|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||

1 Institut für Biologie III, Schänzlestr.1, Albert-Ludwigs-Universität, D-79104 Freiburg im Breisgau, Germany
2 Departmento de Biologia Celular, Molecular e Bioagentes Patogênicos, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Av. Bandeirantes 3900, 14.049-900 Ribeirão Preto-SP, Brazil
3 Department of Zoology, University of Hawaii at Manoa, 2538 McCarthy Mall, Honolulu, HI 96822, USA
* These two authors contributed equally to this work
Author for correspondence (e-mail: kff{at}uni-freiburg.de)
Accepted July 25, 2001
| SUMMARY |
|---|
|
|
|---|
Key words: Drosophila, kirre, duf, rst, irreC, Fusion-competent myoblast, Muscle founder cell, Myoblast fusion
| INTRODUCTION |
|---|
|
|
|---|
Specification of the muscle pattern starts during early embryonic development. After formation of the mesodermal cell layer, the mesoderm becomes subdivided into different cell types based on levels of twist expression: low levels mark future visceral and heart mesoderm, high levels prospective somatic mesoderm (Baylies and Bate, 1996).
In the prospective somatic mesoderm, four cell groups are specified dorsally, dorsolaterally, ventrolaterally and ventrally by the expression of lethal of scute. From each of these groups, one muscle progenitor cell is singled out by lateral inhibition (Carmena et al., 1995). These cells divide asymmetrically and provide the embryo with a subpopulation of myoblasts, the muscle founder cells. The expression of genes such as S59 and krüppel, which specifically affect subsets of muscles, is already switched on in corresponding founder cell subsets. Therefore, the unique character of each future muscle is already programmed into individual founder cells (Frasch, 1999).
The syncytial myotubes form during stages 11-14, when the founder cells fuse with myoblasts of a second class, the fusion-competent myoblasts. These cells do not contribute to the identity of an individual muscles, but rather provide cell material for the outgrowing muscle (Bate, 1990; Rushton et al., 1995).
Based on mutational analysis, several steps in the myoblast fusion process can be distinguished (Paululat et al., 1999): attraction and adhesion of fusion-competent myoblasts to founder cells (blocked in mbc, sns and Df(1)w67k30 mutants (Rushton et al., 1995; Bour et al., 2000; Ruiz-Gomez et al., 2000); alignment of fusion-competent myoblasts and founder cells with paired vesicles on either side of the adjoining membranes (the prefusion complex); the formation of electron-dense plaques; and, finally, vesiculation and membrane breakdown.
For attraction, binding and the initiation of fusion, fusion-competent myoblasts and founder cells need an asymmetric equipment of extracellular membrane-bound components that allows for attraction and discrimination; fusion-competent myoblasts and founder cells fuse only with cells from the other group, rather than with themselves (Baylies et al., 1998). Recently, two genes encoding members of the immunoglobulin superfamily, sns and kirre (kirre was also named dumbfounded) (Ruiz-Gomez et al., 2000), have been reported to show the expected features. Both encode transmembrane cell adhesion molecules involved in myoblast attraction and/or fusion. While Sns is expressed only on fusion-competent myoblasts, but not on founder cells (Bour et al., 2000), kirre is expressed selectively in the latter, but not in fusion-competent myoblasts. We present new data concerning the role of kirre and the involvement of its paralogue rst (Ramos et al., 1993; Reiter et al., 1996) in myoblast fusion.
| MATERIALS AND METHODS |
|---|
|
|
|---|
For misexpression and rescue experiments, we used Df(1)w67k30, Nfa-g (courtesy of S. Artavanis-Tsakonas). The cross for the rescue was Df(1)w67k30, Nfa-g/FM7;+/+;UAS-rst/+ x FM7/Y;twi-Gal4/+;twi-Gal4/+. Lack of epidermal Rst expression was used as a marker for the Df(1)w67k30 chromosome, and remnants of ectopic Rst in the midgut region served as a marker for UAS-rst driven by twi-Gal4.
Cloning of the kirre cDNA
During isolation of the D. virilis orthologue of rst (M. S., unpublished) we serendipitously isolated a related, paralogous sequence. We subsequently identified and cloned the corresponding D. melanogaster sequence, which we named kirre, using RT-PCR based on data of the EDGP (Cosmid 163A10 Accession Number, AL035436) (Benos et al., 2000). The complete kirre cDNA sequence is available in GenBank under the Accession Number AF196553.
RT-PCR
Using the primers 5'-AGCACACCGCTTGAATCAGA-3' and 5'-ACAGATGCAGCACAGCACTTA-3' specific for sequences upstream from the two possible adenylation sites of the annotated kirre open reading frame (Benos et al., 2000), we performed reverse transcription (Superscript II, Life Industries) of 5 µg of total D. melanogaster pupal RNA followed by a RNase H (Life Industries) digestion as described by the manufacturer. Using Pfu turbo DNA-polymerase (Stratagene), 10 µl of the resulting cDNA was used in a 100 µl PCR with 60 pmol of primers that flank the complete kirre ORF (5'-TTAAACATGAGTGGCCAGAGG-3' and 5'-TTGCCGCTGAAAATGAAGCG-3'). PCR conditions were 94°C for 3 minutes, 35 cycles of 94°C for 1 minute, 55°C for 1 minute and 72°C for 12 minutes, and finally 15 minutes at 72°C. PCR was performed in a Robocycler (Stratagene).
The untranslated regions (UTRs) were cloned using the Rapid Amplification of cDNA ends (RACE) protocol as described elsewhere (Dieffenbach and Dveksler, 1995). For the 3'UTR, the adapter primer CCAGTGAGCAGAGTGACGAT15 was used in RT of 5 µg of total pupal RNA as above. Primers for PCR were 5'-CAGAGTCCGTCCGGTCAGTT-3' and 5'-CCAGTGAGCAGAGTGACG-3', and in a nested PCR 5'-GACCTCTGGCCACTCATGTT-3' and 5'-GAGGACTCGAGCTCAAGC-3'.
For the 5'-UTR, the primer 5'-GGCGGAACGAGAACGGTTAG-3' was used in RT of 0.5 µg commercial embryonal polyA-RNA (Clontech) as above. Nested PCRs were performed using 5'-GCGGATAAATGTCCAATGAG-3' and 5'-TGCCGACCATCGAGTAGCGT-3' with adapter primers as above. Amplification products were subcloned into the pCRII-TOPO vector (Invitrogen) and sequenced until all ambiguities were resolved.
Single fly PCR
One to three flies of the relevant genotype were frozen in liquid nitrogen and incubated overnight at 80°C. After addition of 50 µl 1x PCR buffer per fly, the mixture was heated to 94°C for 3 minutes and tissue was mechanically disrupted. The resulting solution (5 µl) was used in a standard 50 µl PCR reaction. Primers specific for kirre were 5'-CTGATCCTGACGCTGCTCCT-3' and 5'-GGCGGAACGAGAACGGTTAG-3'. Primers spanning the presumed transcriptional start site of rst were 5'-CACTCTGACTAATTCACAATG-3' and 5'-GAGTTGAGATCAAAGAGCCCAG-3'. PCR conditions were: 94°C for 3 minutes, 5 cycles of 94°C for 1 minute, 58°C for 2 minutes and 72°C for 40 seconds, and then 30 cycles of 94°C for 30 seconds, 56°C for 40 seconds and 72°C for 40 seconds, followed by 72°C for 10 minutes.
In-situ hybridization
Embryo dechorionation, devitellination and fixation was carried out as previously described (Ashburner, 1989). In situ hybridization was performed as described previously (Oxtoby and Jowett, 1993) and, for probe [K], according to Tautz and Pfeifle (Tautz and Pfeifle, 1989). Probes were selected on the basis of least nucleotide sequence similarity to exclude potential cross-hybridization. For kirre two different probes were used with identical results: probe [K] was isolated using the primers 5'-CAAGAGCGAACAGAGCAAGA-3' and 5'-CATCTGAACATCGGGCATCG-3'. Probe [K intra] was isolated using the primers 5'-GTAATACCGGAGGCATCACG-3' and 5'-TTAAACATGAGTGGCCAGAGG-3'. As for rst, we used a probe isolated using the primers 5'CTGTAAGAAGCGCACCAAGC3' and 5'-GCTAAGTGCCTAACCTAAGC-3'.
Immunocytochemistry and microscopy
Immunocytochemistry was performed as described (Schneider et al., 1995). Antibodies used were against myosin heavy chain (1:1000-1:10,000) (Kiehart and Feghali, 1986), Rst (1:10, mAB24A5.1) (Schneider et al., 1995), ß-3-tubulin (1:1000, provided by R. Renkawitz-Pohl), ß-galactosidase (1:1000, abcam, Cambridge, UK) and GFP (1:250, abcam). Laser scanning microscopy was carried out with Leica TCS-NT and Leica TCS4D microscopes. Data were processed using AMIRA-2.2 (Indeed, Berlin, Germany) and Photoshop (Adobe).
Heat shock treatment
Homozygous pCa18Z
3.1 flies (Moda et al., 2000) were placed on grape juice plates for 1 hour to lay eggs. Eggs were allowed to develop at 25°C for 7 hours and then incubated in a waterbath at 34.5°C for 4 hours. This means that individual embryos were heat-shocked starting at late stage 11 to late stage 12 until late stage 14 to mid stage 15. Controls were treated at 25°C instead of 34.5°C.
| RESULTS |
|---|
|
|
|---|
3.1 flies (Moda et al., 2000) to overexpress a secretable extracellular version of the protein by heat shock induction. Heat shocks applied during stages 12 to 15 induced embryonic lethality. Analysis of these embryos revealed muscle defects (Fig. 1A-D). Secretable Rst interfered with myoblast fusion. In heat shocked pCa18Z
3.1 embryos, the muscles were thinner and more unfused myoblasts could be observed than in heatshocked yw control embryos.
|
Removal or truncation of Rst causes mild muscle defects: rst is not essential for muscle development
As overexpression of Rst causes dramatic muscle defects and lethality, we analysed rst mutants in detail. Loss of Rst protein in rstirreC1 (Schneider et al., 1995) was not lethal. However, embryos homozygous for rstirreC1 did show mild muscle defects. Individual muscles were missing in some, but not in all segments (Fig. 1F, arrowheads). Embryos homozygous for the allele rst6, carrying a truncated version of the intracellular domain of Rst (Ramos et al., 1993), showed thin muscles and sometimes lacked them entirely (Fig. 1G, arrowhead) in some segments. Furthermore, rst6 embryos exhibited muscles in ectopic positions (Fig. 1G, arrow).
kirre, a locus highly related to rst
The kirre locus maps cytogenetically to region 3C6 and lies 3 kb distal to Notch (Fig. 2A). The rst and kirre loci are separated by 127 kb and are transcribed from opposite strands with their 5' flanking regions towards each other (see Fig. 5A). The kirre cDNA consists of 3295 residues and contains a single long open reading frame encoding a protein of 959 amino acids. Algorithms by Sonnhammer et al. (Sonnhammer et al., 1998) and Nielsen et al. (Nielsen et al., 1997) identify a signal peptide sequence (amino acids 7-31) and one putative transmembrane region (amino acids 575-597).
|
|
The intracellular domain of Kirre is considerably longer than that of Rst and displays only low overall homology with the one of Rst. However, three highly conserved motifs were detected (Fig. 2C): One is located close to the transmembrane domain consisting of the sequence PADVI. The second motif, R[Y/F]SAIYGNPYLR(S)[S/T]NSSLLPP, corresponds to the consensus sequence of autophosphorylation domains of receptor tyrosine kinases (Yarden and Ullrich, 1988). The third motif, T[A/H]V, resides at the C terminus of both sequences and corresponds to the consensus sequence of the PDZ-binding motif ([T/S]XV) (Garner et al., 2000). In addition to the site contained in the putative autophosphorylation domain, one putative tyrosine and one putative serine phosphorylation site are conserved between Rst and Kirre (NetPhos 2.0 algorithm) (Blom et al., 1999). A conspicuous difference between the Kirre and Rst proteins is the lack of the opa-like repeat of Rst in Kirre (Ramos et al., 1993).
Similarity searches using the BLAST algorithm showed that the four N-terminal Ig domains of Kirre, Rst, Sns (Bour et al., 2000) and Hibris (GenBank Accession Number, AF210316) are closely related (Fig. 2C). Sns and Hibris have been shown to be involved in muscle development (Bour et al., 2000) (H. A. Dworak and H. Sink, personal communication).
The spatial expression patterns of rst and kirre overlap in muscle founder cells
We performed in situ hybridization using probes specific for kirre and rst, respectively (see Materials and Methods), to identify temporal and spatial expression domains for both genes.
Expression of rst mRNA could be detected in embryonic stages 4 to 14 (Fig. 3A-F) (Ramos et al., 1993). During stage 12, the rst transcript was detected in the majority of mesodermal cells (Fig. 3E). During stages 13 to 14 mesodermal expression of rst could be detected close to the epidermis at positions where muscle founder cells reside (Fig. 3F'out), as well as immediately interior of the founder cells where fusion-competent myoblasts can be found (Fig. 3F, asterisk, Fig. 3F'in). Unlike for kirre, we were never able to identify individual muscle precursors based on rst labelling.
|
A monoclonal antibody against Rst (Schneider et al., 1995) was used to address protein expression in more detail. Crossreactivity of this antibody with Kirre was ruled out by the complete absence of staining of embryos homozygous for the rst null allele rstirreC2 (see Fig. 5A). As the proximal breakpoint of this inversion lies within the second intron of the rst gene, it should leave expression of kirre unimpaired, which resides about 127 kb more proximal. Moreover, staining of wild-type embryos using this antibody reconfirmed rst in situ hybridization patterns.
To determine the myogenic cell types expressing Rst, we used the muscle founder cell-specific enhancer trap line rP298-lacZ (Nose et al., 1998). During embryonic stages 13 to 14, all cells expressing ß-galactosidase also showed Rst staining in their periphery (Fig. 3M), indicating that Rst is expressed by muscle founder cells. As predicted by in situ hybridization, Rst was also detected in mesodermal cells that did not express ß-galactosidase. Morphology and position of these cells suggest that they are fusion-competent myoblasts (Fig. 3M'). The localization of Rst within the membranes of myogenic cells was restricted to discrete spots (Fig. 3M,N).
In rP298-lacZ embryos, fusion-competent myoblasts that have started to fuse with founder cells begin to express ß-galactosidase. This complicates the distinction between the two cell types. To determine whether Rst is expressed in isolated founder cells, we crossed rP298-lacZ into a mbcC1 genetic background (Fig. 3N-O). In mbcC1 embryos, myoblast fusion is almost completely blocked and by stage 16 these embryos display a pattern of isolated, globular, fusion-competent myoblasts and stretched out, fibrous muscle founder cells (Rushton et al., 1995). By stages 13 to 14, antibody staining for ß-galactosidase and Rst revealed a pattern comparable with staining in a wild-type background (Fig. 3N,N'). However, during stages 15 to 16, Rst expression on fusion-competent myoblasts almost completely disappeared, while labelling was pronounced on the cytoplasmic extensions of founder cells (Fig. 3O). Moreover, as rP298lacZ mirrors kirre expression (Ruiz-Gomez et al., 2000), it follows that the expression patterns of rst and kirre overlap.
Muscles attach at specific sites in the epidermis, the apodemes. Rst is also expressed in the apodemes (Fig. 4), as shown by immunodetection of Rst in embryos of the apodeme-specific lacZ-reporter Wß1HI-lacZ (Buttgereit, 1993).
|
As reported previously (Lefevre and Green, 1972; Ramos et al., 1989), both crosses give rise to viable adult flies. We performed single fly PCR on Df(1)N54l9/Y;cosP479BE/+ males to confirm the absence of the kirre locus in Df(1)N54l9. The experiments reproducibly failed to reveal an amplification product using kirre-specific primers (Fig. 2A, arrowheads; Fig. 5B, lane 1), while the same primers gave rise to PCR products on wild-type males (Fig. 5B, lane 3). PCR with rst specific primers used as controls for the integrity of the DNA preparation always showed amplification products on the same Df(1)N54l9/Y; cosP479BE/+ DNA preparations used with the kirre-specific primers (Fig. 5B, lane2) and also on wild-type control males (Fig. 5B, lane 4).
To reveal a putative muscle phenotype of kirre-deficient embryos, we analysed the muscles of non-balanced embryos. We were unable to find defects (Fig. 5C). The GFP balancer we used for selection of the appropriate genotypes (FM7i,P{w+mC=ActGFP}JMR3) does not allow clear distinction between balanced and non-balanced embryos before stage 16-17 because of a strong maternal contribution of GFP. To rule out the possibility of kirre-deficient embryos displaying a muscle phenotype that arrests development before these stages, we analysed 110 embryos resulting from a cross Df(1)N54l9/FM6 x X/Y;cosP479BE by anti-Myosin staining and confocal microscopy. Aside from the expected Notch phenotypes, no defects were detectable with this antibody (data not shown). The deficiency Df(1)N54l9 does not extend into the rst locus, as Df(1)N54l9/rst6 females do not display the rst eye phenotype of rst6 (data not shown).
A kirre, rst double mutant is lethal and shows severe muscle defects
The deficiency Df(1)w67k30 causes embryonic lethality and displays an almost complete lack of myoblast fusion (Fig. 6) (Ruiz-Gomez et al., 2000). The genomic interval removed by Df(1)w67k30 extends from white to kirre. As yet, there is no single embryonic lethal locus known within this region. Hence, the Df(1)w67k30 phenotype could be caused by the removal of two or several loci. Kirre has been shown to be a myoblast attractant expressed on founder cells and reintroduction of kirre can partially rescue the Df(1)w67k30 phenotype (Ruiz-Gomez et al., 2000). Therefore, removal of kirre is partly responsible for the Df(1)w67k30 phenotype. However, as shown above, embryos deficient for a smaller genomic region including kirre do not show a defect in myoblast fusion. Therefore, removal of kirre alone cannot be responsible for the Df(1)w67k30 phenotype. As the situation for rst is similar rst is involved in but not essential for myoblast fusion we conclude that the phenotype of Df(1)w67k30 is caused by the simultaneous removal of the rst and kirre loci.
|
|
|
As Rst is expressed in the apodemes, it remains unclear why fusion-competent myoblasts do not attach to apodeme cells. However, Rst could be detected at sites of ectopic expression in much higher quantities than in the apodemes (Fig. 8M) and closer analysis of different confocal sections revealed that Rst in apodeme cells resides primarily in rings around the apical domains (Fig. 8M,N) of apodeme cells, and not basally, where fusion-competent myoblasts would be suspected to make contact.
| DISCUSSION |
|---|
|
|
|---|
The expression patterns of rst and kirre overlap, but are not identical
Expression patterns of rst and kirre overlap in muscle founder cells. With regard to kirre, our results confirm those of Ruiz-Gomez et al. (Ruiz-Gomez et al., 2000), showing expression in founder cells and muscle precursors. As for rst, the expression is more widespread and includes, in addition to expression in founder cells, fusion-competent myoblasts.
Although Rst immunoreactivity is present in founder cells, we could not unequivocally identify individual outgrowing precursors based on Rst staining, because of subcellular localization and the strong expression of Rst in fusion-competent myoblasts directly adjacent. However, on identification of precursors by staining for ß-3-tubulin, a weak residual Rst immunoreactivity can initially be detected in precursors until the end of stage 13, which fades soon thereafter (data not shown). With regard to the muscle precursors, this downregulation of Rst seems to be dependent on the occurrence of muscle fusion. In contrast to wild type, Rst is still expressed on founder cells at stage 16 in a mbcC1 background (Fig. 3O), where myoblast adhesion is almost completely blocked (Rushton et al., 1995). In fusion-competent myoblasts, however, Rst is downregulated in a mbcC1 background, with large numbers of unfused fusion-competent myoblasts still being present at that stage. This asymmetry in regulation of Rst expression in both cell types is noteworthy. Fusion-dependent downregulation of Rst in muscle precursors could function in size regulation of muscles.
Rst overexpression and mutant phenotypes
Although the rst gene is not essential for muscle fusion, small defects like thinner and missing muscles can be detected in rst6 and rstirreC1 individuals, indicating the involvement of rst in muscle development.
Overexpression of a secretable, extracellular version of Rst during stages when myoblast fusion occurs (stages 12-15) leads to embryonic lethality and defects in myoblast fusion. Mechanistically, the extracellular part of the protein may compete with endogenous Rst for an as yet unknown extracellular ligand or, as the Rst protein has been shown to mediate homophilic cell adhesion (Schneider et al., 1995), the extracellular domain could also bind to endogenous Rst and thereby disturb its function.
Ubiquitous overexpression of the full-length Rst protein also caused embryonic lethality and a severe muscle fusion phenotype. Ectodermal overexpression of Rst did not cause defects in the muscle pattern but ectopic localization and prolonged occurrence of myoblasts at sites of ectopic Rst expression. Mesodermal expression did not induce any detectable phenotype. The reason why global misexpression of Rst differs from misexpression in the mesoderm alone (in most of which Rst is expressed anyway) and from misexpression in the ectoderm alone appears to be the increase of Rst expressing sticky surfaces: the withdrawal of fusion-competent myoblasts from recruiting founders and precursors may considerably lower the probability for these cell types to contact each other.
Some of the defects observed in rst mutants concern muscles in ectopic positions (Fig. 1E,G, arrows). Even though Rst is expressed in the apodemes, our data do not point to an essential role for kirre and/or rst in myotube guidance or attachment: analysis of the subcellular localization shows accumulation of Rst primarily around the apical borders of the apodemes, rather than basally, where outgrowing muscles would be expected to make contact. Moreover, apodeme specification is also not blocked in individuals lacking ectodermal Rst and Kirre, as judged by the muscle pattern (Fig. 7B). Hence, a putative function of Rst in apodeme specification would be redundantly safeguarded by additional as yet unknown factors. Apodeme specification is also not disrupted in da-Gal4/+;UAS-rst/+ embryos, as revealed by antibody staining against Alien (Goubeaud et al., 1996) (data not shown). This clearly rules out the possibility that the strong muscle phenotype observed in these embryos is due to defects in specification of the muscle attachment sites, and argues that restricted expression of Rst is not essential for normal apodeme specification to occur. This is underlined by the fact that 69B-Gal4/+;UAS-rst/+ embryos that express Rst only in the ectoderm do not show attachment defects (data not shown).
Simultaneous deletion of kirre and rst blocks myoblast fusion
The deficiency Df(1)w67k30 deletes the genomic region 3C2-3C6, including rst and kirre. It has been reported previously that Df(1)w67k30 is associated with a lethal myoblast fusion phenotype (Ruiz-Gomez et al., 2000). Our analysis of flies deficient for kirre, but not for rst, revealed that neither kirre nor rst alone are essential for myoblast fusion. Moreover, reintroduction of rst into the mesoderm restored the Df(1)w67k30 phenotype to almost wild-type, as has been shown for kirre (Ruiz-Gomez et al., 2000). Hence, one copy of either rst or kirre is sufficient to restore the wild-type muscle pattern. Furthermore, ectopic expression of Rst mediated ectopic recruitment of fusion-competent myoblasts as has been shown with Kirre (Ruiz-Gomez et al., 2000). Given the overlapping mesodermal expression patterns of rst and kirre, and the significant structural similarity between the two proteins, we conclude that rst and kirre have at least partially redundant functions during muscle development.
Our findings may provide a molecular basis for the findings of Lefevre and Green (Lefevre and Green, 1972), who proposed a genetic duplication between 3C2-5 (the rst locus resides at 3C5) and 3C6: individuals are viable when either one of the regions 3C2-5 or 3C6 is deleted; however, they die when both are missing (Fig. 5A). Even though kirre is now mapped to 3C7 (FlyBase http://flybase.bio.indiana.edu), the mapping data of Lefevre and Green can account for kirre, since other mapping data put the kirre locus into 3C6: the 5' end of Notch was mapped in between 3C6 and 3C7 (Rykowski et al., 1988) and the faswb deletion, which resides in between kirre and Notch (Fig. 2A) (Ramos et al., 1989), has been shown to fuse 3C6 and 3C7 (Keppy and Welshons, 1976).
Rst, Kirre and the fusion machinery
Rst expression in fusion-competent myoblasts is not essential for their attraction towards ectopic Kirre or Rst: myoblasts can be attracted to ectopic sites in a Df(1)w67k30 background, where Rst is only present at ectopic sites and not in fusion-competent myoblasts thus strongly suggesting a heterophilic trans-interaction. However, as Rst has been shown to mediate homophilic cell adhesion (Schneider et al., 1995), a homophilic trans-interaction of Rst may also contribute to the fusion process.
At present, the data do not allow a prediction of the molecular mechanisms in which Rst and Kirre take part; however, it is conceivable that they include the related cell adhesion molecules Sns and Hbs that are expressed on fusion-competent myoblasts (Bour et al., 2000) (H. A. Dworak and H. Sink, personal communication). A model of the fusion machinery may include assembly of adhesion molecules within heteromeric complexes with differing compositions on the side of the fusion-competent myoblasts (including Sns, Hbs and Rst) and on the founder cells (including Kirre and Rst). These complexes may still function after loss of single components. It will need further analysis and binding assays to elucidate how these membrane proteins play together and how they are connected to the other components of the fusion machinery.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Altschul, S. F., Madden, T. L., Schäffer, A. A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389-3402.
Ashburner, M. (1989). Drosophila A Laboratory Manual. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press.
Bate, M. (1990). The embryonic development of larval muscles in Drosophila. Development 110, 791-804.
Bate, M. (1993). The mesoderm and its derivatives. In The development of Drosophila melanogaster. Vol. 2 (ed. M. Bate and A. Martinez-Arias), p. 1013. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press.
Baylies, M. K. and Bate, M. (1996). twist: a myogenic switch in Drosophila. Science 272, 1481-1484.[Abstract]
Baylies, M. K., Bate, M. and Ruiz-Gómez, M. (1998). Myogenesis: a view from Drosophila. Cell 93, 921-927.[Medline]
Benos, P. V., Gatt, M. K., Ashburner, M., Murphy, L., Harris, D., Barrell, B., Ferraz, C., Vidal, S., Brun, C., Demailles, J. et al. (2000). From sequence to chromosome: the tip of the X chromosome of D. melanogaster. Science. 287, 2220-2222.
Blom, N., Gammeltoft, S. and Brunak, S. (1999). Sequence- and structure-based prediction of eukaryotic protein phosphorylation sites. J. Mol. Biol. 294, 1351-1362.[Medline]
Bour, B., Chakravarti, M., West, J. M. and Abmayr, S. M. (2000). Drosophila SNS, a member of the immunoglobulin superfamily that is essential for myoblast fusion Genes Dev. 14, 1498-1511.
Brand, A. H. and Perrimon, N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118, 401-441.[Abstract]
Buttgereit, D. (1993). Redundant enhancer elements guide beta 1 tubulin gene expression in apodemes during Drosophila embryogenesis. J. Cell Sci. 105, 721-727.[Abstract]
Calleja, M., Morena, E., Pelaz, S. and Morata, G. (1996). Visualization of gene expression in living adult Drosophila. Science 274, 252-255.
Campos-Ortega, J. A. and Hartenstein, V. (1997). The Embryonic Development of Drosophila melanogaster. 2nd edn. Berlin-Heidelberg: Springer Verlag.
Carmena, A., Bate, M. and Jiménez, F. (1995). lethal of scute, a proneural gene, participates in the specification of muscle progenitors during Drosophila embryogenesis. Genes Dev. 9, 2373-2383.
Castelli-Gair, J., Greig, S., Micklem, G. and Akam, M. (1994). Dissecting the temporal requirements for homeotic gene function. Development 120, 1983-1995.[Abstract]
Dieffenbach, C. W. and Dveksler, G. S. (1995). PCR primer: A Laboratory Manual. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press.
Frasch, M. (1999). Controls in patterning and diversification of somatic muscles during Drosophila embryogenesis. Curr. Opin. Genet. Dev. 9, 522-529.[Medline]
Garner, C. C., Nash, J. and Huganir, R. L. (2000). PDZ domains in synapse assembly and signalling. Trends Cell Biol. 10, 274-80.[Medline]
Glise, B. and Noselli, S. (1997). Coupling of Jun amino-terminal kinase and decapentaplegic signaling pathways in Drosophila morphogenesis. Genes Dev. 11, 1738-1747.
Goubeaud, A., Knirr, S., Renkawitz-Pohl, R. and Paululat, A. (1996). The Drosophila gene alien is expressed in the muscle attachment sites during embryogenesis and encodes a protein highly conserved between plants, Drosophila and vertebrates. Mech. Dev. 57, 59-68.[Medline]
Grimwade, B., Muskavitch, M. A. T., Welshons, W. J., Yedvobnick, B. and Artavanis-Tsakonas, S. (1985). The molecular genetics of the Notch locus in Drosophila melanogaster. Dev. Biol. 107, 503-519.[Medline]
Keppy, D. O. and Welshons, W. J. (1976). The cytogenetics of a recessive visible mutant associated with a deficiency adjacent to the Notch locus in Drosophila melanogaster. Genetics 85, 497-506.
Kiehart, D. P. and Feghali, R. (1986). Cytoplasmic myosin from Drosophila melanogaster. J. Cell Biol. 103, 1517-1525.
Lefevre, G. Jr. and Green, M. M. (1972). Genetic duplication in the white-split interval of the X chromosome in Drosophila melanogaster. Chromosoma 36, 391-412.[Medline]
Moda, L., Machado, R. and Ramos, R. G. P. (2000). Ubiquitous overexpression of a transgene encoding the extracellular portion of the Drosophila Roughest-Irregular Chiasm C protein induces early embryonic lethality. An. Acad. Bras. Cienc. 72, 381-388.[Medline]
Nielsen, H., Engelbrecht, J., Brunak, S. and von Heijne, G. (1997). Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng. 10, 1-6.
Nose, A., Isshiki, T. and Takeichi, M. (1998). Regional specification of muscle progenitors in Drosophila: the role of the msh homeobox gene. Development 125, 215-223.[Abstract]
Oxtoby, E. and Jowett, T. (1993). Cloning of the zebrafish krox-20 gene (krx-20) and its expression during hindbrain development. Nucleic Acids Res. 21, 1087-1095.
Paululat, A., Holz, A. and Renkawitz-Pohl, R. (1999). Essential genes for myoblast fusion in Drosophila embryogenesis. Mech. Dev. 83, 17-26.[Medline]
Perlman, J. (1983). One side of a deletion breakpoint from the Drosophila melanogaster genome contains a transposable element. Gene 21, 87-94.[Medline]
Ramos, R. G. P., Grimwade, B. G., Wharton, K. A., Scottgale, T. N. and Artavanis-Tsakonas, S. (1989). Physical and functional definition of the Drosophila Notch locus by P element transformation. Genetics 123, 337-348.
Ramos, R. G. P., Igloi, G. L., Lichte, B., Baumann, U., Maier, D., Schneider, T., Brandstätter, J. H., Fröhlich, A. and Fischbach, K.-F. (1993). The irregular chiasm C-roughest locus of Drosophila, which affects axonal projections and programmed cell death, encodes a novel immunoglobulin-like protein. Genes Dev. 7, 2533-2547.
Reiter, C., Schimansky, T., Nie, Z. and Fischbach, K. F. (1996). Reorganization of membrane contacts prior to apoptosis in the Drosophila retina: the role of the IrreC-rst protein. Development 122, 1931-1940.[Abstract]
Ruiz-Gómez, M., Coutts, N., Price, A., Taylor, M. V. and Bate, M. (2000). Drosophila dumbfounded: a myoblast attractant essential for fusion. Cell 102, 189-198.[Medline]
Rushton, E., Drysdale, F., Abmayr, S. M., Michelson, A. M. and Bate, M. (1995). Mutations in a novel gene, myoblast city, provide evidence in support of the founder cell hypothesis for Drosophila muscle development. Development 121, 1979-1988.[Abstract]
Rykowski, M. C., Parmelee, S. J., Agard, D. A. and Sedat, J. W. (1988). Precise determination of the molecular limits of a polytene chromosome band: Regulatory sequences for the Notch gene are in the interband. Cell 54, 461-472.[Medline]
Schneider, T., Reiter, C., Eule, E., Bader, B., Lichte, B., Nie, Z., Schimansky, T., Ramos, R. G. P. and Fischbach, K. F. (1995). Restricted expression of the Rst protein is required for normal axonal projections of columnar visual neurons. Neuron 15, 259-271.[Medline]
Sonnhammer, E. L. L., van Heijne, G. and Krogh, A. (1998). A hidden Markov model for predicting transmembrane helices in protein sequences. In Proceedings of the Sixth International Conference on Intelligent Systems for Molecular Biology (ed. J. Glasgow, T. Littlejohn, F. Major, R. Lathrop, D. Sankoff and C. Sensen), pp. 175-182. Menlo Park, CA: AAAI Press.
Tautz, D. and Pfeifle, C. (1989). A non-radioactive in situ hybridization method for the localization of specific RNAs in Drosophila embryos reveals translational control of the segmentation gene hunchback. Chromosoma 98, 81-85.[Medline]
Walsh, F. S. and Doherty, P. (1997). Neural cell adhesion molecules of the immunoglobulin superfamily: role in axon growth and guidance. Annu. Rev. Cell Dev. Biol. 13, 425-456.[Medline]
Wodarz, A., Hinz, U., Engelbert, M. and Knust, E. (1995). Expression of crumbs confers apical character on plasma membrane domains of ectodermal epithelia of Drosophila. Cell 82, 67-76.[Medline]
Yarden, Y. and Ullrich, A. (1988) Growth factor receptor tyrosine kinases. Annu. Rev. Biochem. 57, 443-478.[Medline]
This article has been cited by other articles:
![]() |
S. Berger, G. Schafer, D. A. Kesper, A. Holz, T. Eriksson, R. H. Palmer, L. Beck, C. Klambt, R. Renkawitz-Pohl, and S.-F. Onel WASP and SCAR have distinct roles in activating the Arp2/3 complex during myoblast fusion J. Cell Sci., April 15, 2008; 121(8): 1303 - 1313. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Carrasco-Rando and M. Ruiz-Gomez Mind bomb 2, a founder myoblast-specific protein, regulates myoblast fusion and muscle stability Development, March 1, 2008; 135(5): 849 - 857. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Kocherlakota, J.-m. Wu, J. McDermott, and S. M. Abmayr Analysis of the Cell Adhesion Molecule Sticks-and-Stones Reveals Multiple Redundant Functional Domains, Protein-Interaction Motifs and Phosphorylated Tyrosines That Direct Myoblast Fusion in Drosophila melanogaster Genetics, March 1, 2008; 178(3): 1371 - 1383. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. E. Richardson, K. Beckett, S. J. Nowak, and M. K. Baylies SCAR/WAVE and Arp2/3 are crucial for cytoskeletal remodeling at the site of myoblast fusion Development, December 15, 2007; 134(24): 4357 - 4367. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Moore, C. A. Parkin, Y. Bidet, and P. W. Ingham A role for the Myoblast city homologues Dock1 and Dock5 and the adaptor proteins Crk and Crk-like in zebrafish myoblast fusion Development, September 1, 2007; 134(17): 3145 - 3153. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Balagopalan, M.-H. Chen, E. R. Geisbrecht, and S. M. Abmayr The CDM Superfamily Protein MBC Directs Myoblast Fusion through a Mechanism That Requires Phosphatidylinositol 3,4,5-Triphosphate Binding but Is Independent of Direct Interaction with DCrk Mol. Cell. Biol., December 15, 2006; 26(24): 9442 - 9455. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. R. Doherty, A. Cave, D. B. Davis, A. J. Delmonte, A. Posey, J. U. Earley, M. Hadhazy, and E. M. McNally Normal myoblast fusion requires myoferlin Development, December 15, 2005; 132(24): 5565 - 5575. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. D. Menon, Z. Osman, K. Chenchill, and W. Chia A positive feedback loop between Dumbfounded and Rolling pebbles leads to myotube enlargement in Drosophila J. Cell Biol., June 20, 2005; 169(6): 909 - 920. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. H. Chen and E. N. Olson Unveiling the Mechanisms of Cell-Cell Fusion Science, April 15, 2005; 308(5720): 369 - 373. [Abstract] [Full Text] [PDF] |
||||