|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
European Molecular Biology Laboratory, Meyerhofstr 1, 69117 Heidelberg, Germany
*Author for correspondence (e-mail: cohen{at}embl-heidelberg.de)
Accepted August 24, 2001
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTS AND DISCUSSIONREFERENCES |
|---|
Key words: Apterous, dLMO, Homeodomain, LIM domain, Wing development
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTS AND DISCUSSIONREFERENCES |
|---|
Apterous protein (Ap) is a LIM-homeodomain transcription factor. LIM-domains are cysteine-rich zinc-finger domains that mediate protein-protein interactions (Jurata and Gill, 1998). Evidence has been presented that the LIM domains block DNA-binding activity of the homeodomain. The Xenopus Ldb1 protein was identified as a cofactor for the LIM-homeodomain Xlim1 by virtue of binding to the LIM domains (Agulnik et al., 1996). The Drosophila homolog of Ldb1 is called dLDB or Chip (Morcillo et al., 1997; Fernandez-Funez et al., 1998). Chip provides both a self-interacting dimerization domain and a LIM-interaction domain that binds to the LIM domains of Ap and other proteins (Jurata et al., 1998). A dimer of dLDB/Chip has been shown to bridge two Ap molecules to form a tetrameric complex, which is active in vivo (Milán and Cohen, 1999; van Meyel et al., 1999; Rincon-Limas et al., 2000).
Ap activity levels are temporally regulated during wing development (Milán and Cohen, 2000). Ap negatively regulates its own activity by inducing the expression of the Beadex/dLMO gene during third instar (Milán et al., 1998; Shoresch et al., 1998; Zeng et al., 1998). Beadex/dLMO encodes a LIM-domain containing protein of the LIM-only type, called dLMO. dLMO protein contains two LIM domains with sequences highly similar to the LIM domains of Ap. dLMO has been shown to bind to Chip, and to compete for binding between Chip and Ap, thereby inactivating Ap (Milán et al., 1998; Milán and Cohen, 1999; van Meyel et al., 1999).
The spatially and temporally restricted expression of dLMO limits the time window during which the induction of the DV organizer can take place. Early in development, Apterous induces expression of the fringe and Serrate genes and represses Delta in D cells (Irvine, 1999). Apterous subsequently induces expression of dLMO, which reduces Ap activity levels and leads to downregulation of Serrate and Fringe, and allows dorsal expression of Delta. Therefore, loss of dLMO leads to overexpression of Serrate, to reduced expression of Delta and to concomitant defects in differentiation and cell survival in the wing primordium (Milán and Cohen, 2000). All of these phenotypes have been shown to be due to excess Ap activity. Thus dLMO serves as an important regulator of Ap activity during wing development.
The model that dLMO acts as a competitive inhibitor of Ap suggests that dLMO should displace Ap from Chip. We present evidence that Ap protein is destabilized in cells expressing dLMO. Interestingly, Ap appears to be destabilized in situations where it is unable to bind to DNA in active tetrameric complexes with Chip. Previous studies have suggested that dLMO competes effectively with Ap for binding to Chip, whereas Ap competes poorly with dLMO. A possible explanation for this behavior is an intrinsic difference in the affinities of the LIM domains from Ap and dLMO proteins for Chip. We addressed this possibility by replacing the LIM domains of Ap with those of dLMO, to generate an Ap-dLMO fusion protein. This fusion protein has Ap activity and unlike the endogenous Ap protein, competes effectively with dLMO in vivo. These observations support the view that dLMO is a potent inhibitor of Ap activity because it binds Chip more effectively and therefore provide an explanation for the long-standing puzzle that overexpression of Apterous cannot cause an increase in Apterous activity in vivo.
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTS AND DISCUSSIONREFERENCES |
|---|
-glycoprotein subunit promoter, that have been shown to bind Ap (Rincon-Limas et al., 2000).
Imaginal disc culture
Wild-type mid-third instar larvae were incubated in cl-8 cell medium for three hours before fixation and staining. For treatment with MG-132, discs were cultured in medium containing 10 µM MG132 (experimental discs) or an equal volume of DMSO (control discs).
Drosophila expression constructs
UAS-dLAp-flag was prepared by PCR, generating three overlapping pieces: the N-terminal Ap part (amino acids 1-148) was amplified using primers (Ap N-ter top) 5' TCCGAATTCCACACATGGGCGTCTGCACC 3' and (Ap N-ter bottom) 5' GCCGCAGCCTGCACAGTCGTCGAGGTTTCG 3' from an ap cDNA template; the LIM-domains of dLMO (amino acids 92-192) were amplified using (dLMO top) 5' CGAAACCTCGACGACTGTGCAGGCTGCGGC 3' and (dLMO bottom) 5' CTGGTCTCCCTTTGTGAATCTGTGGTTACA 3'; and the C-terminal part of Ap (246-469) was generated by PCR with (Ap C-ter top) 5' TGTAACCACAGATTCACAAAGGGAGACCAG 3' and (Ap C-ter bottom) 5' GTCGCGGCCGCCGTCCAAGTTAAGTGGTGG 3'. All three pieces were mixed and used as a template for PCR with the primers Ap N-ter top and Ap C-ter bottom. The resulting product was cut with EcoRI and NotI and cloned into pUAST (Brand and Perrimon, 1993) carrying the flag epitope. pUAST-flag was generated by annealing the oligos 5' GGCCGCGACTACAAGGACGACGATGACAAGTAACCTAC 3' and 5' CTTACTTGTCATCGTCGTCCTTGTAGTCGC 3' and inserting them between the NotI and KpnI sites of pUAST. The dLAp-flag ORF was entirely sequenced to verify correct synthesis.
Drosophila strains
apGal4 has been described previously (Calleja et al., 1996). apUGO35 and aprk568 (apterous-lacZ) have been described previously (Cohen et al., 1992). hdpR590, MS1096 and UAS-dLMO have been described previously (Milán et al., 1998). UAS-ChAp and UAS-Chip
LID have been described previously (Milán and Cohen, 1999). dLMO39was generated by imprecise excision of the Gal4 element of MS1096 as described previously (Milán et al., 1998). dLMO39 is a hypomorphic allele of dLMO that does not affect cell survival in mutant clones (as opposed to dLMOR590). Chipe5.5 has been described previously (Morcillo et al., 1997).
Genotypes of crosses
dLMO39 loss-of-function clones: armlacZFRT18/armlacZFRT18; hsFlp/hsFlp x dLMO39 FRT18/Y
dLMO39 clones in ap-lacZ background: UbiGFPFRT18/FM6; hsFlp/CyO x dLMO39 FRT18/Y; aprk568 /+
dLMO gain-of-function clones: hsFlp/Y; uas-dLMO/SM6-TM6 x Act>CD2>Gal4 uas-GFP/ Act>CD2>Gal4 uas-GFP
Chipe5.5 loss-of-function clones: hsFlp/hsFlp; FRT42 armlacZ/FRT42 armlacZ x FRT42 Chipe5.5/CyO
Antibodies
Guinea-pig anti-Ap was generated using recombinant Ap protein produced in E coli, as described (Milán et al., 1998). Although it was raised against the whole Ap protein, this antibody does not recognize the fusion protein ChAp. As the homeodomain is highly conserved across species, we speculate that is does not constitute a very efficiently recognized epitope and therefore only the LIM domains or other parts of the protein, which are conserved to a lesser extent, were antigenic. Rat anti-Serrate and rat anti-dLMO were produced using recombinant proteins produced in E coli. Mouse anti-Wg was from Brook and Cohen (Brook and Cohen, 1996). Rabbit anti-ß-galactosidase (Cappell). Rabbit anti-Ci was from C. Schwartz.
|
RESULTS AND DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTS AND DISCUSSIONREFERENCES |
|---|
39(Fig. 2A). The increased level of Ap protein in the clone was similar to the level detected in the hinge. Clones of dLMO39 mutant cells were also generated in larvae carrying an ap-lacZ reporter gene. ß-Gal expression by the reporter gene reflects the level of ap transcription. Ap protein was increased in the mutant clones, but ß-gal expression was unaffected (Fig. 2B). This confirms that the effect of removing dLMO on Ap protein level is not due to increased expression of ap transcript.
|
|
|
LID. Ap protein levels were reduced in cells expressing ChipLID but ap-lacZ levels were unaffected (Fig. 4B). Thus, loss of Chip leads to reduced levels of Ap protein. We note that Chip mutant clones also lack dLMO expression (Milán and Cohen, 2000). Thus, loss of Ap protein in Chip mutant clones does not correlate with expression of dLMO, as in wild-type cells. Rather, reduction of Ap levels correlates with the availability of Chip as a binding partner. This suggested that binding to Chip contributes to stabilization of Ap.
|
LID is capable of binding to full-length Chip through its dimerization domain, but cannot bind to Ap (illustrated in Fig 8A,B). Consequently, ChipLID leads to formation of trimeric complexes and thereby blocks Ap activity in vivo (Milán and Cohen, 1999; van Meyel et al., 1999). The observation that ChipLID led to reduced Ap stability without affecting ap-lacZ expression suggested that stabilization might require formation of tetrameric complexes between Chip and Ap. The tetrameric form of Chip and Ap is thought to be the active DNA-binding complex. Overexpression of ChipLID does not decrease the availability of LIM-binding sites in wild-type Chip, but does compete for tetramer formation. This raised the possibility that Ap stability might depend on whether it is able to form a DNA-binding complex with Chip. If Ap stability decreases when it is unable to bind DNA, we reasoned that providing additional binding sites might stabilize the protein. To test this possibility we turned to a cell culture system in which we could vary the number of Ap-binding sites by transfection. We first verified that co-expression of dLMO would decrease Ap stability in transfected cells. A constant amount of a plasmid directing expression of a Myc-tagged Ap protein was co-transfected with varying amounts of a plasmid directing expression of myc-tagged dLMO (Fig. 5A). As observed in the wing disc, overexpressed dLMO reduced Ap protein levels in S2 cells. We note that high levels of dLMO are required to reduce Ap levels. The relative levels of the two proteins can be directly compared in this assay by virtue of the myc-epitope tag. Comparison of relative levels of the endogenous proteins is not possible.
|
Another means to test this possibility is by competition between Ap and a related protein for a fixed number of binding sites. For these experiments we made use of a fusion protein between Chip and Ap (called ChAp). In this protein the dimerization domain of Chip mediates dimerization of the DNA-binding domains of Ap (illustrated in Fig 8C). Thus, ChAp dimers should compete with endogenous Chip:Ap tetramers for DNA-binding sites. Use of the Myc tag versions of both proteins allowed direct comparison of their relative levels in co-transfected cells. Using this assay we verified that increasing the level of ChAp-myc decreased the level of co-transfected Ap-myc in a dose-dependent manner (Fig. 5C). Expression of Chip-myc as a control had little effect on Ap-myc levels (not shown). Note that the level of Ap-myc construct was held constant in all samples. ChAp-myc and Chip-myc expression levels were controlled by varying the ratio of the expression constructs to the empty expression vector in the transfections.
We next asked whether competition for DNA-binding sites would affect Ap stability in the wing disc. Fortuitously, the antibody raised against Ap does not recognize ChAp. This allows us to measure the level of the endogenous Ap protein in cells expressing ChAp. ChAp expression under dppGal4 control led to a decrease in the level of endogenous Ap protein (Fig. 4C). Together, these observations suggest that Ap protein is unstable in vivo unless bound to DNA as part of an active complex with its co-factor Chip (Fig. 8A; for simplicity, the illustration depicts selective degradation of Ap monomers; it is equally plausible that Ap:Chip complexes of any stoichiometry are more susceptible to degradation when they are not bound to DNA).
|
|
To ask whether overexpression of dLAp in dorsal cells would compete effectively with dLMO to produce a net increase in Ap activity levels, we compared wing development in flies expressing dLAp or Ap under apGal4 control. Ap overexpressing wings were normal (not shown). In apGal4/+; uas-dLAp/+ flies we observed defects in wing veins, especially in the posterior crossvein and vein 5, and a held up wing phenotype (Fig. 7A,B). These defects resemble the dLMO mutant phenotype, which has been shown to be due to excess Ap activity (Shoresch et al., 1998; Milán et al., 1998). Another feature of dLMO mutant wings is overexpression of Serrate in the D compartment. Overexpression of wild-type Ap under apGal4 control did not cause abnormal Serrate expression (Fig. 7C); however, expression of dLAp in apGal4/+; uas-dLAp/+ wing discs induced ectopic Serrate in the dorsal compartment and caused mild reduction of the D compartment (Fig. 7D). Similar, though somewhat stronger effects were obtained by overexpression of the Chip/Ap fusion protein ChAp, which is insensitive to competition by dLMO (Milán and Cohen, 1999). Thus, dLAp expression can increase Ap activity to levels above normal in the presence of dLMO.
|
Competition for Chip in formation of different complexes
In this report we have addressed the problem of asymmetry in the competition between dLMO and Ap. The simplest model for competitive inhibition by dLMO would suggest that Ap should compete effectively with dLMO for binding to Chip when overexpressed. However, overexpression of Ap does not produce an excess of Ap activity. dLMO competes effectively for Ap activity, but the reverse is not true. Our finding that swapping the LIM domains of Ap for those of dLMO produces a functional Ap protein that is able to compete effectively with dLMO may provide an explanation for the non-reciprocal properties of Ap and dLMO. We attribute the effectiveness of dLMO as an inhibitor of Ap activity to an intrinsic difference in the ability of the LIM domains of these two proteins to bind to Chip. We consider it likely that the LIM domains of dLMO bind the LID of Chip with higher affinity than the LIM domains of Ap. However, we have not been able to produce these proteins in soluble form at adequate concentrations and so were unable to determine the affinities of these binding interactions directly.
Other proteins might also contribute to stabilization of Chip-dLMO complexes or to destabilization of Chip-Ap complexes in vivo. Interactions involving Ap, Chip and other proteins have been reported. For example, Pannier interacts with Chip and competes with Apterous for patterning of the thorax (Ramain et al., 2000). In this model, Chip is found in a complex with Pannier and dLMO, which promotes dorsal thorax formation. Chip is also found in a complex with Ap. The level of Chip is not in great excess, so competition occurs between Ap and Pannier for formation of Chip complexes, despite the fact that Pannier and Ap do not bind to Chip in the same way. We noted that overexpression of dLAp-flag appears to interfere with Pannier complex formation, because it causes the formation of a cleft in the thorax, resembling a pannier loss-of-function mutant phenotype (data not shown). Comparable overexpression of Ap does not do so. This suggests that dLAp competes more effectively than Ap for binding to Chip and so is more effective at sequestering Chip from Pannier-containing complexes. The relative affinity of these proteins appears to play an important role in maintaining the proper balance of complex formation in vivo. Numerous LIM-HD proteins have been found to play important roles in development of a number of species (Hobert and Westphal, 2000). It seems likely that other LIM-homeodomain transcription factors will be regulated in similarly complex ways.
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTS AND DISCUSSIONREFERENCES |
|---|
Agulnik, A. D., Taira, M., Breen, J. J., Tanaka, T., Dawid, I. B. and Westphal, H. (1996). Interactions of the LIM-domain binding factor Ldb1 with LIM homeodomain proteins. Nature 384, 270-272.[Medline]
Blair, S. S., Brower, D. L., Thomas, J. B. and Zavortink, M. (1994). The role of apterous in the control of dorsoventral compartmentalization and PS integrin gene expression in the developing wing of Drosophila. Development 120, 1805-1815.[Abstract]
Brand, A. and Perrimon, N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118, 401-415.[Abstract]
Brook, W. J. and Cohen, S. M. (1996). Antagonistic interactions between wingless and decapentaplegic responsible for dorsal-ventral pattern in the Drosophila leg. Science 273, 1373-1377.[Abstract]
Brückner, K., Perez, L., Clause, H. and Cohen, S. M. (2000). Glycosytransferase activity of Fringe modulates Notch-Delta interactions. Nature 406, 411-416.[Medline]
Calleja, M., Moreno, E., Pelaz, S. and Morata, G. (1996). Visualization of gene expression in living adult Drosophila. Science 274, 252-255.
Cohen, B., McGuffin, M. E., Pfeifle, C., Segal, D. and Cohen, S. M. (1992). apterous: a gene required for imaginal disc development in Drosophila encodes a member of the LIM family of developmental regulatory proteins. Genes Dev. 6, 715-729.
Di Nocera, P. P. and Dawid, I. B. (1983). Transient expression of genes introduced into cultured cells of Drosophila. Proc. Natl. Acad. Sci. USA 80, 7095-7098.
Diaz-Benjumea, F. J. and Cohen, S. M. (1993). Interaction between dorsal and ventral cells in the imaginal disc directs wing development in Drosophila. Cell 75, 741-752.[Medline]
Fernandez-Funez, P., Lu, C. H., Rincon-Limas, D. E., Garcia-Bellido, A. and Botas, J. (1998). The relative expression amounts of apterous and its co-factor dLdb/Chip are critical for dorso-ventral compartmentalization in the Drosophila wing. EMBO J. 6846-6853.
García-Bellido, A., Ripoll, P. and Morata, G. (1973). Developmental compartmentalisation of the wing disk of Drosophila. Nature 245, 251-253.
Hobert, O. and Westphal, H. (2000). Functions of LIM-homeobox genes. Trends Genet. 16, 75-83.[Medline]
Irvine, K. D. (1999). Fringe, Notch, and making developmental boundaries. Curr. Opin. Genet. Dev. 9, 434-441.[Medline]
Jurata, L. W. and Gill, G. N. (1998). Structure and function of LIM domains. Curr. Top. Microbiol. Immunol. 228, 75-113.[Medline]
Jurata, L. W., Pfaff, S. L. and Gill, G. N. (1998). The nuclear LIM domain interactor NLI mediates homo- and heterodimerization of LIM domain transcription factors. J. Biol. Chem. 273, 3152-3157.
Milán, M. and Cohen, S. M. (1999). Regulation of LIM homeodomain activity in vivo: A tetramer of dLDB and Apterous confers activity and capacity for regulation by dLMO. Mol. Cell 4, 267-273.[Medline]
Milán, M. and Cohen, S. M. (2000). Temporal regulation of apterous activity during development of the Drosophila wing. Development 127, 3069-3078.[Abstract]
Milán, M., Diaz-Benjumea, F. and Cohen, S. M. (1998). Beadex encodes an LMO protein that regulates Apterous LIM-homeodomain activity in Drosophila wing development: a model for LMO oncogene function. Genes Dev. 12, 2912-2920.
Milán, M., Weihe, U., Tiong, S., Bender, W. and Cohen, S. M. (2001). msh specifies dorsal cell fate in the Drosophila wing. Development 128, 3263-3268.
Morcillo, P., Rosen, C., Baylies, M. K. and Dorsett, D. (1997). Chip, a widely expressed chromosomal protein required for segmentation and activity of a remote wing margin enhancer in Drosophila. Genes Dev. 11, 2729-2740.
O’Keefe, D. D., Thor, S. and Thomas, J. B. (1998). Function and specificity of LIM domains in Drosophila nervous system and wing development. Development 125, 3915-3923.[Abstract]
Ramain, P., Khechumian, R., Khechumian, K., Arbogast, N., Ackermann, C. and Heitzler, P. (2000). Interactions between chip and the achaete/scute-daughterless heterodimers are required for pannier-driven proneural patterning. Mol. Cell 6, 781-790.[Medline]
Rincon-Limas, D. E., Lu, C. H., Canal, I. and Botas, J. (2000). The level of DLDB/CHIP controls the activity of the LIM homeodomain protein apterous: evidence for a functional tetramer complex in vivo. EMBO J. 19, 2602-2614.[Medline]
Shoresch, M., Orgad, S., Schmueli, O., Werczberrger, R., Gelbaum, D., Abiri, S. and Segal, D. (1998). Overexpression Beadex mutations and loss of function heldup-a mutations in Drosophila affect the 3' regulatory and coding components, respectively, of the Dlmo gene. Genetics 150, 283-299.
van Meyel, D. J., O’Keefe, D. D., Jurata, L. W., Thor, S., Gill, G. N. and Thomas, J. B. (1999). Chip and apterous physically interact to form a functional complex during Drosophila development. Mol. Cell 4, 259-265.[Medline]
Wang, Q. T. and Holmgren, R. A. (2000). Nuclear import of cubitus interruptus is regulated by hedgehog via a mechanism distinct from Ci stabilization and Ci activation. Development 127, 3131-3139.[Abstract]
Zeng, C., Justice, N. J., Abdelilah, S., Chan, Y. M., Jan, L. Y. and Jan, Y. N. (1998). The Drosophila LIM-only gene, dLMO, is mutated in Beadex alleles and might represent an evolutionarily conserved function in appendage development. Proc. Natl. Acad. Sci. USA 95, 10637-10642.
This article has been cited by other articles:
|
|
 |
|
  P. Hari, M. Deshpande, N. Sharma, N. Rajadhyaksha, N. Ramkumar, K.-i. Kimura, V. Rodrigues, and S. Tole Chip Is Required for Posteclosion Behavior in Drosophila J. Neurosci., September 10, 2008; 28(37): 9145 - 9150. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Zenvirt, Y. Nevo-Caspi, S. Rencus-Lazar, and D. Segal Drosophila LIM-Only Is a Positive Regulator of Transcription During Thoracic Bristle Development Genetics, August 1, 2008; 179(4): 1989 - 1999. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Milan and S. M. Cohen A re-evaluation of the contributions of Apterous and Notch to the dorsoventral lineage restriction boundary in the Drosophila wing Development, February 1, 2003; 130(3): 553 - 562. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-H. Chen, J. W. Yip, A. F. R. Stewart, and E. Frank Differential expression of a transcription regulatory factor, the LIM domain only 4 protein Lmo4, in muscle sensory neurons Development, January 11, 2002; 129(21): 4879 - 4889. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
