|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||

1 Department of Pediatrics, University of Michigan, Ann Arbor, MI 48109, USA
2 Department of Pathology, University of Michigan, Ann Arbor, MI 48109, USA
* These authors contributed equally to this work
Author for correspondence (e-mail: dressler{at}umich.edu)
Accepted August 31, 2001
| SUMMARY |
|---|
|
|
|---|
Key words: Pax2, GDNF, Kidney Development, Ureteric Bud, RET signaling, BMP4, Mouse
| INTRODUCTION |
|---|
|
|
|---|
1 (Gfra1 Mouse Genome Informatics) (Cacalano et al., 1998) and the RET tyrosine kinase (Schuchardt et al., 1994; Schuchardt et al., 1996). At that time, GDNF is expressed in the posterior intermediate mesoderm, the presumptive metanephric mesenchyme, whereas RET localizes to the nephric duct (Pachnis et al., 1993). GFR
1 is expressed in both mesenchymal and epithelial compartments of the developing kidney (Sainio et al., 1997). Mice homozygous for null mutations in Ret (Schuchardt et al., 1994), Gfra1 (Cacalano et al., 1998) or Gdnf (Moore et al., 1996; Pichel et al., 1996; Sanchez et al., 1996) exhibit similar phenotypes, with near complete renal agenesis caused by a block in ureteric bud outgrowth. GDNF can activate the catalytic domain of RET and stimulate branching morphogenesis of the ureteric bud (Vega et al., 1996). Indeed, GDNF can function as a chemoattractant for RET-expressing epithelial cells (Tang et al., 1998). Thus, GDNF is a target-derived guidance cue that assures correct outgrowth and invasion of the ureteric bud into the metanephric mesenchyme. Failure to control the position of ureteric bud growth and subsequent branching morphogenesis can underlie a variety of syndromes, from complete renal agenesis to more subtle defects, such as double or bifurcated ureters, vesicoureteral reflux, or CAKUT (Pope et al., 1999). The metanephric mesenchyme is specified before induction by the ureteric bud. By E11, the mesenchyme appears as a morphologically distinct aggregate of cells that express several unique molecular markers. The Wilms tumor suppressor gene Wt1 is expressed in the mesenchyme before induction and is necessary for cell survival and the ability of the mesenchyme to respond to inductive signals (Kreidberg et al., 1993). The Pax2 gene is expressed in the nephric duct and in the epithelial tubules of the mesonephros (Dressler et al., 1990; Dressler and Douglass, 1992). In the developing metanephros, Pax2 is expressed in the mesenchymal cells directly adjacent to the ureteric bud and in the early epithelial derivatives of these mesenchymal cells. Homozygous embryos carrying a Pax2 null allele exhibit nephric duct growth and extension but fail to form mesonephric tubules (Torres et al., 1995), derived from the more anterior periductal mesenchyme. Pax2 mutants also do not have a ureteric bud, although the metanephric mesenchyme can be observed morphologically. Pax2 encodes a nuclear protein that binds DNA through a conserved paired-domain and activates transcription through a C-terminal domain rich in proline, serine and threonine (Lechner and Dressler, 1996). Pax2 can activate expression of heterologous promoters that consist of multiple engineered Pax2-binding sites. However, genes expressed in the developing kidney that are under the control of Pax2 have remained elusive.
In this report, we examine the relationship between Pax2 and GDNF. Through the use of mutants in RET, we demonstrate that Pax2 is expressed in the metanephric mesenchyme before induction by the ureteric bud. Experiments with Pax2 mutants demonstrate that within the uninduced mesenchyme, Pax2 is necessary for expression of GDNF. Yet, failure to express GDNF is not the sole cause for the ureteric bud defects in Pax2 mutant embryos. Pax2 can activate GDNF in cultured mesenchymal cells derived from the embryonic kidney. Furthermore, GDNF promoter sequences upstream of the translation start site contain a Pax2-binding site that confers Pax2-dependent activation upon a reporter gene in transfected cells. Thus, Pax2 regulation of GDNF expression establishes a link between the control of mesenchymal pattering and signaling to the nephric duct epithelium in the developing kidney.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Whole-mount antibody staining of E11.5 kidneys and organ cultures was as described previously (Cho et al., 1998). Briefly, tissues were fixed in methanol for 10 minutes. and washed twice for 10 minutes. in PBS, 0.1% Tween-20 (PBST). Anti-Pax2 (0.5 mg/ml) and anti-Pan-cytokeratin (Sigma, 1:50) antibodies were diluted in PBST, 2% goat serum and incubated for 3-4 hours at 4°C. Tissues were washed in PBST four times for 1 hour each with one wash overnight at 4°C. The second antibodies, FITC-anti-mouse (Sigma) and TRITC-anti-rabbit (Sigma), were used at 1:100 dilution in PBST, 2% goat serum and incubated for 3 hours. After extensive washing, the samples were placed on slides and covered with gelvatol.
For genotyping, DNA was extracted from embryo yolk sacs by overnight proteinase K digestion in 100 mM NaCl, 10 mM Tris (pH 8.0), 1% SDS at 56°C. Tissues were then treated with RNase at 37°C for 1 hour, extracted with phenol:chloroform, isopropyl alcohol precipitated, washed with 75% ethanol and dissolved in water. Pax2 genotyping was performed by EcoR1 digestion and southern blot analysis using a 1.7 kb NotI/PstI fragment, which spanned the 5' regulatory sequences and exon 1. PCR was used for Ret genotyping using the primers: Ret P1, TGGGAGAAGGCGAGTTTGGAAA; RetP2, TTCAGGAACACTGGCTACCATG; NeoP3, AGAGGCTATTCGGCTATGACTG; and Neo P4, CCTGATCGACAAGACCGGCTTC.
Expression analysis of GDNF
Whole-mount in situ hybridization was preformed as described (Wilkinson, 1992). To allow better penetration of the GDNF probe the nephrogenic tubules, duct and mesonephric mesenchyme were dissected from E11.5 Pax2/ null mutants and wild-type embryos for whole-mount analysis. The tissues were fixed in 4% paraformaldehyde (PFA) overnight at 4°C, dehydrated through a PBTX/methanol series, and stored at 20°C until required.
The tissues were rehydrated, treated with proteinase K, re-fixed with 0.2% gluteraldehyde/4% PFA and hybridized overnight at 65°C. The following day the tissues were washed and preblocked with 10% lamb serum, 2%BSA in TBTX. The preabsorbed anti-digoxigenin (DIG) antibody was incubated overnight at 4°C. The samples were then washed for 2 days and color was developed with NBT (4-nitro blue tetrazolium chloride) and BCIP (X-phosphate/5-Bromo-4-chloro-3indolyl-phosphate) in NTMT (pH9.5). Pictures were taken through a Nikon Eclipse E800 with a Diagnostic Instruments SPOT digital camera.
For RT-PCR, metanephric mesenchymes were dissected from E11.5 wild-type, Pax2+/, Pax2/, and Ret null mutants. The RNA was isolated with Trizol (Life Technologies, Bethesda, MA). The Titan one step RT-PCR kit (Roche) was used with dilutions of input RNA. To detect GDNF mRNA, the forward primer was: 5'GTTATGGGATGTCGTGGCTGTC and the reverse primer used was: 3'CCGTTTAGCGGAATGCTTTCTTAG.
Cell culture
Conditionally immortalized E11 mouse metanephric mesenchyme cells, derived from the Imorto-mouse, were a gift of L. Holzman (University of Michigan). The cell lines contain a temperature-sensitive SV40 T-antigen gene under the control of the
-interferon response element and were cultured at 32°C with 100 U/ml of
-interferon in Dulbeccos modified Eagles media (DMEM) with 10% inactivated fetal calf serum plus 1% penicillin/streptomycin. The clonally derived 46m cell line expresses low levels of WT1, but tested negative for Pax2 expression. Line 46m was subsequently transformed with a Pax2b- and Pax2a-expressing retrovirus containing the neomycin resistance gene and clonally derived cell lines were established. These cell lines were examined for Pax2 expression by western and northern blotting.
The 46m cell line also served as the host for Pax2-adenoviral infection. Briefly 2x105 46m cells/well were seeded out onto a six-well plate and incubated for 24 hours. The cells were washed with 1xPBS and 1 ml of serum free media (DMEM) was added for the infection. Cells were incubated, with serial dilutions of Pax2-adenoviral vector (stock 6.6x107 PFU/µl) ranging from 2x105 to 2x109 PFU/ml, for 2 hours and then 3 ml of complete DMEM was added. Infection success was analyzed at 24 hours using the inherent GFP expression by the Pax2-adenoviral vector. At 2x109 PFU/ml, nearly 100% of the cells were infected as judged by expression of green fluorescent protein. For GDNF activation analyses, cells were infected with 2x109 PFU/ml and harvested for RNA at 8, 24 and 48 hours after infection.
Northern blotting
Total RNA from cell lines was prepared using the TRIZOL reagent (GIBCO) following the manufacturers instructions. Cell lines used for analysis included clone 46m cells, Pax2 retrovirally transformed cells (designated clones 5,8,12,13,24,26,27,28) and Pax2-adenoviral vector infected (2x109 PFU/10 ml media) clone 46m cells at 8, 24 and 48 hours post infection. Each 100 mm plate contained 1x107 cells. Once RNA was isolated and resuspended in RNAse free water, an OD260 was obtained for each sample to determine yield. An aliquot of 10 µg total RNA was electrophoresed in 1% agarose gel containing formaldehyde, blotted on a Hybond-N membrane (overnight) and probed with an exon 2/3 fragment from the GDNF cDNA. The probe was labeled with [32P]dCTP via the random prime reaction. Blots were prehybridized with 5 ml Rapid-Hyb (Amersham) and 5x106 cpm of the radiolabeled probe was added. After 4 hours at 65°C, blots were washed in 2xSSC, 1% SDS twice and 0.2xSSC, 0.1% SDS once at 65°C each.
GDNF genomic clones and expression plasmids
A murine GDNF BAC clone was identified by screening filter arrays (Research Genetics) with a probe for exon 1. The 4.2 kb BamHI fragment was identified, that contained approximately 1.0 kb of 5' UTR from exon 1 and 3.2 kb of upstream sequence. The sequence for exon 1 and the potential 5' regulatory sequences were identical to the published GDNF promoter region (Matsushita et al., 1997; Tanaka et al., 2000) (GenBank Accession Number, D88351). Two reporter vectors were constructed by cloning the 4.2 kb BamHI fragment, containing the 5' promoter region and a portion of exon 1, into the BamHI multiple cloning site of the BLCAT 6 vector (Luckow and Shuetz, 1987). The plasmid p2.4-CAT contains a 2.4 kb HindIII/BamHI fragment spanning position 1260 to +1052 inserted into the BamHI/HindIII sites of BLCAT 6. The vector p2.4-CAT was digested with ApaI, which cuts in the 5' UTR at position +713 and +963 [all numbers are from previously published work (Tanaka et al., 2000)], and re-ligated to make the plasmid p
Apa-CAT.
Electrophoretic mobility shift assays and DNAseI footprinting
The Pax2 paired domain (Pax2-PD), amino acids 1-170, was fused to a poly-histidine expression vector (pRSET, Invitrogen) and purified by metal affinity chromatography under denaturing conditions. The denatured paired domain protein was dialyzed stepwise in decreasing amounts of urea and finally into Z-buffer (25 mm Hepes pH 7.8, 20% glycerol, 12.5 mM MgCl2, 0.1 M KCl, 1 mM DTT).
Initial screening for Pax2-binding sites was performed on digests (AluI, DdeI, Sau3A) of the 2.4 kb GDNF fragment containing the transcription start site and 5' UTR. Total digests were labeled with [
-32P]dCTP via the Klenow fill in reaction. Binding reactions were performed in a total volume of 10 µl for 30 minutes at room temperature and contained increasing amounts of purified Pax2 PD (1-170 amino acids) protein, 100 ng poly(dI-dC)-labeled probe (10,000 dpm). Free DNA and DNA/protein complexes were resolved at room temperature on 4% or 6% neutral polyacrylamide gels in 0.5x TBE at 120 volts. For competition experiments, unlabeled competitor DNA was used at 50- and 500-fold molar excess. Shifts were determined and isolation of corresponding sequences were performed with subsequent digests SacI/StyI resulting in GDNF Pax2-binding site 1 (PBS1) of 198 bp and AvaI, resulting in GDNF Pax2-binding site 2 (PBS2) of 271 bp. The initial shifts were confirmed using the purified fragments. The oligonucleotides corresponding to Pax2-binding sites were: PBS1, ATACATGATATGCAAAGCCTCTGACTTCAGCCAGCAGATA; and PBS2, CCAAGGCAGGGGCGGCTGCTCAGACTTAGTCTTCTTGGGG.
For DNAseI footprinting, DNA fragments were isolated from a 1.5% agarose gel after digestion with restriction enzymes. DNA fragments were labeled with 2-4 molecules of [32P]dCTP and [32P]dGTP by Klenow fill in reaction. Increasing amounts of recombinant Pax2-PD, were pre-incubated with 1 µg poly(dI-dC) in 50 µl of binding buffer for 15 minutes at room temperature. Subsequently, the DNA probe was added (20,000 dpm) and incubated on ice for 10 minutes followed by a 5 minute room temperature incubation. The DNA was digested with 0.2 units of RNAse free DNAseI for 60 seconds and the reaction was terminated with 100 µl stop buffer (50 mM Tris pH8, 100 mM NaCl, 1% SDS, 10 mM EDTA, 1 mg/ml proteinase K, 1 mg/ml sonicated herring sperm). Samples were then incubated at 50°C overnight and extracted once with phenol:chloroform (1:1) and precipitated with ethanol. Samples were resuspended in DNA dye mix (90% formamide) and separated on a 6% denaturing acrylamide sequencing gel. Adenosine + guanine chemical cleavage reactions were performed with piperidine as described (Maxam and Gilbert, 1980).
CAT assays
NIH 3T3 cells were plated at 500,000 cells per 60 mm dish, cultured in DMEM + 10% FCS and 1% penicillin/streptomycin at 37°C, and transfected the following day with FUGENE (Roche), according to the manufacturers protocol. For each 60 mm dish, 6 µl of FUGENE was used per 3 µg of DNA, which contained 0.5 µg of reporter plasmid and 0.2 µg CMV-ß-gal for standardization. After a 2 hour exposure to the FUGENE/DNA in DMEM (serum free), DMEM+10%FCS and 1% PS was added to double the volume. Forty-eight hours post-transfection, cells were scraped into PBS, spun down and resuspended in 0.3 ml of 0.25 M Tris (pH 7.6). Cells were lysed with three freeze/thaw cycles. Debris was pelleted and 50 µl of lysate was assayed for ß-gal activity. Equivalent amounts of ß-gal units were then used for the acetylation reactions as described (Gorman et al., 1982). Spots were cut out of the thin layer chromatography plate and scintillation counted. Counts were standardized for background. Each transfection was performed a minimum of three times.
Site-directed mutagenesis
Two deletions were made in the p2.4-CAT plasmid using the Quikchange Site-Directed Mutagenesis Kit (Stratagene) according to the manufacturers directions. The two sites chosen corresponded to the demonstrated Pax2-binding sites on the GDNF promoter and 5' UTR. Specifically, a 10 bp sequence corresponding to an area within PBS1 was deleted using an HPLC purified set of primers, 5' GCAAAGCCTCTGCAGATATTTGGAGACG 3' and 5' CGTCTCCAAATATCTGCAGAGGCTTTGC 3'. A new PstI restriction site was introduced. A 34 bp deletion was introduced into the 5'UTR which encompassed the Pax2-binding site PBS2. This was accomplished using the primer pair: 5' CCAAGGCAGGGGCGGCCGGTGTGCGAGGTG 3' and 5' CACCTCGCACACCGGCCGCCCCTGCCTTGG 3', which introduced an EagI restriction site. Sequencing analysis confirmed that the deletions had been introduced. The parental 2.4-CAT plasmid had the PBS2 site initially deleted (p
2.4-CAT) and subsequently the PBS1 was also deleted.
| RESULTS |
|---|
|
|
|---|
In order to examine the dependence of Pax2 expression on ureteric bud induction, we stained wild-type and Ret mutant kidneys for Pax2 expression (Fig. 1). Mice homozygous for a null mutation in Ret exhibit a high frequency of renal agenesis, owing to inhibition of ureteric bud outgrowth (Schuchardt et al., 1994; Schuchardt et al., 1996). Because Ret is expressed only in the nephric duct and ureteric bud of the kidney, the metanephric mesenchyme in Ret mutants remains competent to respond to inductive signals and are essentially wild type in nature. Surprisingly in E11.5 kidneys, Pax2 expression is still detected in the uninduced mesenchyme of Ret mutants and clearly demarcates the metanephric anlagen within the posterior intermediate mesoderm (Fig. 1). Thus, activation of Pax2 expression is independent of induction by the ureteric bud. Despite expression of Pax2, in in vitro cultures of isolated Ret mutant, uninduced mesenchyme undergo apoptosis within 24-48 hours of explantation and quickly lose Pax2 expression (data not shown).
|
|
|
Pax2 mutant mesenchyme is unable to respond to inductive signals
The lack of GDNF expression and ureteric bud outgrowth could explain the complete renal agenesis phenotype in the Pax2 mutants. Though the clear absence of mesonephric tubules in Pax2-null embryos would suggest that the periductal mesenchyme is unable to make epithelia, the competence of Pax2 null metanephric mesenchyme had not been examined directly. Thus, we cultured Pax2 mutant metanephric mesenchyme with wild-type spinal cord to examine if Pax2 mutant mesenchyme could respond to inductive signals (Fig. 4). As a positive control, uninduced metanephric mesenchyme from homozygous RET embryos were also co-cultured with dorsal spinal cord. After 24 hours in culture, some RET mesenchyme already showed evidence of tubule formation (Fig. 4A). By 72 hours, 100% (3/3) of the RET mesenchymal cultures exhibited characteristic tubules that stained with anti-E-cadherin antibodies (Fig. 4B). By contrast, none of the Pax2 mutant mesenchymes (0/4) exhibited any sign of tubule formation. After 24 hours, the Pax2 mutant tissue was still discernible (Fig. 4A). However, after 72 hours there was little recognizable Pax2 mesenchyme left in the cultures and no expression of E-cadherin (Fig. 4B). Pax2 expression was detected in the spinal cord, which was used as a heterologous inducer. Thus, Pax2 mutant mesenchyme was neither viable for more than 24 hours, nor was it responsive to strong inductive signals.
|
|
|
|
PBS2-CAT has a small 34 bp deletion of PBS2, the stronger of the two Pax2-PD binding sites. Pax2-dependent activation of the CAT gene is reduced approximately threefold using the p
PBS2-CAT reporter, relative to the p2.4-CAT wild-type construct (Fig. 6B). The vector p
Apa-CAT has a 250 bp ApaI fragment deleted, which encompasses all of the Pax2-binding region and approximately 60 bp 5' and 150 bp 3'. The ability of p
Apa-CAT to respond to Pax2 was reduced tenfold relative to the full-length insert. However, an additional deletion of PBS1 did not significantly reduce Pax2-dependent activation of the reporter (data not shown). Thus, the significance of the weaker Pax2 binding site, PBS1, is questionable. However, PBS2 is a strong Pax2-binding site that is required for full activation of CAT in this reporter system. The sequence of PBS2 was compared with other known binding sites for Pax2 using the ClustaW alignment program (MacVector, IBI) (Fig. 8). From several published Pax2-binding sites, a consensus sequence emerged. This sequence corresponds to the same region of PBS2 first evident on the DNAseI footprint, with lower concentrations of Pax2 protein.
|
| DISCUSSION |
|---|
|
|
|---|
The expression analyses of Pax2 in the Ret mutants have led to a re-evaluation of the role of Pax2 in the metanephric mesenchyme. In the mouse, Pax2 expression in the intermediate mesoderm is first detected at around E8.5, before nephric duct formation. Expression in the chick embryo is similar and marks the region destined to form the nephric duct (Obara-Ishihara et al., 1999). At the ureteric bud stage, Pax2 localizes to the epithelium and the mesenchymal cells surrounding the ureteric bud (Dressler and Douglass, 1992; Ryan et al., 1995). Previous analyses in wild type and Sd mutants have suggested that Pax2 expression in the mesenchyme is coincident with induction (Phelps and Dressler, 1993). This interpretation was based on the following observations. In normal embryonic kidneys, Pax2-expressing cells are tightly associated with the ureteric bud tips. In Sd mutants, which fail to induce the mesenchyme, Pax2 is localized to the ureteric bud but not the metanephric mesenchyme. Finally, in vitro cultures of metanephric mesenchyme do not express Pax2 in the absence of inducing tissues. However, the present report clearly demonstrates that the E11.5 Ret mutants express Pax2 protein in the uninduced mesenchyme. As Ret is expressed only in the nephric duct of the developing kidney, the mesenchyme remains essentially wild type in character. Indeed, expression of Pax2 demarcates the metanephric mesenchyme in the absence of any ureteric bud outgrowth. Pax2 expression in the posterior intermediate mesoderm most probably depends on environmental cues, independent of ureteric bud growth. As demonstrated in the chick embryo, such cues may emanate from paraxial mesoderm (Mauch et al., 2000). In vitro culture of dissected metanephric mesenchyme, from either wild type or Ret mutants, results in the rapid decline of Pax2 expression, presumably because these positional cues are lost. Thus, the potential for Pax2 to regulate genes expressed in the uninduced mesenchyme, as well as the induced mesenchyme and the newly differentiating epithelia, must be considered.
GDNF is expressed in the early metanephric mesenchyme and is essential for activating the RET receptor to promote ureteric bud growth (Moore et al., 1996; Pichel et al., 1996; Sanchez et al., 1996; Vega et al., 1996). We have confirmed that GDNF is sufficient to stimulate ureteric bud outgrowth from wild-type nephric duct, similar to previous reports (Sainio et al., 1997). However, the ability of GDNF to stimulate secondary ureteric bud outgrowth is limited to the posterior half of the nephric duct. Based on the analysis of heterozygous mutants, the secreted signaling peptide BMP4, which is expressed in the surrounding mesenchyme, may limit the effect of GDNF to the more posterior nephric cord (Miyazaki et al., 2000). Our results with organ culture experiments are consistent with these observations, as BMP4 can suppress the effects of exogenous GDNF. RET signaling activates the mitogen-activated protein kinase pathways (Durick et al., 1998; Marshall et al., 1997) and the phosphatidylinositol 3-kinase pathway (Besset et al., 2000; Murakami et al., 1999; Segouffin-Cariou and Billaud, 2000) in different cell types. At present, it is unclear how BMP4 signaling, presumably through activation of Smad proteins, can suppresses these potential RET signaling pathways.
Despite the early expression of Pax2 in the nephric duct, Pax2 null mutants are able to initiate nephric duct epithelium formation and exhibit nephric duct extension towards the cloaca. Yet the failure to express GDNF in the mesenchyme is not the only defect that suppresses ureteric bud outgrowth in Pax2-null embryos, as GDNF replacement in organ culture cannot rescue the Pax2-null phenotype. Thus, the Pax2 mutant nephric duct is unable to respond to GDNF, demonstrating a cell autonomous defect in the epithelium. Although RET expression in Pax2 mutant nephric duct is normal at early stages (Torres et al., 1995), by E11, RET expression levels may be insufficient to generate bud outgrowth when exposed to ectopic GDNF.
The Pax2 gene is essential for regulating GDNF expression in the posterior intermediate mesoderm. Pax2-null mutants have little to no detectable expression of GDNF mRNA, as determined by whole-mount in situ hybridization and RT-PCR. The Pax2-dependent activation of GDNF is mediated, at least in part, by a high-affinity binding site (PBS2) located within the 5' UTR of exon 1. These sites were identified by screening isolated fragments, or pools of fragments, by electrophoretic mobility shift experiments. The importance of PBS2 is underscored by a clear reduction in Pax2-dependent transactivation of reporter gene expression when this site is deleted. However, PBS1, which appeared much weaker in the screen did not significantly reduce reporter gene expression when it was deleted from the p
2.4-CAT vector. Thus, the possibility remains that there are additional Pax2-binding sites within the 2.4 kb GDNF sequences that were not identified in our screen. GDNF expression is also lost in mutants for the eyes absent homolog Eya1 (Xu et al., 1999), a gene associated with branchio-oto-renal syndrome (Abdelhak et al., 1997), although this may be indirect because of suppression of Pax2 in the metanephric mesenchyme. A negative regulator of GDNF expression is the forkhead transcription factor Foxc1 (Kume et al., 2000), which acts to restrict the GDNF expression domain to the more posterior metanephric region. Thus, Pax2 is the first direct positive regulator of GDNF that has been identified to date. Other potential targets of Pax2 in the uninduced mesenchyme include WT1, which can be activated by Pax2 in cell culture (Dehbi et al., 1996; McConnell et al., 1997). In the absence of WT1, the metanephric mesenchyme is unable to respond to inductive signals and undergoes apoptosis (Kreidberg et al., 1993). Indeed, the inability of Pax2 mutant mesenchyme to thrive also may be due to the loss of WT1 expression. This would place Pax2 upstream of Wt1 in the genetic hierarchy of mesenchyme specification. Consistent with this model, the expression of Pax2 and GDNF mRNA has been reported in Wt1 mutants (Donovan et al., 1999).
Once mesenchymal cells are induced and form aggregates around the tips of the ureteric bud, GDNF expression begins to decrease. Little GDNF mRNA is detected in the newly polarized renal vesicles (Hellmich et al., 1996; Sainio et al., 1997), despite high levels of Pax2 protein present at this stage and in subsequent stages of epithelial differentiation. Thus, suppression of GDNF in more differentiated mesenchyme must be mediated by some mechanism other than just loss of Pax2 expression. The identification and specification of Pax2 target genes along with their binding sites remains an important issue in elucidating the underpinnings of the molecular mechanisms during urogenital development. This report demonstrates that the Gdnf gene is an early target for Pax2, and that this regulatory axis is essential for controlling ureteric bud outgrowth. While previous mutant analyses have demonstrated a clear need for Pax2 in mesenchymal-to-epithelial conversion (Rothenpieler and Dressler, 1993; Torres et al., 1995), this report establishes an early function for Pax2 in the uninduced mesenchyme that is essential for patterning the posterior kidney region.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Abdelhak, S., Kalatzis, V., Heilig, R., Compain, S., Samson, D., Vincent, C., Weil, D., Cruaud, C., Sahly, I., Leibovici, M. et al. (1997). A human homologue of the Drosophila eyes absent gene underlies branchio- oto-renal (BOR) syndrome and identifies a novel gene family. Nat. Genet. 15, 157-164.
Besset, V., Scott, R. P. and Ibanez, C. F. (2000). Signaling complexes and protein-protein interactions involved in the activation of the Ras and PI3K pathways by the c-Ret receptor tyrosine kinase. J. Biol. Chem. 275 39159-39166.
Cacalano, G., Farinas, I., Wang, L. C., Hagler, K., Forgie, A., Moore, M., Armanini, M., Phillips, H., Ryan, A. M., Reichardt, L. F. et al. (1998). GFRalpha1 is an essential receptor component for GDNF in the developing nervous system and kidney. Neuron 21, 53-62.
Cho, E. A., Patterson, L. T., Brookhiser, W. T., Mah, S., Kintner, C. and Dressler, G. R. (1998). Differential expression and function of cadherin-6 during renal epithelium development. Development 125, 4806-4815.
Dehbi, M., Ghahremani, M., Lechner, M., Dressler, G. and Pelletier, J. (1996). The paired-box transcription factor, PAX2, positively modulates expression of the Wilms tumor suppressor gene (WT1). Oncogene 13, 447-453.
Donovan, M. J., Natoli, T. A., Sainio, K., Amstutz, A., Jaenisch, R., Sariola, H. and Kreidberg, J. A. (1999). Initial differentiation of the metanephric mesenchyme is independent of WT1 and the ureteric bud. Dev. Genet. 24, 252-262.
Dressler, G. R. and Douglass, E. C. (1992). Pax-2 is a DNA-binding protein expressed in embryonic kidney and Wilms tumor. Proc. Natl. Acad. Sci. USA 89, 1179-1183.
Dressler, G. R., Deutsch, U., Chowdhury, K., Nornes, H. O. and Gruss, P. (1990). Pax2, a new murine paired-box containing gene and its expression in the developing excretory system. Development 109, 787-795.
Durick, K., Gill, G. N. and Taylor, S. S. (1998). Shc and Enigma are both required for mitogenic signaling by Ret/ptc2. Mol. Cell Biol. 18, 2298-2308.
Epstein, J., Cai, J., Glaser, T., Jepeal, L. and Maas, R. L. (1994). Identification of a Pax paired domain recognition sequence and evidence for DNA dependent conformational changes. J. Biol. Chem. 269, 8355-8361.
Gorman, C. M., Moffat, L. F. and Howard, B. H. (1982). Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2, 1044-1051.
Grimm, L., Holinski-Feder, E., Teodoridis, J., Scheffer, B., Schindelhauer, D., Meitinger, T. and Ueffing, M. (1998). Analysis of the human GDNF gene reveals an inducible promoter, three exons, a triplet repeat within the 3'-UTR and alternative splice products. Hum. Mol. Genet. 7, 1873-1886.
Hellmich, H. L., Kos, L., Cho, E. S., Mahon, K. A. and Zimmer, A. (1996). Embryonic expression of glial cell-line derived neurotrophic factor (GDNF) suggests multiple developmental roles in neural differentiation and epithelial-mesenchymal interactions. Mech. Dev. 54, 95-106.
Kreidberg, J. A., Sariola, H., Loring, J. M., Maeda, M., Pelletier, J., Housman, D. and Jaenisch, R. (1993). WT1 is required for early kidney development. Cell 74, 679-691.
Kume, T., Deng, K. and Hogan, B. L. (2000). Murine forkhead/winged helix genes Foxc1 (Mf1) and Foxc2 (Mfh1) are required for the early organogenesis of the kidney and urinary tract. Development 127, 1387-1395.
Kuure, S., Vuolteenaho, R. and Vainio, S. (2000). Kidney morphogenesis: cellular and molecular regulation. Mech. Dev. 92, 31-45.
Lechner, M. S. and Dressler, G. R. (1996). Mapping of Pax-2 transcription activation domains. J. Biol. Chem. 271, 21088-21093.
Lechner, M. S. and Dressler, G. R. (1997). The molecular basis of embryonic kidney development. Mech. Dev. 62, 105-120.
Luckow, B. and Shuetz, G. (1987). CAT constructions with multiple unique restriction sites for the functional analysis of eukaryotic promoters and regulatory elements. Nucleic Acids Res. 15, 5490.
Marshall, G. M., Peaston, A. E., Hocker, J. E., Smith, S. A., Hansford, L. M., Tobias, V., Norris, M. D., Haber, M., Smith, D. P., Lorenzo, M. J. et al. (1997). Expression of multiple endocrine neoplasia 2B RET in neuroblastoma cells alters cell adhesion in vitro, enhances metastatic behavior in vivo, and activates Jun kinase. Cancer Res. 57, 5399-5405.
Matsushita, N., Fujita, Y., Tanaka, M., Nagatsu, T. and Kiuchi, K. (1997). Cloning and structural organization of the gene encoding the mouse glial cell line-derived neurotrophic factor, GDNF. Gene 203, 149-157.
Mauch, T. J., Yang, G., Wright, M., Smith, D. and Schoenwolf, G. C. (2000). Signals from trunk paraxial mesoderm induce pronephros formation in chick intermediate mesoderm. Dev. Biol. 220, 62-75.
Maxam, A. M. and Gilbert, W. (1980). Sequencing end labeled DNA with base specific chemical cleavages. Methods Enzymol. 65, 499-560.
McConnell, M. J., Cunliffe, H. E., Chua, L. J., Ward, T. A. and Eccles, M. R. (1997). Differential regulation of the human Wilms tumour suppressor gene (WT1) promoter by two isoforms of PAX2. Oncogene 14, 2689-2700.
Miyazaki, Y., Oshima, K., Fogo, A., Hogan, B. L. M. and Ichikawa, I. (2000). Bone morphogenetic protein 4 regulates the budding site and elongation of the mouse ureter. J. Clin. Invest. 105, 863-873.
Moore, M. W., Klein, R. D., Farinas, I., Sauer, H., Armanini, M., Phillips, H., Reichardt, L. F., Ryans, A. M., Carver-Moore, K. and Rosenthal, A. (1996). Renal and neuronal abnormalities in mice lacking GDNF. Nature 382, 76-79.
Murakami, H., Iwashita, T., Asai, N., Shimono, Y., Iwata, Y., Kawai, K. and Takahashi, M. (1999). Enhanced phosphatidylinositol 3-kinase activity and high phosphorylation state of its downstream signalling molecules mediated by ret with the MEN 2B mutation. Biochem. Biophys. Res. Commun. 262, 68-75.
Obara-Ishihara, T., Kuhlman, J., Niswander, L. and Herzlinger, D. (1999). The surface ectoderm is essential for nephric duct formation in intermediate mesoderm. Development 126, 1103-1108.
Pachnis, V., Mankoo, B. and Costantini, F. (1993). Expression of the c-ret proto-oncogene during mouse embryogenesis. Development 119, 1005-1017.
Pfeffer, P. L., Bouchard, M. and Busslinger, M. (2000). Pax2 and homeodomain proteins cooperatively regulate a 435 bp enhancer of the mouse Pax5 gene at the midbrain-hindbrain boundary. Development 127, 1017-1028.
Phelps, D. E. and Dressler, G. R. (1993). Aberrant expression of Pax-2 in Danforths short tail (Sd) mice. Dev. Biol. 157, 251-258.
Phelps, D. E. and Dressler, G. R. (1996). Identification of novel Pax-2 binding sites by chromatin precipitation. J. Biol. Chem. 271, 7978-7985.
Pichel, J. G., Shen, L., Sheng, H. Z., Granholm, A.-C., Drago, J., Grinberg, A., Lee, E. J., Huang, S. P., Saarma, M., Hoffer, B. J. et al. (1996). Defects in enteric innervation and kidney development in mice lacking GDNF. Nature 382, 73-76.
Pope, J. C., Brock, J. W., Adams, M. C., Stephens, F. D. and Ichikawa, I. (1999). How they begin and how they end: classic and new theories for the development and deterioration of congenital anomalies of the kidney and urinary tract, CAKUT. J. Am. Soc. Nephrol. 10, 2018-2028.
Rothenpieler, U. W. and Dressler, G. R. (1993). Pax-2 is required for mesenchyme-to-epithelium conversion during kidney development. Development 119, 711-720.
Ryan, G., Steele-Perkins, V., Morris, J., Rauscher, F. J., III and Dressler, G. R. (1995). Repression of Pax-2 by WT1 during normal kidney development. Development 121, 867-875.
Sainio, K., Suvanto, P., Davies, J., Wartiovaara, J., Wartiovaara, K., Saarma, M., Arume, U., Meng, X., Lindahl, M., Pachnis, V. et al. (1997). Glial-cell-line-derived neurotrophic factor is required for bud initiation from ureteric epithelium. Development 124, 4077-4087.
Sanchez, M. P., Silos-Santiago, I., Frisen, J., He, B., Lira, S. A. and Barbacid, M. (1996). Renal agenesis and the absence of enteric neurons in mice lacking GDNF. Nature 382, 70-73.
Schedl, A. and Hastie, N. D. (2000). Cross-talk in kidney development. Curr. Opin. Genet. Dev. 10, 543-549.
Schuchardt, A., DAgati, V., Larsson-Blomberg, L., Costantini, F. and Pachnis, V. (1994). Defects in the kidney and enteric nervous system of mice lacking the tyrosine kinase receptor Ret. Nature 367, 380-383.
Schuchardt, A., DAgati, V., Pachnis, V. and Costantini, F. (1996). Renal agenesis and hypodysplasia in ret-k mutant mice result from defects in ureteric bud development. Development 122, 1919-1929.
Segouffin-Cariou, C. and Billaud, M. (2000). Transforming ability of MEN2A-RET requires activation of the phosphatidylinositol 3-kinase/AKT signaling pathway. J. Biol. Chem. 275, 3568-3576.
Tanaka, M., Ito, S., Matsushita, N., Mori, N. and Kiuchi, K. (2000). Promoter analysis and characteristics of the 5'-untranslated region of the mouse glial cell line-derived neurotrophic factor gene. Mol. Brain Res. 85, 91-102.
Tang, M. J., Worley, D., Sanicola, M. and Dressler, G. R. (1998). The RET-glial cell-derived neurotrophic factor (GDNF) pathway stimulates migration and chemoattraction of epithelial cells. J. Cell Biol. 142, 1337-1345.
Torres, M., Gomez-Pardo, E., Dressler, G. R. and Gruss, P. (1995). Pax-2 controls multiple steps of urogenital development. Development 121, 4057-4065.
Vega, Q. C., Worby, C. A., Lechner, M. S., Dixon, J. E. and Dressler, G. R. (1996). Glial cell line-derived meurotrophic factor activates RET and promotes kidney morphogenesis. Proc. Natl. Acad. Sci. USA 93, 10657-10661.
Wilkinson, D. M. (1992). Whole mount in situ hybridization of vertebrate embryos. In In Situ Hybridization: A Practical Approach (ed. D. M. Wilkinson), pp. 75-83. Oxford: IRL Press.
Xu, P. X., Adams, J., Peters, H., Brown, M. C., Heaney, S. and Maas, R. (1999). Eya1-deficient mice lack ears and kidneys and show abnormal apoptosis of organ primordia. Nat. Genet. 23, 113-117.
This article has been cited by other articles:
![]() |
M. S. Razzaque Can patient-specific stem cell therapy enhance renal repair? Nephrol. Dial. Transplant., June 1, 2008; 23(6): 1826 - 1830. [Full Text] [PDF] |
||||
![]() |
D. R. Abrahamson and B. M. Steenhard Perinatal Nephron Programming Is not So Sweet in Maternal Diabetes J. Am. Soc. Nephrol., May 1, 2008; 19(5): 837 - 839. [Full Text] [PDF] |
||||
![]() |
T. Hoshino, R. Shimizu, S. Ohmori, M. Nagano, X. Pan, O. Ohneda, M. Khandekar, M. Yamamoto, K.-C. Lim, and J. D. Engel Reduced BMP4 abundance in Gata2 hypomorphic mutant mice result in uropathies resembling human CAKUT. Genes Cells, February 1, 2008; 13(2): 159 - 170. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hartwig, D. Bridgewater, V. Di Giovanni, J. Cain, Y. Mishina, and N. D. Rosenblum BMP Receptor ALK3 Controls Collecting System Development J. Am. Soc. Nephrol., January 1, 2008; 19(1): 117 - 124. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-Q. Gong, A. R. Yallowitz, H. Sun, G. R. Dressler, and D. M. Wellik A Hox-Eya-Pax Complex Regulates Early Kidney Developmental Gene Expression Mol. Cell. Biol., November 1, 2007; 27(21): 7661 - 7668. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. J. Murawski, D. B. Myburgh, J. Favor, and I. R. Gupta Vesico-ureteric reflux and urinary tract development in the Pax21Neu+/ mouse Am J Physiol Renal Physiol, November 1, 2007; 293(5): F1736 - F1745. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Linton, G. R. Martin, and L. F. Reichardt The ECM protein nephronectin promotes kidney development via integrin {alpha}8{beta}1-mediated stimulation of Gdnf expression Development, July 1, 2007; 134(13): 2501 - 2509. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Vigneau, K. Polgar, G. Striker, J. Elliott, D. Hyink, O. Weber, H.-J. Fehling, G. Keller, C. Burrow, and P. Wilson Mouse Embryonic Stem Cell-Derived Embryoid Bodies Generate Progenitors That Integrate Long Term into Renal Proximal Tubules In Vivo J. Am. Soc. Nephrol., June 1, 2007; 18(6): 1709 - 1720. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Quinlan, M. Lemire, T. Hudson, H. Qu, A. Benjamin, A. Roy, E. Pascuet, M. Goodyer, C. Raju, Z. Zhang, et al. A Common Variant of the PAX2 Gene Is Associated with Reduced Newborn Kidney Size J. Am. Soc. Nephrol., June 1, 2007; 18(6): 1915 - 1921. [Abstract] [Full Text] [PDF] |
||||