|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||

1 Department of Cell and Developmental Biology, John Innes Centre, Norwich NR4 7UH, UK
2 California Institute of Technology, Division of Biology, Pasadena, CA91125, USA
* These authors contributed equally
Author for correspondence (e-mail: robert.sablowski{at}bbsrc.ac.uk)
Accepted 9 April 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Arabidopsis thaliana, Meristem establishment, WUS, STM
| INTRODUCTION |
|---|
|
|
|---|
To generate new phytomers continuously, two main functions have to be balanced in the SAM (Brand et al., 2001
; Clark, 2001
; Fletcher and Meyerowitz, 2000
; Lenhard and Laux, 1999
). One is the initiation of organ primordia on the flanks of the meristem, with predictable size, position and timing (thus determining the arrangement of leaves around the stem, or phyllotaxy). The other is to maintain the pool of undifferentiated cells, with new cell divisions in the meristem replacing the cells allocated to organ primordia. These two functions roughly correspond to histologically distinguishable regions of the meristem. New organs are initiated in the peripheral zone (PZ). The cell population in the PZ is maintained by continuous recruitment of stem cells from the central zone (CZ). The shift of cells from the CZ to the PZ and the transition from the PZ to organ primordia are genetically separable. Mutations in CLAVATA (CLV) genes increase the size of the CZ and have been proposed to delay the transition from CZ to PZ (Clark et al., 1993
; Clark et al., 1995
; Laufs et al., 1998b
). Mutations in MGOUN genes delay the transition to organogenesis and increase the size of the PZ (Laufs et al., 1998a
).
The balance between the rate of cell division and differentiation is crucial for the ordered transition of cells between meristem zones. In Arabidopsis, two genes have been implicated in the maintenance of undifferentiated cells in the meristem: SHOOT MERISTEMLESS (STM) and WUSCHEL (WUS), both of which encode homeodomain proteins (Long et al., 1996
; Mayer et al., 1998
). STM is thought to prevent premature recruitment of cells into differentiation pathways. In strong stm mutants, the meristem is absent at the end of embryogenesis (Barton and Poethig, 1993
); weak stm mutants fail to maintain the meristem after germination (Clark et al., 1996
; Endrizzi et al., 1996
). The STM mRNA accumulates in both the CZ and PZ of the meristem but is repressed in organ primordia, in accordance with a role in maintaining cells in an undifferentiated state (Long et al., 1996
). WUS is required to keep the pool of stem cells in the CZ of the meristem (Laux et al., 1996
; Mayer et al., 1998
). In wus mutants, the meristem is not established during embryogenesis; after germination, axillary meristems are initiated and aborted repeatedly. This repeated termination of the meristem has been attributed to a failure to specify the central stem cells that are required to re-populate the peripheral meristem. WUS is expressed in a small group of cells below the CZ, indicating that WUS must signal across cell layers to specify the stem cells.
WUS and STM are activated independently during embryogenesis (Mayer et al., 1998
) and although both genes are ultimately required to prevent differentiation and maintain cell division, it is unclear how their functions interact. It is also unknown whether ectopic expression of WUS or STM can revert cell differentiation and re-initiate cell division. We investigated these questions by activating STM and WUS functions in differentiating tissues, after embryogenesis. The combined effect of ectopic WUS and STM functions was more than additive: a subset of meristem functions were activated, including cell division, expression of a CZ marker and initiation of organ primordia, but not meristem self-maintenance and correct phyllotaxy. Our results suggest that WUS signals across cells to enable STM-expressing cells to initiate cell division and meristem activity.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The cycB1::uidA (line FA4C), KNAT2::GUS, LOB and hsp18.2::Cre lines have been described previously (Colón-Carmona et al., 1999
; Laufs et al., 1998a
; Pautot et al., 2001
; Shuai et al., 2002
). The J2341 gene trap line was generated by Jim Haseloff (http://www.plantsci.cam.ac.uk/Haseloff/Home.html) and was obtained from the NASC Arabidopsis Stock Centre (http://nasc.nott.ac.uk/). The cycD3::uidA reporter was derived from the cyclin D3b gene from Antirrhinum majus (Gaudin et al., 2000
) and transformed into Arabidopsis thaliana Landsberg erecta (Ler). The cycD3::uidA reporter mimicked the expression pattern of Arabidopsis cyclin D3:2 (Swaminathan et al., 2000
) shown by in situ hybridisation (C. W., R. S. and J. D., unpublished). 35S::STM-GR, 35S::lox-uidA-NOS-lox-GFP and 35S::lox-uidA-NOS-lox-WUS lines were generated as described below.
Plasmid construction
Standard molecular biology techniques were used (Sambrook et al., 1989
). For cDNA synthesis, RNA was extracted from inflorescences of Arabidopsis Ler, using TRIZOL (Sigma), following the manufacturers instructions. DNase I-treated total RNA was reverse-transcribed using MMLV reverse transcriptase (Stratagene). The STM and WUS coding sequences were amplified from inflorescence cDNA using Pwo polymerase (Stratagene). The primers for STM were 5'ATCTGGATCCATGGAGAGTGGTTCCAACAGC3' and 5'AAAGTCTAGATCAAAGCATGGTGGAGGAGATG3'; WUS primers were 5'AGTCGGATCCAACACACATGGAGCCGCCAC3' and 5'GCGACACTAGTGTAAGAGCTAGTTCAGACG3'. Both PCR products were cloned in pBluescript KS() (Stratagene), as a BamHI-XbaI insert (STM) or BamHI-SpeI (WUS), and their sequences were confirmed using the ABI Big Dye kit and an ABI 3700 sequencer.
To create the STM-GR fusion, the STM cDNA was re-amplified from the cloned product with primers 5'AAGGTCTAGATCTAGCATGGTGGAGGAGATGTGAT3' and 5'ATCTGGATCCATGGAGAGTGGTTCCAACAGC3'. This replaced the STM stop codon with BglII site, which was ligated to the BamHI site at the start of the sequence encoding the steroid-binding domain of the rat glucocorticoid receptor from pBI-
GR (Lloyd et al., 1994
). The STM-GR fusion was re-sequenced and inserted as a BamHI-XbaI fragment into pCGN18 (Krizek and Meyerowitz, 1996
), to create p35S::STM-GR.
To create the mosaic expression vector, the uidA coding sequence of pRAJ275 (Jefferson, 1988
) and the NOS terminator (NOS) from pCGN18 were cloned in pBluescript KS() as EcoRI-uidA-SalI-NOS-PstI. Oligonucleotides containing loxP sequences (Hoess et al., 1982
) were cloned on both ends of uidA-NOS, with a BglII site added upstream of lox-uidA-NOS-lox. Relative to the uidA coding sequence, both loxP sequences were in the orientation 5'GACCTAATAACTTCGTATAGCATACATTATACGAAGTTATATTAAGGGTTG3'. After sequences were confirmed, the lox-uidA-NOS-lox cassette was cloned between BamHI and XbaI sites in pCGN18 to generate pGUSMOS (in the orientation 35S promoter::lox-uidA-NOS-lox). pGUSMOS was cut with BamHI and XbaI to receive mGFP5-ER (Haseloff, 1999
) as a BamHI-XbaI fragment, or the WUS cDNA as BamHI-SpeI. To allow transformation into kanamycin-resistant plants, the 35S::lox-uidA-NOS-lox-WUS-NOS cassette was removed from the pCGN18 derivative as an Asp718-HindIII fragment and cloned into pPZP222, which confers gentamycin resistance to plants (Hajdukiewicz et al., 1994
).
The CLV1::GFP construct was derived from pKR126 (containing the CLV1 gene in pCGN1547). The mGFP5-ER from pBINmGFP5-ER (http://www.plantsci.cam.ac.uk/Haseloff/Home.html) was used as a BamHI fragment to replace the CLV1 coding sequence in pKR126, retaining 5642 bp upstream and 729 bp downstream of the CLV1 ORF.
Plant transformation and growth
Arabidopsis Ler was transformed by the floral dip method (Clough and Bent, 1998
). Agrobacterium strains were ASE for pCGN derivatives and GV3101 for pPZP222. Transformants were selected on GM medium (Valvekens et al., 1988
) with 50 µg/ml kanamycin (for pCGN derivatives) or 100 µg/ml gentamycin (for pPZP200 derivatives). Transformants were moved to soil after 1-2 weeks. 35S::STM-GR lines were selected that segregated kanamycin resistance as a single locus. 35S::lox-uidA-loxGFP and 35S::lox-uidA-loxWUS lines were selected with strong and widespread GUS activity and single T-DNA insertions detected by Southern blotting.
For growth on plates, seeds were surface-sterilised for 5 minutes in 50% v/v commercial bleach with 0.1% Tween 20, and plated on GM medium. Both for plate and soil growth, seeds were stratified at 4°C for 4 days and grown at 18-20°C, with 16 hours light (fluorescent lights at approximately 100 µmol photons m2 s1) and 8 hours dark cycles.
Activation of STM-GR and Cre recombinase
For activation of STM-GR, seeds were plated on GM medium supplemented with 50 µg/ml kanamycin and 1 µM dexamethasone (Sigma). For activation of hsp18.2::Cre, surface-sterilised, stratified wet seeds were spread on the inside of Eppendorf tubes and germinated for 2 days at 20°C under continuous light (the tubes were left open inside a sealed Petri dish lined with wet filter paper). The closed tubes were incubated in a water bath at 38°C for 5 minutes. The heat shocked, germinating seeds were suspended in water and spread on GM medium (with 1 µM dexamethasone if the treatment also involved STM-GR activation).
Microscopy
For conventional scanning electron microscopy (SEM), seedlings were vacuum-infiltrated and left overnight at 4°C in a solution of 2.5% glutaraldehyde/PBS. The tissue was then rinsed 2x at 15 minute intervals with PBS followed by a further two washes with water. All rinses were at 4°C. The tissues were dehydrated through an ethanol series 30%, 50%, 70%, 90%, 100%, 100% for 30 minutes at each stage. The samples were critical point-dried in liquid carbon dioxide and were sputter coated with gold. The specimens were mounted on aluminium specimen stubs using carbon tabs (Agar Scientific) and viewed on a Philips XL30 FEG scanning electron microscope.
For cryo-scanning electron microscopy, seedlings were frozen in nitrogen slush at 190°C. Ice was sublimated at 90°C, and the specimens were sputter coated and examined on a Philips XL 30 FEG scanning electron microscope fitted with a cold stage.
For confocal imaging, a Leica TCS SP microscope was used, with excitation by an argon laser (488 nm) and emission filters set at 500-550 nm (for GFP) and 600-660 nm (for chlorophyll fluorescence). The image settings gave no signal in the GFP channel for GFP-negative controls. The images shown are projections of up to twelve 8 µm optical sections, combining the GFP and chlorophyll channels.
Histological techniques
GUS staining was as described previously (Sieburth and Meyerowitz, 1997
).
In situ hybridisation was carried out as described by Long et al. (Long et al., 1996
) (detailed on http://www.wisc.edu/genetics/CATG/barton/protocols.html).
The template used to transcribe the WUS probe was derived from the WUS cDNA cloned in pBluescript KS() (described above), by deletion of a HindII fragment, leaving nucleotides 545-1004 in the EMBL entry AJ012310.
| RESULTS |
|---|
|
|
|---|
In the absence of dexamethasone, STM-GR under the widely expressed 35S promoter had no effect (Fig. 1A). When 35S::STM-GR seeds were germinated on medium containing dexamethasone, leaf development and growth of the cotyledons and hypocotyl were inhibited; these effects are described in more detail below. In spite of the disruption of leaf development, leaf primordia emerged from the meristem with the normal spiral phyllotaxy (Fig. 1C). This phenotype was seen in five independent 35S::STM-GR lines; 15 other lines showed similar but weaker phenotypes that could be reproduced by treatment of the strong lines with low concentrations of dexamethasone (not shown). The phenotype seen in the strong lines was also observed in seedlings with STM expressed under control of the 35S promoter, although severe 35S::STM lines could not be maintained because the plants could not set seed (not shown). For further analysis, we used two strong 35S::STM-GR lines.
|
Additional evidence that STM-GR provided STM function came from ectopic activation of genes that are normally expressed in the meristem. One of these (Laufs et al., 1998a
) was the KNAT2 promoter fused to the uidA reporter, which encodes ß-glucuronidase (GUS). KNAT2 encodes a homeodomain protein that functions downstream of STM and is normally expressed in the periphery of the meristem but absent or much reduced in organ primordia (Byrne et al., 2000
; Laufs et al., 1998a
; Lincoln et al., 1994
; Pautot et al., 2001
). When treated with dexamethasone, 35S::STM-GR plants expressed KNAT2::uidA in cotyledons, leaf primordia and roots (Fig. 2A,B). In cotyledons, expression was not uniform, but concentrated on spots that did not seem to correlate with a particular tissue or cell type. The same pattern (not shown) was obtained with a reporter gene directed by the promoter of KNAT1, which is related to KNAT2 (Lincoln et al., 1994
; Ori et al., 2000
). The meaning of this expression pattern is not clear; it could reflect a positive feedback loop initiated in random cells that reach a threshold level of STM activity. Other meristem markers, however, showed uniform ectopic activation by STM-GR. These included LOB (LATERAL ORGAN BOUNDARIES), which is normally expressed in the boundaries around organ primordia (Shuai et al., 2002
) and the gene trap line J2341, which is expressed around primordia in the shoot meristem (not shown).
|
To monitor the effects of ectopic STM-GR on cell division, we used cyclin D and cyclin B reporter genes. D-cyclins are thought to control primarily the G1-S transition; B-cyclins control the G2-M transition and were used as markers for mitotic activity (Meijer and Murray, 2001
). In wild-type background, both CycD3::uidA and CycB1::uidA were expressed in scattered cells within the meristem and young leaves (Fig. 2C,E). In seedlings with activated STM-GR, CycB1::uidA expression was comparable to wild-type (Fig. 2F). CycD3::uidA expression was also similar to wild type in meristem and organ primordia, but in addition, it was activated in cotyledons (Fig. 2D). The ectopic expression of the CycD3:: uidA, but not of CycB1::uidA, showed that activation of STM-GR in differentiated tissues partially activated the cell division machinery, but was not sufficient to trigger mitosis.
Combined STM-GR and WUSCHEL induced ectopic organogenesis
The KNAT1::uidA, KNAT2::uidA and LOB marker genes that were ectopically activated by STM-GR are expressed mainly in the periphery of the wild-type meristem (Laufs et al., 1998a
; Ori et al., 2000
; Pautot et al., 2001
; Shuai et al., 2002
). A reporter gene that is expressed in the central zone of the meristem (CLV1::GFP; see below) was not activated by STM-GR outside the shoot apex (not shown). It has been proposed that STM has distinct roles in the central and peripheral regions of the meristem (Long and Barton, 1998
). Our results raised the possibility that the partial meristem identity induced by STM-GR on cotyledons and hypocotyls corresponded to the meristem peripheral zone, and that full meristem activity could be induced if central zone functions were added. Since WUS controls central zone identity (Mayer et al., 1998
), we generated plants in which WUS could be expressed in differentiated tissues. In wild-type development, WUS is expressed in a small group of cells in the SAM and has a short range, non cell-autonomous effect (Mayer et al., 1998
). To mimic this situation, we used the Cre-loxP recombination system (Sternberg and Hamilton, 1981
) to generate random WUS-expressing sectors outside the meristem.
The vector used for mosaic expression (Fig. 3A) had the uidA reporter flanked by loxP sequences, inserted between the 35S promoter and the coding sequence to be expressed in random sectors. Plants with this construct were crossed to a line containing the Cre recombinase directed by a heat shock-inducible promoter (Sieburth et al., 1998
). Heat-shock-induced Cre catalysed recombination between the loxP sequences, removing the uidA reporter and activating expression of the downstream coding sequence. The system was tested initially with the GFP reporter. In 35S::lox-uidA-lox-GFP seedlings that were not heat shocked, GUS was widely expressed and no GFP was detected; after heat shock, sectors developed that expressed GFP but not GUS (not shown). The 35S::lox-uidA-lox-GFP line was used to optimise the conditions for induction of mosaic expression in seedlings (Fig. 3B,C) and as a negative control in subsequent experiments with WUS expression.
|
|
After heat shock and dexamethasone treatment, 35S::STM-GR; 35S::lox-uidA-lox-WUS; hsp18.2::Cre seedlings had a novel phenotype: in approximately 35% of seedlings (15/45, 45/125, 16/29 in three experiments), outgrowths emerged on the surface of cotyledons and hypocotyls (Fig. 4C,D). These outgrowths appeared both on the abaxial and adaxial sides of cotyledons, and at any position on hypocotyls. Scanning electron microscopy (Fig. 4K), confocal microscopy (Fig. 6D) and conventional sections of hypocotyls (not shown) suggested that each outgrowth originated from a single epidermal cell. Although ectopic cell divisions were also seen in the cortex and endodermis, outgrowths never seemed to originate from these tissues. The outgrowths usually developed into organs that resembled the abnormal leaf primordia seen at the apex of seedlings after STM-GR activation, with leaf-like features such as dorsoventral assymetry and trichomes (Fig. 4C,D,J).
|
|
Plants homozygous for 35S::lox-uidA-lox-WUS and hsp18.2::Cre were crossed to 35S::STMGR; CLV1::GFP plants. The progeny was heat shocked 2 days after germination and plated on dexamethasone-containing medium. Two days after heat shock, ectopic cell divisions were detected on the hypocotyl epidermis (not seen in controls that were not heat shocked). These newly dividing cells expressed CLV1::GFP (Fig. 6C). Seven days after heat shock, ectopic outgrowths were visible. Like meristems, these outgrowths contained small, isodiametric, CLV1::GFP-expressing cells (Fig. 6D). In the areas where the outgrowths were bulging out of the hypocotyl surface, the cells were still small and seemed to be actively dividing, but no longer expressed CLV1::GFP. In outgrowths with leaf-like features (10 days after heat shock), expression of CLV1::GFP was detected mostly at the base and occasionally in a fraction of the cells within the ectopic organs (Fig. 6E). These GFP-expressing cells were fewer and larger than in earlier stages, suggesting that they were no longer actively dividing. Controls with induction of STMGR only or WUS only did not activate CLV1::GFP in cotyledons (not shown) or in the hypocotyl (Fig. 6G,H), except in the outgrowths seen at a low frequency on the hypocotyl after activation of WUS alone (not shown).
These results suggested that combined WUS and STM-GR initiated meristem activity (based on activated cell division and CLV1::GFP expression), but the meristematic cells were consumed in the development of ectopic organs.
| DISCUSSION |
|---|
|
|
|---|
Ectopic activation of STM-GR inhibited cell expansion and the development of specialised cell types, but did not activate cell division. The previously reported effects of ectopic expression of STM homologues included delayed differentiation, increased subdivision of the leaf lamina, ectopic meristems on the adaxial surface of leaves, or a combination of these phenotypes (Reiser et al., 2000
). Ectopic meristems were seen on the leaves of plants overexpressing KNAT1 in Arabidopsis and in tobacco plants with high levels of expression of the maize STM homologue, KNOTTED1 (Sinha et al., 1993
). In contrast, ectopic activation of KNAT1 and KNAT2 by STM-GR (our results) or in asymmetric leaves1-1 (as1-1) and as2-2 mutants (Ori et al., 2000
) did not cause ectopic meristems [although occasional ectopic meristems were reported in as1-1 by Byrne et al. (Byrne et al., 2000
)]. One possible explanation for this discrepancy is that higher levels of STM (and consequently KNAT1 and KNAT2) would be required to initiate meristems. The level of STM-GR expression in our experiments, however, appeared to be physiologically relevant, because it was sufficient to rescue the meristem in stm mutants and to initiate ectopic meristem activity in combination with WUS. In addition, a more severe 35S::STM phenotype has been reported, with inhibition of growth and leaf development, disruption of the SAM, but no ectopic meristems (Williams, 1998
). The less severe effect in our experiments could be due to the fact that STM-GR was activated only after embryogenesis. Our most severe 35S::STM lines, however, were similar to dexamethasone-treated 35S::STM-GR lines (not shown); seedlings with more severe inhibition of growth may have been missed during the selection of kanamycin-resistant transformants.
In spite of the failure to induce ectopic meristems or mitosis, activation of the cyclin D3 promoter suggested a link between STM and the cell division machinery. This link, however, may be indirect. Expression of cyclin D3 is activated by cytokinin (Riou-Khamlichi et al., 1999
), and STM may increase cytokinin levels, as seen after ectopic expression of KNOTTED1 in tobacco leaves (Ori et al., 1999
). D-cyclins have been proposed to function at a point when differentiation decisions are made (Meijer and Murray, 2000
) so activation of cyclin D3 may be related to the delay in differentiation caused by ectopic STM activity.
Our data support the previous suggestion that STM has separable PZ and CZ functions. These different functions have been proposed on the basis of the mutant phenotypes and on the expression pattern of STM during embryogenesis. The partial fusion of cotyledons seen in stm mutants suggested that STM inhibits growth in the areas between emerging organs, while in the centre of the meristem, STM is required to maintain cell proliferation (Long and Barton, 1998
). In our experiments, activation of genes that are expressed in the periphery of the meristem, but not of the central zone marker CLV1::GFP, suggested that STM outside the shoot apex activated peripheral zone functions. The prediction that the missing central zone functions could be provided by WUS was confirmed here: combined WUS and STM-GR triggered meristem activity, expression of a CZ marker (CLV1::GFP) and organogenesis.
An interesting feature of the results of combined STM and WUS activity was that ectopic organs were induced on both the adaxial and abaxial sides of cotyledons. This contrasts with previous reports where misexpression of genes caused ectopic organs specifically on the adaxial surface of leaves (Chuck et al., 1996
; McConnell and Barton, 1998
; Sinha et al., 1993
). These previous results indicated that the adaxial side has special competence for meristematic activity, consistent with the fact that axillary meristems normally form on the adaxial side of the leaf (McConnell and Barton, 1998
). Our work suggest that combined WUS and STM function can bypass the factor(s) that confer special meristematic competence to the adaxial side of lateral organs (assuming that these factors function similarly in leaves and cotyledons).
Our results are consistent with the suggestion that WUS is required to produce a signal that specifies stem cells across cell layers (Mayer et al., 1998
). When STM and WUS functions were combined, cell division was activated in cells that did not express WUS. This observation was supported by experiments in which no ectopic organs were initiated after STM-GR activation and ubiquitous WUS expression caused by high levels of Cre induction (not shown). In seedlings with mosaic WUS expression, however, not every WUS-expressing sector was associated with ectopic organs. The ability to initiate organs seemed limited to epidermal cells that did not express WUS, but we cannot exclude the possibility that the ability to produce the WUS signal may also be limited to specific cell types or tissues.
With the caveat that additional factors may affect the ability to produce or respond to the WUS signal, our results suggest that this signal triggers division in STM-expressing cells. This is consistent with the observation that in late wus-1 embryos, the cells in the area normally occupied by the meristem still express STM but fail to divide (Laux et al., 1996
; Mayer et al., 1998
). Instead, these cells enlarge, show signs of differentiation and, after germination, no longer express STM. The fact that wus-1 mutants re-initiate organogenesis days after germination, however, shows that cell division can occur at the shoot apex independently of WUS (Laux et al., 1996
). This organ re-initiation may rely on the mechanism that establishes axillary meristems at the base of leaves. The tomato lateral suppressor mutant showed that establishment of the apical and axillary meristems are genetically separable (Schumacher et al., 1999
). We propose that during axillary meristem development, other genes can transiently replace the WUS signal to trigger cell division in response to STM.
The ectopic organs in seedlings with combined WUS and STM activity initiated with localised activation of cell division and CLV1::GFP expression, indicating that the outgrowths initially had characteristics of the CZ of the meristem. Subsequently, CLV1::GFP was down-regulated and leaf-like organs developed. This suggested that the outgrowths progressed through the states normally assumed by cells in different meristem areas: central zone (marked by CLV1 expression), peripheral zone (active cell division but no CLV expression, and ability to initiate organs), and finally organ primordia. We propose two hypotheses to explain this result. The response to the WUS signal could be distance-dependent: in the vicinity of WUS-expressing cells, STM-expressing cells respond to a strong signal and acquire central zone identity. As cell division increases the number of cell layers from the WUS source, STM-expressing cells continue dividing but shift to peripheral zone functions and acquire the ability to initiate organs. Alternatively, combined WUS and STM could trigger a cascade of signals, starting with activation of central zone identity by a WUS-dependent signal. Central zone functions would include the mechanism to trigger the transition to peripheral zone identity, possibly stimulated by the CLV pathway (Clark et al., 1997
); peripheral zone identity would trigger the transition to organogenesis.
If combined ectopic STM and WUS provided both central zone and peripheral zone functions, why were self-maintaining meristems not established? One possibility is that additional genes need to be activated or repressed independently of STM and WUS for full meristem activity. Another possibility may be that in the ectopic induction experiments, WUS expression was insensitive to the delicate regulatory mechanisms that maintain the meristem, in particular the feedback loop between WUS and CLV genes (Schoof et al., 2000
). An early effect of ectopic WUS was activation of the CLV1 promoter. Since WUS was also reported to activate CLV3 (Schoof et al., 2000
), it is reasonable to expect that the whole CLV pathway was activated. The CLV pathway has been proposed to have two functions, which are not mutually exclusive: to inhibit cell proliferation in the central zone of the meristem, and to promote the transition of cells from the central to the peripheral zone (Clark et al., 1996
; Clark et al., 1997
). In addition, CLV activity negatively regulates WUS at the transcript level; this negative feedback loop prevents excessive growth of the central zone in response to WUS (Brand et al., 2000
; Schoof et al., 2000
). In our experiments, CLV1 may not be able to moderate its own expression by repressing its activator, WUS, because the latter is controlled by a heterologous promoter. The build-up of high CLV activity may eventually inhibit cell proliferation and promote the transition to peripheral zone function and organogenesis. Both effects would explain why expression of CLV1::GFP and organogenesis were transient in our experiments.
In conclusion, we have shown that ectopic STM and WUS functions interact non-additively to activate a subset of meristem functions, including cell division, CLV1 expression and organ initiation. Our results also suggest that WUS and STM not only maintain meristem cells undifferentiated, but can also revert cells to a CZ-like, undifferentiated and actively dividing state, from which they can follow an alternative differentiation pathway (from hypocotyl to leaf-like identity). The ectopic induction of meristem CZ identity was followed by organogenesis, suggesting that the mechanisms that establish the CZ and organogenesis are coupled.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Barton, M. K. and Poethig, R. S. (1993). Formation of the shoot apical meristem in Arabidopsis thaliana an analysis of development in the wild-type and in the shoot meristemless mutant. Development 119, 823-831.[Abstract]
Brand, U., Fletcher, J. C., Hobe, M., Meyerowitz, E. M. and Simon, R. (2000). Dependence of stem cell fate in Arabidopsis an a feedback loop regulated by CLV3 activity. Science 289, 617-619.
Brand, U., Hobe, M. and Simon, R. (2001). Functional domains in plant shoot meristems. BioEssays 23, 134-141.[Medline]
Byrne, M. E., Barley, R., Curtis, M., Arroyo, J. M., Dunham, M., Hudson, A. and Martienssen, R. A. (2000). ASYMMETRIC LEAVES1 mediates leaf patterning and stem cell function in Arabidopsis. Nature 408, 967-971.[Medline]
Chuck, G., Lincoln, C. and Hake, S. (1996). KNAT1 induces lobed leaves with ectopic meristems when overexpressed in Arabidopsis. Plant Cell 8, 1277-1289.[Abstract]
Clark, S. E. (2001). Meristems: start your signaling. Curr. Opin. Plant Biol. 4, 28-32.[Medline]
Clark, S. E., Jacobsen, S. E., Levin, J. Z. and Meyerowitz, E. M. (1996). The CLAVATA and SHOOT MERISTEMLESS loci competitively regulate meristem activity in Arabidopsis. Development 122, 1567-1575.[Abstract]
Clark, S. E., Running, M. P. and Meyerowitz, E. M. (1993). CLAVATA1, a regulator of meristem and flower development in Arabidopsis. Development 119, 397-418.[Abstract]
Clark, S. E., Running, M. P. and Meyerowitz, E. M. (1995). CLAVATA3 Is a specific regulator of shoot and floral meristem development affecting the same processes as CLAVATA1. Development 121, 2057-2067.[Abstract]
Clark, S. E., Williams, R. W. and Meyerowitz, E. M. (1997). The CLAVATA1 gene encodes a putative receptor kinase that controls shoot and floral meristem size in Arabidopsis. Cell 89, 575-585.[Medline]
Clough, S. J. and Bent, A. F. (1998). Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16, 735-743.[Medline]
Colón-Camera, A., You, R., Haimovitch-Gal, T. and Doerner, P. (1999). Spatio-temporal analysis of mitotic activity with a labile cyclin-GUS fusion protein. Plant. J. 20, 503-508.[Medline]
Endrizzi, K., Moussian, B., Haecker, A., Levin, J. Z. and Laux, T. (1996). The SHOOT MERISTEMLESS gene is required for maintenance of undifferentiated cells in Arabidopsis shoot and floral meristems and acts at a different regulatory level than the meristem genes WUSCHEL and ZWILLE. Plant J. 10, 967-979.[Medline]
Fletcher, J. C. and Meyerowitz, E. M. (2000). Cell signaling within the shoot meristem. Curr. Opin. Plant Biol. 3, 23-30.[Medline]
Gaudin, V., Lunness, P. A., Fobert, P. R., Towers, M., Riou-Khamlichi, C., Murray, J. A., Coen, E. and Doonan, J. H. (2000). The expression of D-cyclin genes defines distinct developmental zones in snapdragon apical meristems and is locally regulated by the Cycloidea gene. Plant Physiol. 122, 1137-1148.
Gray, A. (1885). The Botanical Textbook. Part I: Structural Botany. London: MacMillan and Co.
Hajdukiewicz, P., Svab, Z. and Maliga, P. (1994). The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol. Biol. 25, 989-994.[Medline]
Haseloff, J. (1999). GFP variants for multispectral imaging of living cells. Methods Cell Biol. 58, 139-151.[Medline]
Hoess, R. H., Ziese, M. and Sternberg, N. (1982). P1 site-specific recombination: nucleotide sequence of the recombining sites. Proc. Natl. Acad. Sci. USA 79, 3398-3402.
Jacobson, D. R. and Moscovits, T. (1991). Rapid, non-radioactive screening for activating ras oncogene mutations using PCR primer-introduced restriction analysis (PCR-PIRA). PCR Meth. Appl. 1, 146-148.[Medline]
Jefferson, R. A. (1988). Plant reporter genes: The GUS gene fusion system. In Genetic Engineering, vol. 10 (ed. J. K. Setlow), pp. 247-263. Plenum Publ. Co.
Jürgens, G. (2001). Apical-basal pattern formation in Arabidopsis embryogenesis. EMBO J. 20, 3609-3616.[Medline]
Klimyuk, V. I., Carroll, B. J., Thomas, C. M. and Jones, J. D. G. (1993). Alkali treatment for rapid preparation of plant material for reliable PCR Analysis. Plant J. 3, 493-494.[Medline]
Krizek, B. A. and Meyerowitz, E. M. (1996). The Arabidopsis homeotic genes APETALA3 and PISTILLATA are sufficient to provide the B class organ identity function. Development 122, 11-22.[Abstract]
Laufs, P., Dockx, J., Kronenberger, J. and Traas, J. (1998a). MGOUN1 and MGOUN2: two genes required for primordium initiation at the shoot apical and floral meristems in Arabidopsis thaliana. Development 125, 1253-1260.[Abstract]
Laufs, P., Grandjean, O., Jonak, C., Kieu, K. and Traas, J. (1998b). Cellular parameters of the shoot apical meristem in Arabidopsis. Plant Cell 10, 1375-1390.
Laux, T., Mayer, K. F., Berger, J. and Jürgens, G. (1996). The WUSCHEL gene is required for shoot and floral meristem integrity in Arabidopsis. Development 122, 87-96.[Abstract]
Lenhard, M. and Laux, T. (1999). Shoot meristem formation and maintenance. Curr. Opin. Plant Biol. 2, 44-50.[Medline]
Lincoln, C., Long, J., Yamaguchi, J., Serikawa, K. and Hake, S. (1994). A knotted1-like homeobox gene in Arabidopsis is expressed in the vegetative meristem and dramatically alters leaf morphology when overexpressed in transgenic plants. Plant Cell 6, 1859-1876.
Lloyd, A. M., Schena, M., Walbot, V. and Davis, R. W. (1994). Epidermal cell fate determination in Arabidopsis patterns defined by a steroid-inducible regulator. Science 266, 436-439.
Long, J. A. and Barton, M. K. (1998). The development of apical embryonic pattern in Arabidopsis. Development 125, 3027-3035.[Abstract]
Long, J. A., Moan, E. I., Medford, J. I. and Barton, M. K. (1996). A member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis. Nature 379, 66-69.[Medline]
Mayer, K. F., Schoof, H., Haecker, A., Lenhard, M., Jürgens, G. and Laux, T. (1998). Role of WUSCHEL in regulating stem cell fate in the Arabidopsis shoot meristem. Cell 95, 805-815.[Medline]
McConnell, J. R. and Barton, M. K. (1998). Leaf polarity and meristem formation in Arabidopsis. Development 125, 2935-2942.[Abstract]
Meijer, M. and Murray, J. A. (2001). Cell cycle controls and the development of plant form. Curr. Opin. Plant Biol. 4, 44-49.[Medline]
Meijer, M. and Murray, J. A. H. (2000). The role and regulation of D-type cyclins in the plant cell cycle. Plant Mol. Biol. 43, 621-633.[Medline]
Ori, N., Eshed, Y., Chuck, G., Bowman, J. L. and Hake, S. (2000). Mechanisms that control knox gene expression in the Arabidopsis shoot. Development 127, 5523-5532.[Abstract]
Ori, N., Juarez, M. T., Jackson, D., Yamaguchi, J., Banowetz, G. M. and Hake, S. (1999). Leaf senescence is delayed in tobacco plants expressing the maize homeobox gene knotted1 under the control of a senescence-activated promoter. Plant Cell 11, 1073-1080.
Pautot, V., Dockx, J., Hamant, O., Kronenberger, J., Grandjean, O., Jublot, D. and Traas, J. (2001). KNAT2: evidence for a link between knotted-like genes and carpel development. Plant Cell 13, 1719-1734.
Reiser, L., Sánchez-Baracaldo, P. and Hake, S. (2000). Knots in the family tree: evolutionary relationships and functions of knox homeobox genes. Plant Mol. Biol. 42, 151-166.[Medline]
Riou-Khamlichi, C., Huntley, R., Jacqmard, A. and Murray, J. A. (1999). Cytokinin activation of Arabidopsis cell division through a D-type cyclin. Science 283, 1541-1544.
Sablowski, R. W. and Meyerowitz, E. M. (1998). A homolog of NO APICAL MERISTEM is an immediate target of the floral homeotic genes APETALA3/PISTILLATA. Cell 92, 93-103.[Medline]
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning A Laboratory Manual. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
Schoof, H., Lenhard, M., Haecker, A., Mayer, K. F., Jürgens, G. and Laux, T. (2000). The stem cell population of Arabidopsis shoot meristems in maintained by a regulatory loop between the CLAVATA and WUSCHEL genes. Cell 100, 635-644.[Medline]
Schumacher, K., Schmitt, T., Rossberg, M., Schmitz, G. and Theres, K. (1999). The Lateral suppressor (Ls) gene of tomato encodes a new member of the VHIID protein family. Proc. Natl. Acad. Sci. USA 96, 290-295.
Shuai, B., Reynaga-Peña, C. and Springer, P. S. (2002). The LATERAL ORGAN BOUNDARIES gene defines a novel, plant-specific gene family. Plant Phys. (in press).
Sieburth, L. E., Drews, G. N. and Meyerowitz, E. M. (1998). Non-autonomy of AGAMOUS function in flower development: use of a Cre/loxP method for mosaic analysis in Arabidopsis. Development 125, 4303-4312.[Abstract]
Sieburth, L. E. and Meyerowitz, E. M. (1997). Molecular dissection of the AGAMOUS control region shows that cis elements for spatial regulation are located intragenically. Plant Cell 9, 355-365.[Abstract]
Simon, R., Igeño, M. I. and Coupland, G. (1996). Activation of floral meristem identity genes in Arabidopsis. Nature 384, 59-62.[Medline]
Sinha, N. R., Williams, R. E. and Hake, S. (1993). Overexpression of the maize homeo box gene, KNOTTED-1, causes a switch from determinate to indeterminate cell fates. Genes Dev. 7, 787-795.
Sternberg, N. and Hamilton, D. (1981). Bacteriophage P1 site-specific recombination. I. Recombination between loxP sites. J. Mol. Biol. 150, 467-486.[Medline]
Swaminathan, K., Yang, Y. Z., Grotz, N., Campisi, L. and Jack, T. (2000). An enhancer trap line associated with a D-class cyclin gene in Arabidopsis. Plant Physiol. 124, 1658-1667.
Valvekens, D., Vanmontagu, M. and Vanlijsebettens, M. (1988). Agrobacterium tumefaciens-mediated transformation of Arabidopsis thaliana root explants by using kanamycin selection. Proc. Natl. Acad. Sci. USA 85, 5536-5540.
van den Berg, C., Willemsen, V., Hendriks, G., Weisbeek, P. and Scheres, B. (1997). Short-range control of cell differentiation in the Arabidopsis root meristem. Nature 390, 287-289.[Medline]
Wagner, D., Sablowski, R. W. and Meyerowitz, E. M. (1999). Transcriptional activation of APETALA1 by LEAFY. Science 285, 582-584.
Weatherwax, P. (1923). The Story of the Maize Plant. Chicago, IL: The University of Chicago Press.
Williams, R. W. (1998). Plant homeobox genes: many functions stem from a common motif. BioEssays 20, 280-282.[Medline]
This article has been cited by other articles:
![]() |
M. R. Tucker, A. Hinze, E. J. Tucker, S. Takada, G. Jurgens, and T. Laux Vascular signalling mediated by ZWILLE potentiates WUSCHEL function during shoot meristem stem cell development in the Arabidopsis embryo Development, September 1, 2008; 135(17): 2839 - 2843. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gomez-Mena and R. Sablowski ARABIDOPSIS THALIANA HOMEOBOX GENE1 Establishes the Basal Boundaries of Shoot Organs and Controls Stem Growth PLANT CELL, August 1, 2008; 20(8): 2059 - 2072. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Depuydt, K. Dolezal, M. Van Lijsebettens, T. Moritz, M. Holsters, and D. Vereecke Modulation of the Hormone Setting by Rhodococcus fascians Results in Ectopic KNOX Activation in Arabidopsis Plant Physiology, |