|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
DEVELOPMENT AND DISEASE |
1 Department of Pediatrics, University of Utah School of Medicine, Salt Lake City, UT 84112, USA
2 Departments of Pediatrics, Molecular Biology and Pharmacology, Washington University School of Medicine, St Louis, MO, USA
3 Howard Hughes Medical Institute and Department of Human Genetics, University of Utah School of Medicine, Salt Lake City, UT 84112, USA
4 Program in Human Molecular Biology and Genetics, University of Utah School of Medicine, Salt Lake City, UT 84112, USA
*Author for correspondence (e-mail: anne.moon{at}genetics.utah.edu)
Accepted 1 July 2002
| SUMMARY |
|---|
|
|
|---|
Fibroblast growth factor 8 is a signaling molecule expressed in the ectoderm and endoderm of the developing pharyngeal arches and known to play an important role in survival and patterning of first arch tissues. We demonstrate a dosage-sensitive requirement for FGF8 during development of pharyngeal arch, pharyngeal pouch and neural crest-derived tissues. We show that FGF8 deficient embryos have lethal malformations of the cardiac outflow tract, great vessels and heart due, at least in part, to failure to form the fourth pharyngeal arch arteries, altered expression of Fgf10 in the pharyngeal mesenchyme, and abnormal apoptosis in pharyngeal and cardiac neural crest.
The Fgf8 mutants described herein display the complete array of cardiovascular, glandular and craniofacial phenotypes seen in human deletion 22q11 syndromes. This represents the first single gene disruption outside the typically deleted region of human chromosome 22 to fully recapitulate the deletion 22q11 phenotype. FGF8 may operate directly in molecular pathways affected by deletions in 22q11 or function in parallel pathways required for normal development of pharyngeal arch and neural crest-derived tissues. In either case, Fgf8 may function as a modifier of the 22q11 deletion and contribute to the phenotypic variability of this syndrome.
Key words: 22q11 deletion syndromes, Pharyngeal arches, FGF8, Pharyngeal arch artery, Congenital heart disease, Truncus arteriosus, Interrupted aortic arch, Outflow tract, Endoderm, Immunodeficiency
| INTRODUCTION |
|---|
|
|
|---|
A growing body of evidence indicates that signals from pharyngeal endoderm pattern the arch neural crest and mesoderm (Couly et al., 2002
; LeDouarin, 1982
; Piotrowski and Nusslein-Volhard, 2000
; Thomas et al., 1998
; Veitch et al., 1999
; Wendling et al., 2000
). This tissue expresses signaling molecules such as bone morphogenetic proteins, fibroblast growth factors (FGFs), Sonic hedgehog, and transcription factors including Hox A3, Pax1, Pax9 and Tbx1 (Dietrich and Gruss, 1995
; Garg et al., 2001
; Manley and Capecchi, 1998
; Peters et al., 1998
). Pharyngeal pouch endoderm gives rise to the thyroid, parathyroid and thymus glands. Interactions between neural crest and endoderm are important for early thymic and parathyroid development (Bockman and Kirby, 1984
; Le Douarin and Jotereau, 1975
; LeLievre and LeDouarin, 1975
) and later proliferation of the thymic epithelium has been shown to be dependent on FGF signaling (Revest et al., 2001
).
Haploinsufficiency of chromosome 22q11(del22q11) is the genetic abnormality shared by the majority of individuals diagnosed with DiGeorge sequence (DiGeorge, 1965
), Velocardiofacial syndrome (Shprintzen et al., 1978
) and Conotruncal anomaly face syndrome (Burn et al., 1993
) (for reviews, see Emanuel et al., 2001
; Lindsay, 2001
; Scambler, 2000
). The craniofacial, cardiovascular and glandular phenotypes that characterize these individuals indicate that all pharyngeal arch-derived structures may be affected. Affected individuals often present in the neonatal period with life-threatening cardiac malformations. Conotruncal defects such as persistent truncus arteriosus and Tetralogy of Fallot are common, as are aortic arch defects including interrupted aortic arch, right aortic arch and vascular ring (Emanuel et al., 2001
).
Molecular defects resulting from deletion of genes in del22q11 are hypothesized to adversely affect neural crest function during cardiac and pharyngeal arch development (Emanuel et al., 2001
; Robinson, 1975
; Van Mierop and Kutsche, 1986
). Mechanical ablation of premigratory cardiac neural crest from the posterior hindbrain of chick embryos produces many features of del22q11, including interrupted aortic arch type B and truncus arteriosus (Bockman et al., 1989
; Kirby and Waldo, 1990
). The results of Wnt1 and Pax3 neural crest lineage analyses provide evidence for the existence of a cardiac neural crest population in mammals as well (Epstein et al., 2000
; Jiang et al., 2000
). Furthermore, mice homozygous for mutations in the neural crest-expressed Pax3 gene [the splotch (Sp2h) mouse] show decreased numbers of migrating cardiac neural crest cells (Conway et al., 1997a
; Epstein et al., 2000
) and a severe phenotype that includes cardiovascular features of del22q11 (Conway et al., 1997b
; Franz, 1989
; Goulding et al., 1993
).
An enormous effort has been directed towards understanding how haploinsufficiency for the three megabase typically deleted region (TDR, the deletion found in 90% of affected individuals) of chromosome 22 results in the clinically heterogeneous del22q11syndromes. Investigators have attempted to model these syndromes in mice by deleting the region of murine chromosome 16 corresponding to the TDR (Kimber et al., 1999
; Lindsay et al., 1999
; Puech et al., 2000
). Others inactivated murine orthologs of genes within the TDR (Guris et al., 2001
; Jerome and Papaioannou, 2001
; Lindsay et al., 2001
; Merscher et al., 2001
; Saint-Jore et al., 1998
). In all cases, heterozygotes were either phenotypically normal or had partial phenotypes with cardiovascular defects that were infrequent and mild, relative to those seen in humans. Twenty five percent of heterozygous mice bearing an engineered deletion on chromosome 16 called Df1 had vascular malformations, predominantly affecting the right subclavian artery (Lindsay et al., 1999
). Crko1 heterozygotes (homologous to the CRKL locus in the human TDR) were normal, but homozygotes had vascular, thymic, parathyroid and craniofacial malformations (Guris et al., 2001
). Tbx1, another gene within the TDR, encodes a transcription factor in the T-box family expressed in the endoderm and mesoderm of the pharyngeal arches (Garg et al., 2001
). Tbx1-null homozygotes display the most severe features of del22q11; 100% of Tbx1-null homozygotes had truncus arteriosus and lacked thymus and parathyroid glands (Jerome and Papaioannou, 2001
).
Data from murine models and from humans suggest that multiple loci on chromosome 22 or elsewhere may function in the pathogenesis or act as modifiers of the del22q11 phenotype (Yamagishi et al., 1999
; Emanuel et al., 2001
; Lindsay, 2001
; Scambler, 2000
). Sequence and microdeletion analysis of nondeleted syndromic individuals has not revealed causal mutations in Tbx1 or other genes on 22q11 (Chieffo et al., 1997
; Wadey et al., 1999
; Emanuel et al., 2001
). Humans bearing identical deletions have highly variable phenotypes, both with regard to affected structures and presence and severity of cardiovascular disease. Indistinguishable phenotypes have been observed in association with deletions and translocations on chromosome 10p (Gottlieb et al., 1998
; Herve et al., 1984
) and as the result of teratogenic exposure. Dysfunction of genes that operate in common developmental or genetic pathways may independently generate or modify the del22q11 phenotype.
FGF8 is a secreted signaling molecule expressed in the developing brain, face and limbs, and in the endoderm and ectoderm of the pharyngeal pouches and grooves (Crossley and Martin, 1995
; MacArthur et al., 1995
). During embryogenesis, epithelially produced FGF8 provides survival, mitogenic, antidifferentiation and patterning signals to adjacent mesenchyme (Moon and Capecchi, 2000
; Lewandoski et al., 2000
; Trumpp et al., 1999
). Ectodermal FGF8 signaling has been demonstrated to regulate mesenchymal gene expression in the first pharyngeal arch (Tucker et al., 1999a
; Tucker et al., 1999b
); conditional ablation of FGF8 in first arch ectoderm results in craniofacial defects caused by death of first arch neural crest mesenchyme and perturbed expression of patterning genes (Trumpp et al., 1999
). Severe hypomorphism for FGF8 results in gastrulation and left-right asymmetry defects (Meyers et al., 1998
; Meyers and Martin, 1999
). We employ a hypomorphic allele of Fgf8 to demonstrate that FGF8 performs unique and required roles in development of murine pharyngeal arch and pouch-derived structures including the pharyngeal arch arteries (PAAs), cardiac outflow tract, heart, thymus and parathyroids. The constellation of anomalies displayed by these Fgf8 hypomorphic mutants is a remarkably complete phenocopy of human del22q11 syndrome. These animals provide an excellent model system in which to examine molecular and cellular pathways that result in this common and frequently lethal human syndrome.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Reverse-transcription, PCR amplification
Total RNA was isolated from E10.0 embryos with Trizol reagent (Gibco BRL) according to manufacturers instructions. One microgram of total RNA was reverse-transcribed with a first-strand cDNA synthesis kit (Omniscript, Qiagen) and 2 µl of the product was amplified with primers 5'-AAGCTCATTGTGGAGACCGAT-3' and 5'-AGCTCCCGCTGGATTCCTC-3' for X=28 and X+1=29 cycles to detect Fgf8 cDNA, or with primers 5'CCAGTATGACTCCACTCACGGCA 3' and 5'ATACTTGGCAGGTTTCGCCAGGCG 3' for X=13 and X+1=14 cycles to detect the GAPDH control cDNA. To assure that the results were quantitative, the cycle number for each primer set was optimized for amplification within the linear range.
Corrosion casting of vasculature
Pregnant females were anesthetized with a lethal dose of Avertin by intraperitoneal injection and the embryos removed. Thoracotomy was performed and the pericardium opened. Blue Mercox resin and catalyst (Ladd Research Industries #21246 and Benzoyl Peroxide CAS [94-36-0]) were injected into the left ventricle using a pulled glass needle. After allowing the resin to cure for 24 hours, the preparations were placed in Batsons #17 Maceration solution (Polysciences, Warrington, PA; catalog number, 07359) for 48-72 hours until tissues were completely dissolved. The casts were rinsed repeatedly in distilled water and stored in water.
Histology, immunohistochemistry and TUNEL analysis of sections
Embryos were fixed in 4% paraformaldehyde (E9-E11.5) or Bouins fixative (E18.5). Paraffin embedded E9.5 to E11.5 embryos were sectioned at 5 µm and stained with a monoclonal antibody against Pecam-1 (1:50, Pharmingen), to label endothelial cells within the vasculature. A biotinylinated goat anti-rat secondary antibody (1:75, Pharmingen) was used and sections were developed in 3, 3'-diaminobenzidine with nickel chloride chromagen (Vector Laboratories) and counterstained with Eosin. E18.5 embryos were sectioned at 10 µm and stained with Hematoxylin and Eosin.
For cryosections, embryos were fixed in 4% paraformaldehyde and then protected in a sequential series of 10, 20 and 30% sucrose/PBS solutions, oriented in OCT (Tissue Tek) filled molds and rapidly frozen, then sectioned at 10 µm transversely with respect to neural tube and in parallel with the third pharyngeal arch. Sections were washed with PBS, blocked in 2% bovine serum albumin with 0.5% Triton-X100 and incubated overnight with primary antibodies: mouse monoclonal anti-AP2
(1:25, 3B5, Developmental Studies Hybridoma Bank), rabbit polyclonal anti-class III ß-tubulin (1:500,Covance,
-Tuj1) or rabbit polyclonal antiphosphohistone H3 (1:100, Upstate Biotechnology,
-PHH3). Sections were washed, blocked and incubated with FITC conjugated anti-mouse IgG antibody (1:500, Molecular Probes), Cy-5 conjugated anti-rabbit IgG antibody (1:500, Jackson Laboratories), and TMR Red in situ cell death detection reagents (Roche). Sections were preserved in Vectashield anti-fading reagent (Vector Laboratories) and observed with confocal analysis at 20x magnification.
Whole-mount in situ hybridization
In situ hybridization on intact embryos was carried out as previously described (Moon et al., 2000
). The plasmids used to generate riboprobes were generously provided by N. Miura (mfh-1), B. Morrow (tbx-1), D. Srivastava (hrt-1) and D. Ornitz (Fgf10).
Flow cytometry
Thymocytes from embryos at 18.5 days of gestation were dispersed through nylon mesh into PBS, washed, counted on a hemocytometer using Trypan Blue to exclude non-viable cells, stained for cell surface markers (PE-anti-CD25, PerCP-anti-CD8, APC-anti-CD4, FITC-anti-CD44 from PharMingen), washed, resuspended in PBS and analyzed by flow cytometry on a FACSCaliber® (Becton Dickinson).
Alkaline phosphatase staining
Alkaline phosphatase staining of wholemounts was performed as previously described (Moon et al., 2000
).
Whole-mount TUNEL analysis
Somite matched E9.5 embryos were fixed and subjected to Terminal UTP nick end labeling (TUNEL) as described elsewhere (Stadler et al., 2001
). Confocal analysis was performed as above. Photomicrographs were taken at 8x magnification.
Fluorescent imaging
FITC, CY5, and Texas red fluorescence were recorded using a BioRad MRC 1024 laser-scanning confocal imaging system fitted to a Leitz Aristoplan microscope using filters supplied by the manufacturer. A digital Kalman averaging filter was used to reduce background fluorescence.
| RESULTS |
|---|
|
|
|---|
|
Fgf8H/ mice die from congenital cardiovascular defects
Multiple, severe developmental defects contribute to the neonatal demise of some mutants; however, most die a cardiovascular death, with progressive cyanosis and respiratory failure. We discovered cardiovascular defects in 95% of 60 term mutants, most of which were lethal malformations (Fig. 2, summarized in Table 1).
|
|
Vascular defects were observed in the majority of mutants (see Table 1) and included interrupted aortic arch type B, in which the arch of the aorta fails to form between the left common carotid artery and left subclavian artery (IAAB, Fig. 2O); right aortic arch (Fig. 2P); and anomalous origin of the subclavian arteries. These defects indicate that formation, stabilization or remodeling of the fourth PAAs is disrupted in the mutants. The right and left fourth PAAs form between E 9.5-E10.0. The right fourth PAA gives rise to the origin of the right subclavian artery. The left fourth PAA becomes the arch of the aorta between the left common carotid artery and left subclavian artery which is the portion of the aorta that is absent in IAAB.
To evaluate fourth PAA formation, we performed intravascular ink injections in E9.5 to E 11.5 mutants and controls. At E9.5, prior to the formation of the fourth PAA, mutant animals have patent PAAs 1-3, as do controls (Fig. 3A,B). The fourth PAA is not patent to ink injection in E10.0 to E11.5 mutants (Fig. 3C-F). All mutants display abnormal fourth PAA formation bilaterally at E10.5 (Table 2). The absence of these arteries can not be attributed to growth delay, as the sixth PAA is present by E10-10.5 (Fig. 3D,F,H,J). A mutant sectioned coronally through the pharyngeal arches and immunohistochemically stained with the endothelial marker PECAM demonstrates that endothelial cells can be detected in the left fourth arch region, although they are disorganized and no vessel lumen is evident (Fig. 3H, left side). On the right-hand side of this animal, the right fourth vessel appears patent in the section displayed, but serial sections revealed that it never connected with the dorsal aorta.
|
|
|
Fgf8H/ mice exhibit thymic and parathyroid aplasia and hypoplasia
The thymus and parathyroid glands develop from the third and fourth pharyngeal pouch endoderm and migrate caudally to their final location in the mediastinum. We analyzed mutants by gross dissection and in sections, and found that 50% of mutants had no detectable thymus, while in another 50% the thymus was hypoplastic with small single or double lobes or strands of thymic tissue ectopically located in the rostral region of the neck (Fig. 5A-C). Rarely, ectopic thymic tissue could be found penetrating into the oropharynx of E18.5 mutants (data not shown). The parathyroid glands were aplastic or hypoplastic in 50% of mutants (Fig. 5D-F).
|
Fgf8 is not expressed in neural crest cells
The Fgf8H/ mutant phenotypes are striking in their similarity to human del22q11 syndromes and animal models of neural crest dysfunction. Although Fgf8 expression has not been reported in neural crest in the mouse, it is possible that these defects arise from a deficiency of FGF8 in a previously undetected expression domain in neural crest. To determine if Fgf8 is expressed in premigratory or migratory neural crest, we combined the Wnt1-Cre transgene (Jiang et al., 2000
) with the alkaline phosphatase (AP) reporter/conditional features of the Fgf8H allele (Moon and Capecchi, 2000
) (Fig. 1A). LoxP sites flank exon 5 and neor, and enable conditional expression of the AP reporter upon Cre-mediated recombination of the Fgf8H allele. In this experiment, cells of the Wnt1 lineage, including premigratory cardiac neural crest (Echelard et al., 1994
), contain the recombined Fgf8H allele; thus, blue AP staining indicates cells that currently or previously express(ed) Wnt1, and that currently express Fgf8 (Fig. 6). We detected overlapping domains of Wnt1 and Fgf8 expression in the isthmus and frontonasal prominences at E9.5 (Crossley and Martin, 1995
; Echelard et al., 1994
), but none in the domain of premigratory or migratory cardiac neural crest, which originates in rhombomeres six through eight, at either E8.5 or E9.5. These results suggest that the cardiovascular and glandular phenotypes of Fgf8 mutants result from altered signaling between the pharyngeal epithelium, the mesodermal mesenchyme, and neural crest en route to the arches, outflow tract and heart.
|
|
antibody to label migrating neural crest in cryosectioned embryos (Mitchell et al., 1991
double-labeled cells (yellow signal, yellow arrowheads) in neural crest migrating from rhombomeres 6 and 7 into the lateral developing fourth and sixth arches. This finding was reproducible and persisted to the 29 somite stage (Fig. 8C,D). No reproducible differences in proliferation were detected at this stage, as assayed with an antiphosphohistone H3 antibody to label chromatin in proliferating cells. Note that in whole-mount TUNEL and cryosectioned specimens, many of the apoptotic cells are distant from the sources of FGF8 in the pharyngeal pouches and clefts shown in Fig. 7 (Crossley and Martin, 1995
|
| DISCUSSION |
|---|
|
|
|---|
Deficiency of FGF8 causes cardiovascular, craniofacial and glandular phenotypes resulting from abnormal pharyngeal arch development, altered mesenchymal expression of Fgf10 and decreased neural crest survival. Similar to our observation in the developing limb (Moon and Capecchi, 2000
), we found that epithelial FGF8 is required for expression of Fgf10 in the pharyngeal arch mesenchyme, including the region of the developing fourth pharyngeal arch and the putative secondary heart field (Kelly et al., 2001
). Further experiments will be required to determine if aspects of the outflow tract defects seen in Fgf8 hypomorphs are related to this finding. Tissue-specific ablation of FGF8 in the pharyngeal epithelia may clarify its role in this region.
Although cardiac neural crest does not itself express Fgf8, Fgf8 mutants display increased apoptosis in this tissue, indicating that FGF8 signaling from pouch endoderm and ectoderm is important for its survival. FGF receptors are expressed in the ectoderm and throughout the mesenchyme of the pharyngeal arches (MacArthur et al., 1995
; Orr-Urtreger et al., 1993
; Orr-Urtreger et al., 1991
; Peters et al., 1992
). Our whole-mount TUNEL and analysis of apoptosis in sections reveals that some of the apoptosis is (not surprisingly) directly adjacent to sites of epithelial Fgf8 expression (Crossley and Martin, 1995
; Heikinheimo et al., 1994
; MacArthur et al., 1995
) (Fig. 7) and probably reflects the failure of FGF8/FGFR1- or FGF8/FGFR2-mediated signaling. However, other large domains of mesenchymal apoptosis are relatively distant from these sources. This finding suggests that altered FGF8 signaling is sensed or relayed distant to its expression domains; such relays may, or may not, be based on FGF/FGFR interactions. We have reported the same phenomenon in proximal limb mesenchyme after conditional ablation of FGF8 in the distal limb ectoderm (Moon and Capecchi, 2000
) and reproduced this finding after ablation of both FGF4 and FGF8 in the limb ectoderm (A. M. Boulet, M. R. C. and A. M. M., unpublished). Ablation of FGF8 in first arch ectoderm results in abnormal apoptosis of neural crest-derived mesenchyme (much of which is distant to the epithelial FGF8 source (Trumpp et al., 1999
), similar to that described here.
The phenotypes of Fgf8 and Tbx1 mutants confirm that pharyngeal endoderm plays a crucial role in patterning the pharyngeal neural crest and mesoderm-derived mesenchyme (Couly et al., 2002
; LeDouarin, 1982
; Piotrowski and Nusslein-Volhard, 2000
; Thomas et al., 1998
; Veitch et al., 1999
; Wendling et al., 2000
). The importance of cardiac neural crest in the pathogenesis of the human del22q11 syndromes is supported by neural crest ablations in chick (Creazzo et al., 1998
) and the splotch mouse (Conway et al., 1997b
; Epstein et al., 2000
). Several mouse models with neural crest dysfunction exhibit conotruncal and aortic arch defects (Bamforth et al., 2001
; Feiner et al., 2001
; Mendelsohn et al., 1994
; Schorle et al., 1996
; Zhang et al., 1996
). Our results concur with accumulating evidence that neural crest cells rely on signals from adjacent tissues for patterning and survival en route to their targets (Trainor and Krumlauf, 2000
) and indicate an important role for epithelial-mesenchymal interactions in neural crest function during development.
Aortic arch abnormalities arise from defects in formation or remodeling of the PAAs, although models vary considerably in pathogenesis. In neural crest-ablated chicks, PAA 3, PAA 4 and PAA 6 are formed but rapidly regress (Kirby, 1999
). This indicates that interactions between neural crest, the primitive vessel and possibly the mesodermal mesenchyme are required for stabilization and subsequent remodeling of the vessel. In Df1 heterozygotes or Tbx1 haploinsufficient mice, the fourth PAA is specifically affected. These mutants initially form an endothelialized tube that is not stabilized and by E10.5, 100% of animals have a nonpatent vessel (Lindsay and Baldini, 2001
; Lindsay et al., 1999
; Lindsay et al., 2001
). Recovery from this defect is variable resulting in a 30% incidence of primarily right-sided cardiovascular defects. Homozygous mutants of Crkol, Mfh1 or genes in the endothelin signaling pathway all demonstrate fourth PAA defects in which arteries form normally, but regress to a variable extent after E11.5 (Guris et al., 2001
; Iida et al., 1997
; Kurihara et al., 1995
; Yanagisawa et al., 1998
). Our Fgf8 mutants exhibit early defects in vessel formation and stabilization similar to the Tbx1 and Df1 mutants described by Lindsay and colleagues (Lindsay and Baldini, 2001
; Lindsay et al., 1999
; Lindsay et al., 2001
). Endothelial cells are aggregated in the fourth arch at E10.5, but patent vessel lumens are not evident. However, we see a greater proportion of left sided and bilateral defects at E10.5, and no evidence of recovery by E11.5. This results in a greater incidence of fourth PAA defects in the newborns, particularly the more severe left-sided phenotypes of IAAB and right aortic arch.
The Fgf8 hypomorphic phenotype suggests that Fgf8 may contribute to the variability of human del22q11 phenotypes as a modifier, or may be a causative locus in syndromic individuals that do not have deletions of 22q11. Complete inactivation of one allele of Fgf8 in conjunction with a decrease in function of the remaining allele in mice provides a spectrum of disease closely resembling that seen in humans. FGF8 may participate directly in molecular pathways affected by deletions in the 22q11 region or function in parallel pathways required for normal development of pharyngeal arch and neural crest-derived tissues.
Given the lack of genotype-phenotype correlation in humans with the 22q11 deletion, it is possible that dysfunction of other developmentally active loci is required to produce the most severe del22q11 phenotypes. To test this hypothesis in mice, we are searching for genetic interactions by evaluating mice bearing combinations of mutant loci known to generate aspects of this phenotype. Screening individuals with del22q11 for mutations on the nondeleted chromosome 22 or for mutations in genes known to contribute to pharyngeal arch development (Fgf8, Pax3, for example) will provide another important test of this hypothesis.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Bamforth, S. D., Braganca, J., Eloranta, J. J., Murdoch, J. N., Marques, F. I., Kranc, K. R., Farza, H., Henderson, D. J., Hurst, H. C. and Bhattacharya, S. (2001). Cardiac malformations, adrenal agenesis, neural crest defects and exencephaly in mice lacking Cited2, a new Tfap2 co-activator. Nat. Genet. 29, 469-474.[Medline]
Birgbauer, E., Sechrist, J., Bronner-Fraser, M. and Fraser, S. (1995). Rhombomeric origin and rostrocaudal reassortment of neural crest cells revealed by intravital microscopy. Development 121, 935-945.[Abstract]
Bockman, D. E. and Kirby, M. L. (1984). Dependence of thymus development on derivatives of the neural crest. Science 223, 498-500.
Bockman, D. E., Redmond, M. E. and Kirby, M. L. (1989). Alteration of early vascular development after ablation of cranial neural crest. Anat. Rec. 225, 209-217.[Medline]
Burn, J., Takao, A., Wilson, D., Cross, I., Momma, K., Wadey, R., Scambler, P. and Goodship, J. (1993). Conotruncal anomaly face syndrome is associated with a deletion within chromosome 22q11. J. Med. Genet. 30, 822-824.[Abstract]
Chieffo, C., Garvey, N., Gong, W., Roe, B., Zhang, G., Silver, L., Emanuel, B. S. and Budarf, M. L. (1997). Isolation and characterization of a gene from the DiGeorge chromosomal region homologous to the mouse Tbx1 gene. Genomics 43, 267-277.[Medline]
Conway, S. J., Henderson, D. J. and Copp, A. J. (1997a). Pax3 is required for cardiac neural crest migration in the mouse: evidence from the splotch (Sp2H) mutant. Development 124, 505-514.[Abstract]
Conway, S. J., Henderson, D. J., Kirby, M. L., Anderson, R. H. and Copp, A. J. (1997b). Development of a lethal congenital heart defect in the splotch (Pax3) mutant mouse. Cardiovasc. Res. 36, 163-173.
Couly, G., Creuzet, S., Bennaceur, S., Vincent, C. and le Douarin, N. M. (2002). Interactions between Hox-negative cephalic neural crest cells and the foregut endoderm in patterning the facial skeleton in the vertebrate head. Development 129, 1061-1073.
Creazzo, T. L., Godt, R. E., Leatherbury, L., Conway, S. J. and Kirby, M. L. (1998). Role of cardiac neural crest cells in cardiovascular development. Annu. Rev. Physiol. 60, 267-286.[Medline]
Crossley, P. H. and Martin, G. R. (1995). The mouse Fgf8 gene encodes a family of polypeptides and is expressed in regions that direct outgrowth and patterning in the developing embryo. Development 121, 439-451.[Abstract]
Dietrich, S. and Gruss, P. (1995). undulated phenotypes suggest a role of Pax-1 for the development of vertebral and extravertebral structures. Dev. Biol. 167, 529-548.[Medline]
DiGeorge, A. M. (1965). Discussion on a new concept of the cellular basis of immunology. J. Pediatr. 67, 907.
Echelard, Y., Vassileva, G. and McMahon, A. P. (1994). Cis-acting regulatory sequences governing Wnt-1 expression in the developing mouse CNS. Development 120, 2213-2224.[Abstract]
Emanuel, B. S., McDonald-McGinn, D., Saitta, S. C. and Zackai, E. H. (2001). The 22q11.2 deletion syndrome. Adv. Pediatr. 48, 39-73.[Medline]
Epstein, J. A., Li, J., Lang, D., Chen, F., Brown, C. B., Jin, F., Lu, M. M., Thomas, M., Liu, E., Wessels, A. et al. (2000). Migration of cardiac neural crest cells in Splotch embryos. Development 127, 1869-1878.[Abstract]
Etchevers, H. C., Couly, G., Vincent, C. and le Douarin, N. M. (1999). Anterior cephalic neural crest is required for forebrain viability. Development 126, 3533-3543.[Abstract]
Feiner, L., Webber, A. L., Brown, C. B., Lu, M. M., Jia, L., Feinstein, P., Mombaerts, P., Epstein, J. A. and Raper, J. A. (2001). Targeted disruption of semaphorin 3C leads to persistent truncus arteriosus and aortic arch interruption. Development 128, 3061-3070.
Franz, T. (1989). Persistent truncus arteriosus in the Splotch mutant mouse. Anat. Embryol. 180, 457-464.[Medline]
Garg, V., Yamagishi, C., Hu, T., Kathiriya, I. S., Yamagishi, H. and Srivastava, D. (2001). Tbx1, a DiGeorge syndrome candidate gene, is regulated by sonic hedgehog during pharyngeal arch development. Dev. Biol. 235, 62-73.[Medline]
Gottlieb, S., Driscoll, D. A., Punnett, H. H., Sellinger, B., Emanuel, B. S. and Budarf, M. L. (1998). Characterization of 10p deletions suggests two nonoverlapping regions contribute to the DiGeorge syndrome phenotype. Am. J. Hum. Genet. 62, 495-498.[Medline]
Goulding, M., Sterrer, S., Fleming, J., Balling, R., Nadeau, J., Moore, K. J., Brown, S. D., Steel, K. P. and Gruss, P. (1993). Analysis of the Pax-3 gene in the mouse mutant splotch. Genomics 17, 355-363.[Medline]
Guris, D. L., Fantes, J., Tara, D., Druker, B. J. and Imamoto, A. (2001). Mice lacking the homologue of the human 22q11.2 gene CRKL phenocopy neurocristopathies of DiGeorge syndrome. Nat. Genet. 27, 293-298.[Medline]
Heikinheimo, M., Lawshe, A., Shackelford, G. M., Wilson, D. B. and MacArthur, C. A. (1994). Fgf-8 expression in the post-gastrulation mouse suggests roles in the develoopment of the face, limbs and central nervous system. Mech. Dev. 48, 129-138.[Medline]
Herve, J., Warnet, J. F., Jeaneau-Bellego, E., Portnoi, M. F., Taillemitte, J. L. and Herve, F. (1984). Partial monosomy of the short arm of chromosome 10, associated with Riegers syndrome and a Di George type partial immunodeficiency. Ann. Pediatr. 31, 77-80.
Iida, K., Koseki, H., Kakinuma, H., Kato, N., Mizutani-Koseki, Y., Ohuchi, H., Yoshioka, H., Noji, S., Kawamura, K., Kataoka, Y. et al. (1997). Essential roles of the winged helix transcription factor MFH-1 in aortic arch patterning and skeletogenesis. Development 124, 4627-4638.[Abstract]
Jawad, A. F., McDonald-Mcginn, D. M., Zackai, E. and Sullivan, K. E. (2001). Immunologic features of chromosome 22q11.2 deletion syndrome (DiGeorge syndrome/velocardiofacial syndrome). J. Pediatr. 139, 715-723.[Medline]
Jerome, L. A. and Papaioannou, V. E. (2001). DiGeorge syndrome phenotype in mice mutant for the T-box gene, Tbx1. Nat. Genet. 27, 286-291.[Medline]
Jiang, X., Rowitch, D. H., Soriano, P., McMahon, A. P. and Sucov, H. M. (2000). Fate of the mammalian cardiac neural crest. Development 127, 1607-1616.[Abstract]
Kelly, R. G., Brown, N. A. and Buckingham, M. E. (2001). The arterial pole of the mouse heart forms from Fgf10-expressing cells in pharyngeal mesoderm. Dev. Cell 1, 435-440.[Medline]
Kimber, W. L., Hsieh, P., Hirotsune, S., Yuva-Paylor, L., Sutherland, H. F., Chen, A., Ruiz-Lozano, P., Hoogstraten-Miller, S. L., Chien, K. R., Paylor, R. et al. (1999). Deletion of 150 kb in the minimal DiGeorge/velocardiofacial syndrome critical region in mouse. Hum. Mol. Genet. 8, 2229-2237.
Kirby, M. (1999). Contribution of neural crest to heart and vessel morphology. In Heart Development (ed. N. Rosenthal), pp. 179-193. San Diego, CA: Academic Press.
Kirby, M. L. and Waldo, K. L. (1990). Role of neural crest in congenital heart disease. Circulation 82, 332-340.
Kurihara, Y., Kurihara, H., Oda, H., Maemura, K., Nagai, R., Ishikawa, T. and Yazaki, Y. (1995). Aortic arch malformations and ventricular septal defect in mice deficient in endothelin-1. J. Clin. Invest. 96, 293-300.
Le Douarin, N. M. and Jotereau, F. V. (1975). Tracing of cells of the avian thymus through embryonic life in interspecific chimeras. J. Exp. Med. 142, 17-40.
LeDouarin, N. (1982). The Neural Crest. Cambridge: Cambridge University Press.
LeLievre, C. S. and LeDouarin, N. (1975). Mesenchymal derivatives of the neural crest: analysis of chimaeric quail and chick embryos. J. Embryol. Exp. Morphol. 34, 125-154.[Medline]
Lewandoski, M., Sun, X. and Martin, G. R. (2000). Fgf8 signalling from the AER is essential for normal limb development. Nat. Genet. 26, 460-463.[Medline]
Lindsay, E. A. (2001). Chromosomal microdeletions: dissecting del22q11 syndrome. Nat. Rev. Genet. 2, 858-868.[Medline]
Lindsay, E. A. and Baldini, A. (2001). Recovery from arterial growth delay reduces penetrance of cardiovascular defects in mice deleted for the DiGeorge syndrome region. Hum. Mol. Genet. 10, 997-1002.
Lindsay, E. A., Botta, A., Jurecic, V., Carattini-Rivera, S., Cheah, Y. C., Rosenblatt, H. M., Bradley, A. and Baldini, A. (1999). Congenital heart disease in mice deficient for the DiGeorge syndrome region. Nature 401, 379-383.[Medline]
Lindsay, E. A., Vitelli, F., Su, H., Morishima, M., Huynh, T., Pramparo, T., Jurecic, V., Ogunrinu, G., Sutherland, H. F., Scambler, P. J. et al. (2001). Tbx1 haploinsufficieny in the DiGeorge syndrome region causes aortic arch defects in mice. Nature 410, 97-101.[Medline]
MacArthur, C. A., Lawshe, A., Xu, J., Santos-Ocampo, S., Heikinheimo, M., Chellaiah, A. T. and Ornitz, D. M. (1995). FGF-8 isoforms activate receptor splice forms that are expressed in mesenchymal regions of mouse development. Development 121, 3603-3613.[Abstract]
Manley, N. R. and Capecchi, M. R. (1998). Hox group 3 paralogs regulate the development and migration of the thymus, thyroid, and parathyroid glands. Dev. Biol. 195, 1-15.[Medline]
Mendelsohn, C., Lohnes, D., Decimo, D., Lufkin, T., LeMeur, M., Chambon, P. and Mark, M. (1994). Function of the retinoic acid receptors (RARs) during development (II). Multiple abnormalities at various stages of organogenesis in RAR double mutants. Development 120, 2749-2771.[Abstract]
Merscher, S., Funke, B., Epstein, J. A., Heyer, J., Puech, A., Lu, M. M., Xavier, R. J., Demay, M. B., Russell, R. G., Factor, S. et al. (2001). TBX1 is responsible for cardiovascular defects in velo-cardio-facial/DiGeorge syndrome. Cell 104, 61