|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00095
1 Dipartimento di Fisiologia e Biochimica, Laboratorio di Biologia Cellulare e
dello Sviluppo, Università di Pisa, Via G. Carducci 13, 56010 Ghezzano
(Pisa), Italy
2 Department of Anatomy, University of Cambridge, Downing Street, Cambridge CB2
3DY, UK
* Author for correspondence (e-mail: rvignali{at}dfb.unipi.it)
Accepted 7 August 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Neural induction, Forebrain, Telencephalon, Organizer, Anterior endoderm, Cerberus, Chordin, FGF, Xenopus
| INTRODUCTION |
|---|
|
|
|---|
Particular interest has been focused on the signals that promote the
spatially restricted expression of patterning genes within the developing CNS.
Perhaps the best known model that has been proposed to explain neural
patterning is the activation/transformation model of Nieuwkoop and co-workers
(Nieuwkoop et al., 1952
;
Nieuwkoop and Nigtevecht,
1954
; Foley et al.,
2000
; Foley and Stern,
2001
; Stern,
2001
), who suggested that early induction and patterning of the
neuroectoderm occurs in two steps. During a first step (`activation'), the
dorsal ectoderm is initially induced from the adjacent and underlying
mesendoderm to presumptive forebrain neuroectoderm. Subsequently, during the
second step (`transformation'), some of this tissue receives caudalizing
signals from the posterior dorsal mesoderm. This model has received strong
molecular support from studies on Xenopus. Several factors that can
work as `activators' have been identified in the secreted molecules noggin
(Lamb et al., 1993
; Zimmerman
et al., 1996), chordin (Sasai et al.,
1994
; Piccolo et al.,
1996
), follistatin
(Hemmati-Brivanlou et al.,
1994
), Xnr3 (Smith et al.,
1995
; Hansen et al.,
1997
) and cerberus (Bouwmeester
et al., 1996
; Piccolo et al.,
1999
). They are all expressed in the dorsal mesendoderm during
gastrula/neurula developmental stages and work as extra-cellular antagonists
of bone morphogenetic proteins (BMPs). Molecules with characteristics of
`transformers' include retinoic acid, Wnts and FGFs, all of which can activate
expression of posterior neural genes in neuroectoderm
(Sasai and de Robertis, 1997
;
Gamse and Sive, 2001
).
While the two-signal model may be sufficient to explain how the CNS is
subdivided into main regions such as forebrain, midbrain, hindbrain and spinal
cord, it does not explicitly account for the complex subregionalization of the
forebrain itself. In principle, this could result from either a gradient of a
single anterior inducing activity, or from the integration of multiple,
qualitatively different, activities. Inhibition of BMP signaling appears to be
a crucial step in forebrain induction, as shown by the double knockout of
chordin and noggin in the mouse
(Bachiller et al., 2000
).
However, several lines of evidence suggest that, within the most anterior
region of the neural plate, inhibition of BMP signaling needs to be integrated
by other activities that counteract Wnt and Nodal signaling, thereby promoting
forebrain development (Glinka et al.,
1997
; Piccolo et al.,
1999
). Some of these molecules have been identified as the
Wnt-inhibitors Dkk1, Frzb1, crescent and sFRP2
(Leyns et al., 1997
;
Wang et al., 1997
;
Glinka et al., 1998
; Pera et
al., 2000), the Nodal inhibitor Lefty1
(Meno et al., 1999
), or
cerberus, a triple inhibitor of BMP, Wnt and Nodal
(Piccolo et al., 1999
), all of
which are expressed in anterior mesendodermal tissues. Moreover, IGF signaling
also appears to be required for head formation in Xenopus
(Pera et al., 2001
). Finally,
patterning of the most anterior parts of the CNS may be integrated by
additional signaling molecules, such as FGFs, Nodal, hedgehog proteins, Wnts
and BMPs, involved in locally modifying the regional character of the
forebrain neuroectoderm after its initial induction
(Shimamura and Rubenstein,
1997
; Furuta et al.,
1997
; Ye et al.,
1998
; Barth et al.,
1999
; Golden et al.,
1999
; Gunhaga et al.,
2000
; Shanmulingam et al., 2000;
Heisenberg et al., 2001
;
Rohr et al., 2001
;
Wilson and Rubenstein,
2000
).
Although all these data have started to clarify the molecular mechanisms that govern induction and patterning of the forebrain region, the fact that experiments were often performed on whole embryos did not allow in many cases the dissection of the activity of single inducing/patterning molecules, and to distinguish their direct actions on the neuroectoderm from indirect actions due to effects on mesendodermal tissues. This can be carried out easily in the frog embryo by means of dissection/recombination and misexpression methods that allow the overexpression of genes in the context of tissue conjugation experiments. In this paper, we report on some of the tissue and molecular signals at work in the induction and patterning of the anterior CNS in Xenopus, with particular attention to the telencephalon. We show that dorsoventral patterning of the telencephalon is a complex process that cannot be elicited by simple inhibition of BMP signaling. Moreover, by dissection/recombination experiments, we identify the anterior dorsal endoderm (ADE) of the leading edge of the Xenopus gastrula embryo as a source of signals that can regulate dorsoventral patterning of the telencephalon, in possible cooperation with the adjacent prechordal mesendoderm. Finally, in animal cap assays, we have used different combinations of inducing and patterning molecules to show that dorsoventral telencephalic patterning can be reconstructed, at least partially, in naive ectoderm by the combined action of the ADE molecule cerberus and FGF signals.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
RNA methods and microinjections
Capped RNAs were synthesized from linearized plasmid templates as described
(Krieg and Melton, 1984
).
Embryos were injected with 10-2000 pg mRNA/embryo at the one- and eight-cell
stage as previously described (Vignali et
al., 2000
). The following template plasmids were used.
C1 (Fetka et al.,
2000
XFGFR-4a:
XFGFR-4a-pSP64T
(Hongo et al., 1999
RT-PCR was performed as described by Henry and Melton
(Henry and Melton, 1998
).
Embryo RNA was extracted with RNA-NucleoSpin kit (Macherey and Nagel) and
retro-transcribed with Superscript II (Invitrogen). PCR primers and conditions
were drawn from
http://www.hhmi.ucla.edu/derobertis/index.html,
except for cpl-1 (see Knecht and
Harland, 1997
), XBF-1 and nrp-1 (see
Hongo et al., 1999
). For
Xemxl, 35 cycles were used with primers GCAGAAGCCTTTGTCAGTGG
(forward) and CCTCCAGTTT-CTGCCTCTTG (reverse); for eomes, 32 cycles
were used with primers GCCTACGAAACAGACTACTCCT (forward) and
TAATGGAGGGAGGGGTTTCTAC (reverse).
Animal cap and conjugate assays
For animal cap and dissection/recombination assays, RNAs were injected in
the animal pole of one-cell stage embryos. Animal caps were dissected from
stage 9 or stage 10.5 embryos in 1xMBS; after healing, caps were
cultured in 0.5xMBS until early tailbud stage 22/23, or to late tailbud
stage 30/31 alongside with sibling embryos.
Dissections and culturing of dorsal ectoderm from gastrula stage embryos were similarly performed.
In conjugate experiments, embryo fragments were similarly dissected, recombined and cultured. Peptide-releasing beads (SIGMA H-5263) were washed in 1xPBS and then incubated overnight at 4°C in 5 µl of 1xPBS, 0.1% BSA containing either human bFGF (100 or 200 ng/µl; ICN) or mouse FGF8b (100, 200 or 400 ng/µl; R&D). Beads were implanted within pairs of animal caps dissected from either injected or uninjected embryos.
Dissections were performed in the presence of gentamycin (50 µg/ml final concentration).
| RESULTS |
|---|
|
|
|---|
In particular, we dissected, from stage 10.5 midgastrula embryos, fragments
of DE of about 500 µm comprised between the animal pole and about half way
between the dorsal blastopore lip and the leading edge of the involuting
dorsal mesendoderm, as outlined in the scheme in
Fig. 2. Data from one to seven
independent experiments (Table
1) depending on the analyzed marker indicate that
this DE region is already specified to develop as anterior neural tissue. In
fact, explants cultured up to stage 22/23 showed a strong expression of the
pan-neural marker nrp-1 (Knecht
et al., 1995
), of the fore/midbrain marker Xotx2
(Pannese et al., 1995
), of the
general telencephalic marker XBF-1 (also expressed in the nasal part
of the eye) (Papalopulu and Kintner,
1996
), of the eye marker Xrx1
(Casarosa et al., 1997
) or of
the ventral forebrain marker Xvax1b
(Liu et al., 2001
)
(Fig. 2A-C,F,G;
Table 1). However, only few of
the explants showed a faint staining for the dorsal telencephalic marker
Xemx1 (Pannese et al.,
1998
) (Fig. 2H;
Table 1). We also found that
more posterior markers such as Xkrox-20
(Bradley et al., 1993
) and
XhoxB9 (Wright et al.,
1990
) were not activated at all, or activated only in few explants
(Fig. 2D,E;
Table 1). By contrast, when the
explants were cultured to stage 30/31, not only did they express Xrx1,
Xvax1b and the ventral forebrain marker Xnkx2.1
(Small et al., 2000
), but an
evident activation of Xemx1 also occurred
(Fig. 2K-M, Table 1; see
Fig. 6B and
Table 1 for Xnkx2.1).
To test for possible mesoderm contamination, a proportion of explants were
assayed for expression of chd
(Sasai et al., 1994
) (at the
equivalent of stage 12.5) or muscle actin
(Mohun et al., 1984
) (at stage
22/23), and found deprived of expression for either marker
(Fig. 2I,J;
Table 1). Therefore, although
some aspects of forebrain specification have already taken place by
midgastrulation, the onset of expression of dorsal telencephalic genes appears
to be significantly delayed in stage 10.5 explants. However, when DE was
dissected from late gastrula embryos, clear expression of Xemx1 was
already detectable at stage 22/23 (data not shown). These observations suggest
that further contact with the dorsal mesendoderm may be required between
mid-gastrula and end of gastrulation, to ensure a proper temporal
specification of the dorsal telencephalon.
|
|
|
|
|
|
The anterior dorsal mesendoderm plays a role in patterning of the
telencephalon
Because signals produced from dorsal mesendoderm may be important for
proper induction of dorsal telencephalon
(Pannese et al., 1998
), we
decided to assay the inducing/patterning abilities of different regions of
this tissue.
In order to do this reproducibly, different parts of the involuting
mesendoderm were dissected at stage 10.5, cultured to stage 12.5, and assayed
with Xhex, chd, gsc and Xnot-2 probes as diagnostic
molecular markers. We identified four different pieces, which were used in our
recombination experiments. Three of these fragments are contained within one
another, and correspond to the yellow, red and green pieces in the schemes of
Fig. 3. A first fragment of
about 100 µm, corresponding to the anterior dorsal endoderm (ADE; in yellow
in Fig. 3), strongly expressed
Xhex (Jones et al.,
1999
) (Fig. 3A;
Table 1); contamination by
prechordal mesoderm was excluded by absence of hybridization to a chd
probe (Fig. 3B;
Table 1), that specifically
labels the whole axial mesendoderm, but not the most anterior dorsal endoderm
(Sasai et al., 1994
). A larger
fragment of about 200 µm, corresponding to the anterior half of the
involuted anterior dorsal mesendoderm (ADME; in red in
Fig. 3), weakly expressed
gsc (Cho et al.,
1991
), a marker of prechordal mesoderm, strongly expressed
chd, but did not express Xnot-2
(Gont et al., 1993
), a marker
of presumptive notochord (Fig.
3C,D; Table 1; and
data not shown). By contrast, a still larger fragment of about 300 µm,
corresponding to the anterior three-quarters of the involuted ADME (in green
in Fig. 3), strongly expressed
gsc while showing a weak spot of Xnot-2 staining only in a
minority of explants (Fig.
3E,F; Table 1).
Finally, a fourth fragment of about 120 µm, corresponding to the posterior
quarter of the involuted ADME of stage 11 embryos (in brown in
Fig. 3), showed a weak
gsc, but a strong Xnot-2, expression
(Fig. 3G,H; Table 1). Thus, we conclude
that the `yellow' fragments correspond to the anterior endoderm of the leading
edge (ADE), while those in `red' or `green' appear to contain exclusively, or
almost exclusively, prechordal mesendoderm; finally, the `brown' fragment is
mainly composed of presumptive notochord tissue with little if any
prechordal mesendoderm.
We first separately analyzed the inducing properties of the prechordal mesendoderm (`green' fragment) compared with those of the presumptive anterior notochord (`brown' fragment). Their different inducing abilities were tested by conjugating either `green' or `brown' fragments with stage 9 animal caps, followed by in situ hybridization analysis of the conjugates at the corresponding of stage 22/23. A weak anterior neural induction was detected in the conjugates with the prechordal (`green') fragment, as shown by the occurrence of either weak or no activation of nrp-1, Xotx2, Xrx1, XBF-1 and Xemx1 genes after extensive color reaction (Fig. 4A-E; Table 1). By contrast, efficient induction of neural tissue took place in the conjugates made with presumptive anterior notochord (`brown') tissue, as shown by the strong activation of nrp-1; localized weak expression of Xotx2, Xrx1, XBF-1 and Xemx1 was detected only in a minority of explants (Fig. 4F-J; Table 2). By RT-PCR assay, very weak or no activation was detected for nrp-1, N-CAM, XBF-1, Xotx2, Xrx1 and Xemx1 in conjugates with the prechordal mesendoderm (Fig. 4K). Instead nrp-1, N-CAM, XBF-1, Xotx2 and Xrx1 were readily detected in conjugates with the anterior chordomesoderm, while Xemx1 was very weakly expressed in these recombinants (Fig. 4K), possibly owing to the presence of contaminating gsc-positive cells in the `brown' fragment (Fig. 3G). Therefore, the prechordal mesendoderm and the anterior notochord significantly differ in their neural inducing abilities, but neither tissue is able to efficiently induce dorsal telencephalic character in naive ectoderm. Differences between in situ hybridization and RT-PCR results may reflect the different potencies of the two techniques in detecting localized or average levels of expression.
|
|
|
|
|
|
It has been proposed that the ADE in Xenopus, and the
corresponding structure known as AVE in the mouse, may play a pivotal role in
forebrain development (Bouwmeester et al.,
1996
; Thomas and Beddington,
1996
). We therefore tested whether the ADE alone, without the
adjoining prechordal mesendoderm, could elicit Xemx1 activation in
midgastrula DE. We explanted DE fragments from stage 10.5 embryos together
with the underlying ADE (`yellow' piece of
Fig. 3), as in the lower scheme
in Fig. 6, and cultured them up
to stage 22/23. Control explants, made of DE alone (upper scheme of
Fig. 6), displayed a strong
Xrx1 (as a positive control of neuralization, data not shown), but no
Xemx1 activation (Fig.
6A; Table 1); by
contrast, most of the ADE-containing recombinates expressed Xemx1
(Fig. 6C;
Table 1). We also tested
whether the ADE had any effect on ventral forebrain marker specification, and
surprisingly found that while Xemx1 expression was maintained in
stage 30/31 recombinates (data not shown), Xnkx2.1 expression was
suppressed in these recombinates, compared with explants of DE
(Fig. 6B,D;
Table 1). These results suggest
that ADE may be important for specification of dorsal telencephalon, but may
have an inhibitory effect on ventral forebrain specification.
Organizer signals and induction of telencephalic markers in animal
caps
The organizer-secreted BMP antagonists noggin and Xnr3 are able to activate
Xotx2, but not Xemx1 and Xemx2 expression, in
Xenopus animal caps grown to stage 22/23
(Pannese et al., 1998
).
Because DE isolated from midgastrula embryos shows Xemx1 expression
only when cultured up to stage 30/31, and not to stage 22/23
(Fig. 2H,M; Table 1), we asked whether any
similar delayed activation of Xemx1 could take place in animal caps
neuralized by BMP antagonists.
Animal caps were dissected from stage 9 embryos injected with chd
mRNA. For optimal culture to later stages caps were joined in pairs to allow a
better healing of the explants (see scheme in
Fig. 8) and cultured up to
stage 22/23 or 30/31. After injection of doses of chd ranging from 10
to 600 pg, no induction of the dorsal telencephalic markers Xemx1 and
eomes (Ryan et al.,
1998
) was ever observed at either stage, either by in situ
hybridization or RT-PCR analysis (Fig.
7B,C; Fig. 9E,F;
Fig. 10;
Table 2 and data not shown).
Because different levels of BMP antagonism have been shown to induce neural
tissue of different dorsoventral character
(Knecht and Harland, 1997
), we
analyzed the dorsoventral organization of chd-injected caps in our
assays. Strong staining with the epidermal marker XK81 was detected
in chd-injected caps, indicating that explants retained epidermis and
possibly a dorsal boundary between neural tissue and epidermis in the
conditions used (Fig. 7D;
Table 2). Presence of a dorsal
neural tube boundary was also addressed by checking the expression of the
telencephalic dorsal neural tube boundary marker cpl-1
(Knecht et al., 1995
).
cpl-1 is strongly expressed in caps at low doses of injected
chd, but still detectable, though at low levels, at high doses
(Fig. 10); these results are
consistent with earlier observations
(Knecht and Harland, 1997
) and
show that even in conditions that promote cpl-1 strong expression,
Xemx1 and eomes are never induced. To rule out the
possibility that these results could be specific to Chd with respect to other
BMP antagonists, we also assayed Smad7, a global antagonist of the whole
TGF-ß pathway (Nakayama et al.,
2001
), and obtained similar results
(Fig. 7E-H; Table 2;
Fig. 10).
|
Because we showed that stage 10.5 ADME had a patterning activity on stage 10.5 neuralized DE, we asked whether it could integrate the action of BMP inhibitors to activate dorsal telencephalic genes. Therefore, stage 9 animal caps were explanted from chd injected embryos, conjugated with the ADME (`red' fragment of Fig. 3) of stage 10.5 control embryos and grown to stage 30/31 (see scheme in Fig. 8). Although conjugated pairs of chd injected caps did not express Xemx1 or eomes (Fig. 8G,H; Table 2), but expressed the positive control marker Xrx1 (Fig. 8I; Table 2), chd injected caps recombined with the ADME were positive both for Xemx1 and for eomes expression (Fig. 8J,K; Table 2). By contrast, uninjected caps conjugated with the ADME did not show any expression for Xemx1, eomes and Xrx1 (Fig. 8D,E,F), confirming the poor, if any, forebrain inducing activity of the ADME. These results demonstrate that the ADME is able to complement the action of BMP antagonists to promote development of dorsal telencephalon.
Head induction has been proposed to result from the triple inhibition of
BMP, Wnt and Nodal pathways (Glinka et
al., 1997
; Glinka et al.,
1998
; Piccolo et al.,
1999
) by several secreted proteins. Among them, cerberus has the
unique feature of being a triple BMP-Nodal-Wnt-antagonist; moreover, it is
expressed in the ADE, which plays a patterning role on the anterior
neuroectoderm (see above). Remarkably, when cerberus mRNA was
injected into animal caps, besides a strong activation of Xrx1 in the
vast majority of explants, also Xemx1 and eomes expression
was found in some of the animal caps (Fig.
9A-C; Table 2).
As cerberus is a triple BMP-Wnt-Nodal-inhibitor, we decided to define which
of these inhibitory activities was required for induction of dorsal
telencephalic genes. To achieve this, we made use of two previously described
constructs, cer-S and cer-
C1, encoding the C-terminal
(cer-S) and the N-terminal (cer-
C1) regions of cerberus, which have
been described as a Nodal-antagonist and as a Wnt-antagonist, respectively
(Piccolo et al., 1999
;
Fetka et al., 2000
). When the
anti-BMP activity of Chd was coupled to the anti-Nodal activity of cer-S, no
activation of either Xemx1 or eomes was detected
(Fig. 10), in agreement with
the result obtained with the general TGFß inhibitor Smad7
(Fig. 7F,G; Table 2;
Fig. 10). By contrast, the
combination of Chd and cer-
C1 was clearly able to induce both
Xemx1 and eomes, as detected by in situ hybridization and by
RT-PCR, while no activation was detectable in chd injected caps
(Fig. 9E-H;
Table 2; Fig. 10). cer-
C1 alone
was not able to induce any expression of Xemx1, eomes, NCAM and
Xrx1 at doses that were able to induce dorsal telencephalic genes in
combination with Chd, suggesting that cer-
C1, at least at these doses,
lacks neural inducing ability and hence does not retain significant
BMP-antagonizing activity (Fig.
10). However, we found that besides the previously described
Wnt-blocking activity (Fetka et al.,
2000
), cer-
C1 retains some Nodal-antagonizing activity
(data not shown). We also compared the effects of cer-
C1 with those of
Nxfz8, a potent Wnt-antagonist (Deardoff
et al., 1998
). In contrast to cer-
C1, neither a combination
of Chd and Nxfz8, nor a combination of Chd, Nxfz8 and cer-S, was able to
induce expression of Xemx1 or eomes
(Fig. 10), at doses of Nxfz8
that efficiently induced strong axial defects in whole embryos
(Deardoff at al., 1998
) (data
not shown). Similar results were obtained with the analogous construct ECD8
(Itoh and Sokol, 1999
) (data
not shown). Because the only qualitative difference between the combinations
Chd+cer-
C1 and Chd+Nxfz8+cer-S resides in the Wnt-inhibitory activities
of cer-
C1 and Nxfz8, these results suggest that the dorsal
telencephalic inducing activity of cerberus relies on its specific anti-Wnt
action; however, we cannot completely rule out the possibility that the
residual anti-Nodal activity of cer-
C1 may also be required.
In addition, we also tested induction of the ventral forebrain marker
Xnkx2.1 in these same caps. Xnkx2.1 was not induced by Chd,
Smad7, or the combinations of Chd+cer-S and Chd+cer-
C1
(Fig. 10), indicating that,
though cerberus is able to partially promote dorsal telencephalic fates, a
full patterning of the telencephalon may require the integration of different
molecular pathways.
Role of FGFs in patterning of the telencephalon
FGFs have been proposed to play important roles both in early neural
induction in the frog and the chick (Hongo
et al., 1999
; Streit et al.,
2000
), and in later patterning of the anterior neural plate, and
particularly the telencephalon, in the mouse
(Shimamura and Rubenstein,
1997
; Ye et al.,
1998
; Shanmugalingam et al.,
2000
) (reviewed by Rubenstein
et al., 1998
; Wilson and
Rubenstein, 2000
).
We therefore tested whether we could induce telencephalic genes in animal
caps by integrating the activities of Chd and cerberus with that of FGF. To do
this we conjugated pairs of animal caps, injected with either chd or
cerberus mRNA, around a bead soaked in bFGF or in FGF8 (see
Fig. 11). Animal caps were
dissected at stage 10.5, when they no longer respond to mesoderm inducing
signals, and therefore any effect of FGFs is a direct effect on ectoderm
(Lamb and Harland, 1995
). Cap
competence for mesoderm induction was excluded by failure of either bFGF or
FGF8 to induce Xbra (Smith et
al., 1991
) expression, while failure to detect expression of the
pan-neural marker Sox2 excluded any direct neural inducing activity
by FGFs (data not shown). However, it proved to be difficult to harvest stage
10.5 caps from chd-injected embryos, probably because excess
involution of dorsal mesendoderm made it impossible to dissect caps without
any underlying mesendoderm. Therefore, it would not be possible to
discriminate whether FGF activity, rather than signals from the underlying
mesendoderm, was responsible for any effect additional to that of Chd. We
therefore co-injected chd mRNA with cer-S, a
cerberus construct that, by inhibiting mesoderm formation
(Piccolo et al., 1999
), was
able to prevent any excessive involution of mesendoderm, and afterwards
dissected and conjugated the animal caps to FGF beads. The effects of
Chd+cer-S on caps dissected at stage 10.5 were not substantially different
from those on caps dissected at stage 9, at least for the markers we tested,
and resulted in no activation of the ventral gene Xnkx2.1
(Fig. 11A), essentially no
activation of the dorsal genes eomes
(Fig. 11F) and Xemx1
(Fig. 11K), and in a strong
activation of Xrx1 (data not shown). However, when FGF8 was added,
Xnkx2.1 expression was strongly activated in animal caps
(Fig. 11B,C;
Table 2), and activation was
also observed for eomes (Fig.
11G,H; Table 2); by
contrast, slight, if any, activation of Xemx1 was observed
(Fig. 11L,M;
Table 2). Similar effects were
also observed for bFGF (Fig.
11D,E,I,J,N,O; Table
2).
Different results were obtained when cerberus-injected caps were explanted at stage 10.5 and conjugated in pairs either without or with FGF-soaked beads. Again, Xnkx2.1 and Xnkx2.4 were not activated by the injected RNA (Fig. 11A',M'; Table 2); however, clear activation was observed for eomes (Fig. 11E'; Table 2) and for Xemx1 (Fig. 11I'; Table 2); finally, strong activation was observed in all caps for Xrx1 (data not shown). When FGF was added to cerberus-injected caps, Xnkx2.1 and Xnkx2.4 were strongly activated in almost all explants (Fig. 11B'-D',N'; Table 2) and an increase was also observed in the expression of eomes (Fig. 11F'-H'; Table 2). Instead, no significant difference was caused by FGFs on Xemx1 activation compared with cerberus alone (Fig. 11J'-L'; Table 2).
These data indicate that FGF signals can promote ventral forebrain fates
and may also be important for regulation of dorsal telencephalic fates. To
further investigate this, we interfered with the FGF signaling pathway by
using a dominant-negative FGF receptor,
XFGFR-4a, which blocks the
effects of FGF8 on neural tissues (Hongo
et al., 1999
; Hardcastle et
al., 2000
). We therefore injected
XFGFR-4a mRNA in
the animal region of Xenopus early embryos and subsequently
conjugated stage 9 animal caps explanted from these embryos with a full stage
10-10+ organizer. Control conjugates were made with uninjected
animal caps and the organizer. Experimental and control conjugates were
assayed for the ventral marker Xnkx2.1 and the dorsal marker
Xemx1 at stage 30/31. Although in control explants both genes are
strongly activated (Fig.
12A,B; Table 2), in
experimental conjugates, expression of both genes was substantially suppressed
(Fig. 12D,E;
Table 2). By contrast, there
was no apparent effect on neural induction, as the expression of the
pan-neural marker Sox2 (Misuzeki
et al., 1998
) was essentially the same in the two sets of
conjugates (Fig. 12C,F;
Table 2). These data therefore
suggest that FGF signals are required for correct patterning of the
forebrain.
| DISCUSSION |
|---|
|
|
|---|
The ADE may be involved in controlling the dorsoventral patterning of
the telencephalon
In the last few years, work on several vertebrate models has unravelled a
crucial role of anterior endodermal tissues in forebrain development. In
particular, the mouse anterior visceral endoderm (AVE) is essential for
forebrain induction and patterning, as shown by both embryological and genetic
manipulations. Indeed, removal of the AVE at the earliest stages of
gastrulation impairs activation of rostral CNS markers in the epiblast
(Thomas and Beddington, 1996
).
Moreover, before their activation in the axial mesendoderm, several genes
required for forebrain development, such as Lim1, Otx2, HNF3ß
and nodal, are expressed in the pregastrula stage AVE, where their
activities are specifically required for proper forebrain formation (reviewed
by Beddington and Robertson,
1998
). Recently, the chick hypoblast has been proposed as the
embryological and functional equivalent of the mouse AVE. In fact, genetic
activities characteristic of mouse AVE are also detectable in chick hypoblast
at pre-streak stages; moreover, the hypoblast induces pre-forebrain markers in
the epiblast before streak formation and protects the forebrain territory from
caudalizing signals by directing cell movements that distance the anterior
epiblast from the organizer (Foley et al.,
2000
). During gastrulation, both mouse AVE and chick hypoblast are
displaced by the involuting foregut endoderm; also this tissue has important
functions for proper forebrain formation: in chick, removal of the foregut
endoderm during gastrulation results in severely compromised forebrain
patterning (Withington et al.,
2001
). In addition, the foregut endoderm shares some of the
genetic activities of the mouse AVE or chick hypoblast, such as
cerberus and Hex. Knock-out of the Hex gene in the
mouse and analysis of chimeric embryos showed that Hex function is
specifically required in the foregut endoderm for normal forebrain development
(Martinez Barbera et al.,
2000
). Therefore it is likely that the AVE/hypoblast and the
foregut endoderm may play similar roles and that the anti-caudalizing activity
of the AVE/hypoblast is taken over at later stages by the foregut endoderm
and/or prechordal mesendoderm (Foley et
al., 2000
; Foley and Stern,
2001
; Stern,
2001
). Although in chick and mouse this activity occurs in two
separate tissues (the AVE/hypoblast and the foregut endoderm), in
Xenopus, the anterior dorsal endoderm (ADE) that constitutes the
leading edge of the involuting dorsal mesendoderm may possess the signaling
properties of both amniote tissues. Like them, the ADE is the only frog tissue
that expresses cerberus and Hex. Moreover, it displays cell
movements reminescent of the mouse AVE
(Jones et al., 1999
;
Foley and Stern, 2001
).
Finally, the ADE will contribute to the foregut, and, similarly to the foregut
endoderm of chick and mouse, it may be important to confer anterior character
to the overlaying ectoderm, as judged by the ability to trigger cement gland
markers in gastrula ectodermal explants
(Bradley et al., 1996
;
Jones et al., 1999
).
Our data suggest a new potential role for the Xenopus ADE in the dorsoventral patterning of the forebrain, possibly in synergism with the adjacent prechordal mesendoderm. In fact, the ADE was able to activate the dorsal telencephalic marker Xemx1 in midgastrula DE explants that, although already specified to forebrain fates, would not express Xemx1 at the early tailbud stages. Moreover, expression of the ventral forebrain marker Xnkx2.1 was suppressed in stage 10.5 DE explants conjugated to the ADE. These data suggest that the ADE may be involved in inducing dorsal telencephalic fates and repressing ventral fates within the prospective forebrain region. This patterning role was further supported by the striking observation that a fragment of ADME, including the ADE together with the anteriormost prechordal mesendoderm, was able to elicit Xemx1 and eomes expression in chd-injected caps, where expression of these dorsal telencephalic markers was otherwise never detected. Notably, removal of the anterior definitive endoderm in chick embryos seems to impair proper regionalization of dorsal, but not ventral, forebrain territories, although a more specific molecular marker analysis was not performed (Whitington et al., 2001).
Previous work in Xenopus has shown that planar signals spreading
from the dorsal mesendoderm are sufficient to induce, in the adjacent
ectoderm, neural tissue with a remarkable degree of anteroposterior
patterning, including forebrain characters
(Doniach at al., 1992
;
Papalopulu and Kintner, 1993
).
However, additional vertical signaling is required from the involuting
mesendoderm for proper differentiation, morphogenesis and patterning of the
nervous system (Dixon and Kintner,
1989
; Ruiz i Altaba,
1992
). In line with these observations, our results suggest that
vertical signals from the ADE and possibly the adjacent ADME may be
specifically responsible for proper dorsoventral patterning of the
telencephalon during gastrulation.
Molecular signaling specifying dorsal and ventral telencephalic
fates
A crucial question concerns the identity of molecules mediating the
patterning activity of the ADE. The secreted molecule cerberus was a likely
candidate to mediate part of this activity: its expression is restricted to
the ADE throughout gastrulation
(Bouwmeester et al., 1996
), and
besides providing a BMP antagonistic effect, cerberus is also endowed with
anti-Wnt and anti-Nodal activities
(Piccolo et al., 1999
), which
could account for the patterning effects of the ADE. Remarkably, we found that
cerberus was not only able to trigger anterior neural induction and early
forebrain markers (such as Xrx1 and XBF-1) (see Results;
data not shown) in animal caps, as do other BMP inhibitors, but also to induce
the expression of the dorsal telencephalic markers Xemx1 or
eomes. We then attempted to define which of the three inhibitory
activities of cerberus are required for the induction of these genes. When the
anti-Nodal activity of cer-S (Piccolo et
al., 1999
) and the anti-BMP activity of Chd were combined
together, they were not able to induce Xemx1 and eomes.
Instead, their efficient induction was obtained by the combination of
cer-
C1, containing the Wnt-inhibitory activity of cerberus
(Fetka et al., 2000
), and Chd,
while cer-
C1 alone did not show any telencephalic or neural inducing
activity, at least in the conditions we used. Taken together, with respect to
the induction of dorsal telencephalic genes, these results suggest that: (1)
the anti-BMP and the anti-Wnt activities of cerberus are both required; and
(2) neither of them alone is sufficient, but they might be possibly sufficient
in combination. However, in our hands, cer-
C1 seemed to retain a
partial anti-Nodal activity that has not been previously described
(Fetka et al., 2000
); thus, at
present, a requirement for the anti-Nodal activity of cerberus in the
activation of dorsal telencephalic genes cannot be completely excluded. When a
different Wnt-antagonist, Nxfz8 (Deardoff
et al., 1998
), was tried, it did not trigger Xemx1 or
eomes, either in combination with Chd or with the further addition of
the anti-Nodal activity of cer-S. Because in all the different combinations
that we assayed, dorsal telencephalic genes were only induced when the
Wnt-inhibitory action of cerberus was included, these results would suggest
that dorsal telencephalic induction may require a particular specificity of
Wnt inhibition. Besides cerberus, several other inhibitors of Wnt signaling
are secreted from the ADE and/or the adjacent prechordal mesendoderm, such as
Dkk1 (Glinka et al., 1998
),
Frzb1 (Leyns et al., 1997
;
Wang et al., 1997
), crescent
and Sfrp2 (Pera and De Robertis,
2000
). They have different anti-Wnt specificities and different
biological activities (Kazanskaya et al.,
2000
; Pera and De Robertis,
2000
); some of them may cooperate with cerberus in inducing the
dorsal telencephalon. The requirement of the anti-Wnt activity of cerberus for
the induction of dorsal telencephalic genes in animal caps raises the question
of which Wnts need to be inhibited. In Xenopus, Xwnt7B
(Chang and Hemmati-Brivanlou,
1998
) and Xwnt8b (Cui
et al., 1995
) are widely expressed in the ectodermal region of the
embryo during gastrula and neurula developmental stages; furthermore,
Xwnt7B expression is maintained in animal caps dissected from
blastula stage embryos (Chang and
Hemmati-Brivanlou, 1998
). Therefore, Xwnt7B and
Xwnt8b potentially represent two Wnt activities whose inhibition may
be necessary for patterning of the telencephalon in Xenopus. This
hypothesis is strongly supported by recent work in zebrafish, showing
requirement of local Wnt antagonism for telencephalic gene expression within
the anterior neuroectoderm, and identifying Wnt8b as a likely target for this
antagonism (Houart et al.,
2002
).
Because FGF8, as other FGFs (Shinya et
al., 2001
), is expressed in the anterior neural ridge
(Crossley and Martin, 1995
),
and seems to mediate the ability of the latter to promote expression of the
telencephalic marker XBF1
(Shimamura and Rubenstein,
1997
; Ye et al.,
1998
) and also later aspects of telencephalic patterning
(Fukuchi-Shigomori and Grove,
2001
), we tested whether FGF could have a role in the regulation
of dorsal and ventral telencephalic genes. We here show that FGF8 is able to
potentiate eomes expression in Chd+cer-S or cerberus injected caps.
Moreover, Xemx1 activation in animal caps by the head organizer was
severely compromised by overexpression of the dominant-negative
XFGFR-4a receptor. Together, these results suggest that cerberus and
FGF8 may interact in the specification of the dorsal telencephalon.
We have also found that FGF signals (FGF8 or bFGF) are able to promote
strong Xnkx2.1 expression in animal caps neuralized by cerberus or by
the combination of Chd+cer-S; conversely, the dominant negative
XFGFR-4a receptor almost completely prevents activation of
Xnkx2.1 in animal caps conjugated to early organizer tissue, without
preventing neural induction. These results strongly suggest that FGF signals
may be essential for specification of the ventral forebrain. Similar
conclusions have been recently reached by Shinya et al.
(Shinya et al., 2001
), who
showed that inhibition of FGF signaling, particularly from FGF3 and FGF8,
suppressed development of the ventral telencephalon in zebrafish embryos.
In conclusion, our work provides evidence that inductive signals leading to
specification of early dorsal and ventral telencephalic territories can be
reconstructed, at least in part, on naive animal caps, by specific
combinations of signaling molecules. BMP inhibition, though able to possibly
provide a general telencephalic fate, is not sufficient for dorsal and ventral
telencephalic specification, as it does not activate the dorsal telencephalic
markers Xemx1 and eomes or the ventral forebrain marker
Xnkx2.1. Strong Xnkx2.1 activation instead occurred when
either FGF8 or bFGF were administered to neuralized caps. By contrast,
activation of both Xemx1 and eomes expression was detected
in animal caps injected with cerberus or the combination of Chd and N-terminal
fragment of cerberus, cer-
C1, and eomes induction was
reinforced by the further addition of FGF8 to the explants. A model that
summarizes a possible interaction between the molecules and tissues we have
studied for dorsoventral patterning of the telencephalon is shown in
Fig. 13. According to this,
the anterior neural plate is induced in dorsal ectoderm by the action of BMP
inhibitors, such as Chd; this initial forebrain-presumptive region may already
express region-specific genes such as Xotx2, Xrx1 and XBF-1.
Upon this ground, ventral forebrain fates would be induced by FGF signals,
possibly secreted from the anterior neural ridge, and inhibited by the ADE. On
the same ground, cerberus, possibly through its Wnt-inhibitory activity, and
FGF signaling may cooperate in the activation of Xemx1 and
eomes and the specification of dorsal telencephalon.
|
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Andreazzoli, M., Gestri, G., Angeloni, D., Menna, E. and Barsacchi, G. (1999). Role of Xrx1 in Xenopus eye and anterior brain development. Development 126,2451 -2460.[Abstract]
Bachiller, D., Klingensmith, J., Kemp, C., Belo, J. A., Anderson, R. M., May, S. R., McMahon, J. A., McMahon, A. P., Harland, R. M., Rossant, J. and de Robertis, E. M. (2000). The organizer factors Chordin and Noggin are required for mouse forebrain development. Nature 403,658 -661.[CrossRef][Medline]
Barth, K. A., Kishimoto, Y., Rohr, K., Seydler, C., Schulte-Merker, S. and Wilson, S. W (1999). Bmp activity establishes a gradient of positional information throughout the entire neural plate. Development 126,4977 -4987.[Abstract]
Beddington, R. S. and Robertson, E. J. (1998). Anterior patterning in mouse. Trends Genet. 14,277 -284.[CrossRef][Medline]
Bouwmeester, T., Kim, S., Sasai, Y., Lu, B. and de Robertis, E. M. (1996). Cerberus is a head-inducing secreted factor expressed in the anterior endoderm of Spemann's organizer. Nature 382,595 -601.[CrossRef][Medline]
Boyl, P. P., Signore, M., Annino, A., Barbera, J. P., Acampora, D. and Simeone, A. (2001). Otx genes in the development and evolution of the vertebrate brain. Int. J. Dev. Neurosci. 19,353 -363.[Medline]
Bradley, L. C., Snape, A., Bhatt, S. and Wilkinson, D. G. (1993). The structure and expression of the Xenopus Krox-20 gene: conserved and divergent patterns of expression in rhombomeres and neural crest. Mech. Dev. 40, 73-84.[CrossRef][Medline]
Bradley, L., Wainstock, D. and Sive. H. (1996). Positive and negative signals modulate formation of the Xenopus cement gland. Development 122,2739 -2750.[Abstract]
Bulfone, A., Puelles, L., Porteus, M. H., Frohman, M. A., Martin, G. R. and Rubenstein, J. L. R. (1993). Spatially restricted expression of Dlx-1, Dlx-2 (Tes-1), Gbx-2, and Wnt-3 in the embryonic day 12.5 mouse forebrain defines potential transveres and longitudinal segmental boundaries. J. Neurosci. 13,3155 -3172.[Abstract]
Casarosa, S., Andreazzoli, M., Simeone, A. and Barsacchi, G. (1997). Xrx1, a novel Xenopus homeobox gene expressed during eye and pineal gland development. Mech. Dev. 61,187 -198.[CrossRef][Medline]
Chang, C. and Hemmati-Brivanlou, A. (1998). Neural crest induction by Xwnt7B in Xenopus. Dev. Biol. 194,129 -134.[CrossRef][Medline]
Cho, K. W. Y., Blumberg, B., Steinbeisser, H. and de Robertis, E. M. (1991). Molecular nature of Spemann's organizer: the role of the Xenopus homeobox gene goosecoid.Cell 67,1111 -1120.[CrossRef][Medline]
Crossley, P. H. and Martin, G. R. (1995). The mouse Fgf8 gene encodes a family of polypeptides and is expressed in regions that direct outgrowth and patterning in the developing embryo. Development 121,439 -451.[Abstract]
Cui, Y., Brown, J. D., Moon, R. T. and Christian, J. L. (1995). Xwnt-8b: a maternally expressed Xenopus Wnt gene with a potential role in establishing the dorsoventral axis. Development 121,2177 -2196.[Abstract]
Deardoff, M., Tan, C., Conrad, L. J. and Klein, P. S. (1998). Frizzled-8 is expressed in the Spemann organizer and plays a role in early morphogenesis. Development 125,2687 -2700.[Abstract]
Dixon, J. E. and Kintner, C. R. (1989).
Cellular contacts required for neural induction in Xenopus embryos:
evidence for two signals. Development
106,749
-757.
Doniach, T., Phillips, C. R. and Gerhart, J. C.
(1992). Planar induction of anteroposterior patterning in the
developing central nervous system of Xenopus laevis.Science 257,542
-545.
Fetka, I., Doederlein, G. and Bouwmeester, T. (2000). Neuroectodermal specification and regionalization of the Spemann organizer in Xenopus. Mech. Dev. 93, 49-58.