|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724, USA
*Author for correspondence (e-mail: martiens{at}cshl.org)
Accepted 28 January 2002
| SUMMARY |
|---|
|
|
|---|
Key words: TALE class homeobox, shoot apical meristem, boundary, leaf shape, KNAT1, KNAT2
| INTRODUCTION |
|---|
|
|
|---|
One pathway involved in meristem initiation and maintenance involves a highly conserved class of homeodomain transcription factors encoded by knox genes. knox genes are defined by homology to the maize knotted1 (kn1) gene and are separated into two classes based on sequence identity and conserved intron location (Bharathan et al., 1999
; Kerstetter et al., 1994
; Reiser et al., 2000
). The Arabidopsis genome sequence has revealed 8 knox genes (The Arabidopsis Genome Initiative, 2000
). Class I genes comprise STM, KNAT1, KNAT2 and KNAT6 (Lincoln et al., 1994
; Long et al., 1996
; Semiarti et al., 2001
). Loss-of-function mutations in STM result in embryos that lack a SAM and so fail to develop any postembryonic vegetative tissue (Barton and Poethig, 1993
; Clark et al., 1996
; Long et al., 1996
). STM is thus required to maintain proliferation of cells in the SAM and/or prevent their differentiation. Recessive mutations in the kn1 gene of maize also condition defects in meristem maintenance (Kerstetter et al., 1997
; Vollbrecht et al., 2000
). Both STM and kn1 are expressed throughout the SAM but are down-regulated in founder cells that are recruited to form lateral organs (Jackson et al., 1994
; Long et al., 1996
; Smith et al., 1992
). Down regulation of knox genes in lateral organ primordia is a critical event in organ patterning as ectopic expression of knox genes disrupts normal leaf development (Byrne et al., 2001
; Chuck et al., 1996
; Reiser et al., 2000
). In Arabidopsis, KNAT1 and KNAT2 are also expressed within the SAM and are down-regulated in lateral organ primordia, but so far there is no genetically defined role for these class I knox genes.
Mutations in AS1 result in plants that have abnormal leaves, with marginal outgrowths or lobes (Byrne et al., 2000
; Ori et al., 2000
; Semiarti et al., 2001
; Tsukaya and Uchimiya, 1997
). AS1 is a myb domain transcription factor related to ROUGH SHEATH2 (RS2) in maize and PHANTASTICA (PHAN) in Antirrhinum (Byrne et al., 2000
). All three genes are expressed in lateral organ primordia and act as negative regulators of knox genes (Byrne et al., 2000
; Ori et al., 2000
; Semiarti et al., 2001
; Timmermans et al., 1999
; Tsiantis et al., 1999
; Waites et al., 1998
). Unexpectedly, as1 suppresses the stm mutant phenotype, so that double mutants have an as1 vegetative shoot. Further, in stm mutant embryos, AS1 expression spreads throughout the apical region. This genetic interaction indicates that STM prevents AS1 expression in stem cells of the SAM and so maintains their undifferentiated state (Byrne et al., 2000
). STM has additional roles in the inflorescence, since as1 stm mutants lack normal flowers. We previously proposed that other knox genes might replace STM in vegetative but not in floral meristems, accounting for the phenotype of as1 stm-1 plants (Byrne et al., 2000
).
The mutant asymmetric leaves2 (as2) has a leaf phenotype comparable to as1, and knox genes are also mis-expressed (Ori et al., 2000
; Semiarti et al., 2001
). We show that AS2 is also negatively regulated by STM and likely interacts with AS1. We used second-site suppressor mutagenesis to identify meristem factors that replace STM in as1 stm double mutants. In this screen we isolated mutations in the KNAT1 gene, which corresponds to the classical locus BREVIPEDICELLUS (BP) (Douglas et al., 2002
; Venglat et al., 2002
). Thus KNAT1 and STM are redundant in embryo and vegetative development in the absence of AS1. Gene trap and enhancer trap lines were used to show that KNAT2 and the novel gene LATERAL ORGAN BOUNDARIES (LOB) are also regulated by AS1 but do not contribute significantly to the as1 phenotype. Interactions between leaves and meristems were first proposed to have a role in leaf patterning on the basis of surgical experiments (Sussex, 1954
; Sussex, 1955
). Our studies provide a molecular framework for some of these interactions.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plant genetics
To generate as2 stm double mutants homozygous as2 plants were crossed to plants heterozygous for stm. AS2 and STM are linked on chromosome 1 and in F2 populations a novel phenotype segregated at a low frequency. F3 plants from individuals of the genotype as2 stm-1/as2 + segregated 1:3 for the double mutant phenotype [as2 159 (72.3%), as2 stm-1 61 (27.7%)]. To construct as1 bp and as2 bp double mutants, plants homozygous for as1 or as2 were crossed to plants homozygous for bp. Double as1 bp and as2 bp mutants segregated in the F2 progeny in the expected 1:15 ratio. The number of plants in each phenotypic class segregating as1 and bp were; wild type 182 (60.3%), as1 44 (14.5%), bp 58 (19.2%), as1 bp 18 (6.0%). The number of plants in each phenotypic class segregating as2 and bp were; wild type 123 (57.2%), as2 40 (18.6%), bp 40 (18.6%), as2 bp 12 (5.6%). Double stm-11 bp and stm-2 bp mutants were generated by crossing plants homozygous for bp to plants heterozygous for stm-11 or stm-2. Only stm and bp phenotypes segregated in the F2 generation. F3 seed from homozygous bp plants segregated 1:3 stm mutants. Segregation values for lines homozygous for bp and segregating stm-11 were; bp 215 (72.6%), double bp stm-11 59 (27.4%). Segregation values for bp mutant lines segregating stm-2 were; bp 229 (67.3%), double bp stm-2 75 (32.7%).
Triple as1 stm-1 bp mutants were generated by crossing plants homozygous for as1 and heterozygous for stm-1 to plants homozygous for bp. The F3 generation from selfed as1/as1 bp/bp stm-1/+ individuals segregated 1 in 4 shoot meristemless individuals [as1 bp 113 (75.3%) and as1 stm-1 bp 37 (24.7%)]. Plants homozygous for the Ds insertion allele of KNAT2 were crossed with homozygous mutants in the case of as1, as2 and bp, and with heterozygous plants in the case of stm-11 to generate double mutants. In F3 lines homozygous for as1, as2 or bp and segregating for knat2 and in lines homozygous for the knat2 allele and segregating for stm, no new phenotypes were observed. Triple as1 stm-1 kt2 mutants were generated by crossing as1/as1 stm-1/+ plants with kt2/kt2 plants. The F3 progeny from selfed as1/as1 stm-1/+ kt2/kt2 individuals segregated plants that were phenotypically as1 and plants with an as1 stm-1 phenotype in the ration 1:3.
Molecular biology
DNA extraction and manipulation were carried out using standard protocols (Sambrook et al., 1989
). To sequence EMS-induced mutations, DNA from mutant plants was amplified with primer pairs encompassing the exon regions of KNAT1. PCR products were sequenced with internal primers, using dye terminator cycle sequencing (Applied Biosystems). For RT-PCR, total RNA was purified using Trizol reagent (GibcoBRL). Following treatment with DNase (Boehringer Mannheim) complementary DNA was synthesized using 100 Units of M-MuLV reverse transcriptase (New England Biolab) in 50 mM Tris-HCl (pH 8.3), 30 mM KCl, 8 mM MgCl2, 10 mM DTT, 1 mM each of dATP, dCTP, dGTP, dTTP, 1 µM oligo(dT), 50 Units RNasin and 0.1 µg BSA. RT-PCR reactions were performed with gene-specific primers. KNAT2 primers (ACCACCGGAGACAATCAAAG and TCCGCTGCTATGTCATCATC) span the exon 3/exon 4 junction. PCR products were subject to Southern hybridization using gene-specific probes. ClustalW analysis of class I knox genes was performed using MacVector6.5.1 (Oxford Molecular Group).
Histology and microscopy
GUS staining was carried out as previously described (Gu et al., 1998
) using a substrate solution containing 100 mM sodium phosphate pH 7, 10 mM EDTA, 0.1% Triton X-100, 0.5 mg/ml 5-bromo-4-chloro-3-indolyl ß-D glucuronic acid (X-Gluc), 100 µg/ml chloramphenicol, 2 mM each of potassium ferricyanide and potassium ferrocyanide. Seedlings were mounted in 50% glycerol before viewing. Inflorescences from plants carrying a DsG element in KNAT2 were first stained for GUS expression before fixing in FAA (50% ethanol, 5% glacial acetic acid, 3.7% formaldehyde), dehydrating through an ethanol series, embedding in paraffin and sectioning. Eight-day old seedlings were fixed in glutaraldehyde and dehydrated through an ethanol series prior to embedding in paraffin. 10 mm sections were cut and stained with Toluidine Blue. For scanning electron microscopy fresh material was mounted on silver tape (Electron Microscope Sciences) and viewed with an Hitachi S-3500N SEM using a beam voltage of 5 kV.
| RESULTS |
|---|
|
|
|---|
|
Given that as1 and as2 have similar phenotypes and are both required for normal expression of knox genes and LOB, we carried out double mutant analysis to determine if as2 also interacts with stm. Embryos homozygous for strong stm alleles, including stm-1 and stm-11, completely lack a SAM and develop cotyledons that are fused at their base (Barton and Poethig, 1993
; Clark et al., 1996
; Long and Barton, 1998
). Weak stm mutants, such as stm-2, also germinate with fused cotyledons, but subsequently form a SAM and initiate leaves (Clark et al., 1996
; Endrizzi et al., 1996
). In as1 stm-1 double mutants vegetative shoots and leaves are indistinguishable from those of as1 single mutants. In reproductive development as1 stm-1 double mutants generate additional lateral shoots in the place of flowers. The phyllotaxy of lateral shoots in the inflorescence is also somewhat irregular compared with as1 single mutants (Fig. 2A) (Byrne et al., 2000
). Mutants homozygous for as1 and the weaker stm-2 allele are similar to as1 stm-1 double mutants except that they form fewer lateral shoots and more flowers, most of which remain incomplete (Fig. 2C). Typically flowers have a normal number of sepals, a reduced number of petals and stamens and only occasionally form a central abnormal unfused carpel. Terminal flowers are often fusions of more than one flower (Fig. 2E).
|
Screening for suppressors of as1 stm-1
One function of STM is to prevent AS1 expression in stem cells of the SAM (Byrne et al., 2000
). However, STM may have additional roles in meristem maintenance that are assumed by other factors redundant with STM that are only revealed in as1 stm-1 double mutants. Likely candidates are the other class I knox genes expressed in the SAM, namely KNAT1, KNAT2 and KNAT6 (Lincoln et al., 1994
; Long et al., 1996
; Semiarti et al., 2001
). In pairwise comparisons (Fig. 3) STM is most closely related to KNAT1, sharing 44% identity over all and 70% identity within the homeodomain. However, KNAT2 is most closely related to KNAT6 sharing overall 70% amino acid identity and 89% identity in the homeodomain.
|
To confirm that the shoot meristemless seedlings were derived from triple as1 stm-1 bp homozygotes, we constructed triple mutants between as1 stm-1 and an independently derived deletion allele of KNAT1 (Douglas et al., 2002
). Progeny from as1/as1 bp/bp stm-1/+ mutants segregated 1 in 4 shoot meristemless plants, as expected. Like stm-1, these as1 stm-1 bp mutants have cotyledons fused at the base and no vegetative shoot (Fig. 4B,C), although rarely some leaves are formed. At 8 days after germination, the wild-type SAM is visible in sections as a dome of densely staining cells at the base of the cotyledons (Fig. 4D). In contrast, sections through the apex of as1 stm-1 bp mutant seedlings have no SAM (Fig. 4F), and are comparable to stm-1 single mutants (Fig. 4E). Thus KNAT1 is required for SAM maintenance in the absence of AS1 and STM.
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
|
Previously we have shown that the leaf phenotype in as1 stm double mutants is unaltered compared with as1, indicating that STM is not required for the as1 phenotype (Byrne et al., 2000
). Likewise, the as2 leaf phenotype is unaltered in double mutants with stm. Surprisingly, mutations in KNAT1 and KNAT2 also have no effect on as1 and as2 phenotypes. One explanation is that misexpression of any one knox gene is sufficient for the phenotype, requiring a triple knox mutant to suppress as1. Alternatively, misexpression of other factors may contribute to as1 and as2.
Redundancy of knox genes
The Arabidopsis genome sequence has revealed large-scale gene duplications that may reflect significant redundancy (The Arabidopsis Genome Initiative, 2000
; Martienssen and Irish, 1999
). For example, several closely related members of a large family of novel transcription factors, the KANADI genes, as well as members of the YABBY gene family play redundant roles in specification of organ polarity (Eshed et al., 2001
; Siegfried et al., 1999
). In flower development several groups of closely related MADS box transcription factor genes appear to be fully or partially redundant. Mutations in SHATTERPROOF1 and SHATTERPROOF2 have little phenotypic effect, but in combination they disrupt normal fruit development (Liljegren et al., 2000
). Similarly, the three SEPALLATA genes have redundant roles, in that floral organs are replaced by sepals in the triple mutant but not in any other combination (Pelaz et al., 2000
). A third group of closely related MADS box genes, APETALA1 (AP1), CAULIFLOWER (CAL) and FRUITFULL (FUL), have partially redundant functions in floral meristem identity (Ferrandiz et al., 2000
; Gu et al., 1998
; Mandel and Yanofsky, 1995
).
In contrast to MADS box genes, Class I knox genes constitute a small family of only four genes in Arabidopsis. KNAT2 and KNAT6 share a high degree of amino acid sequence identity and, like SHATTERPROOF and SEPALLATA, they are located within segmental chromosomal duplications (The Arabidopsis Genome Initiative, 2000
). Thus, redundancy probably accounts for the lack of phenotype we observed when a Ds transposon was inserted into KNAT2. KNAT1 and STM are also closely related, but these genes are not part of a segmental duplication and were probably duplicated earlier than KNAT2 and KNAT6. In the inflorescence, STM expression is found in all SAMs while KNAT1 expression is restricted to subepidermal cells of the stem and pedicel (Lincoln et al., 1994
; Long et al., 1996
). The stem and pedicel are affected in bp mutants, consistent with this expression pattern (Douglas et al., 2002
; Venglat et al., 2002
). In the vegetative apex, both genes are down-regulated in leaf founder cells, but KNAT1 expression is mainly in the peripheral zone while STM is expressed throughout the SAM (Lincoln et al., 1994
; Long et al., 1996
). Nonetheless, we have shown that KNAT1 assumes a redundant role with STM in the vegetative SAM in the absence of AS1. The lack of flowers in as1 stm double mutants shows that KNAT1 cannot substitute for STM in floral meristems, consistent with the lack of KNAT1 expression in these cells. This situation resembles the partial redundancy and overlapping expression patterns exhibited by the MADS box genes AP1, CAL and FUL.
Evolutionary implications of knox gene duplications
Phylogenetic analysis of knox genes in plants suggests a monophyletic origin, but the ancestral gene expression pattern remains unresolved (Bharathan et al., 1999
; Reiser et al., 2000
). One possibility is that STM and KNAT1 represent the ancient duplication of a gene involved in meristem maintenance that repressed AS1, a function that KNAT1 has subsequently lost. Alternatively, STM has acquired a new function to negatively regulate AS1. We favor the former possibility since repression of AS1 is critical to meristem maintenance. Following duplication, the differences between STM and KNAT1 will have favored evolutionary stabilization of both genes (Cooke et al., 1997
).
In general, screens for patterning mutants in the vegetative phase have typically recovered negative regulatory genes such as AS1, CURLY LEAF, SERRATE and PICKLE (Byrne et al., 2000
; Goodrich et al., 1997
; Ogas et al., 1999
; Prigge and Wagner, 2001
) rather than loss-of-function mutations in individual homeotic genes. One explanation is that genes controlling organogenesis in the vegetative apex have been duplicated over evolutionary time. If one copy of each of these duplicate pairs acquired additional functions in the flower, but still retained its vegetative role, then mutants in floral development would be readily obtained, but leaf mutants would be masked by redundancy (Martienssen and Dolan, 1998
). Only genes that regulate this redundancy, such as AS1, could lose function with phenotypic effect. Of course, dominant and haplo-insufficient alleles of homeotic genes could still be recovered (McConnell et al., 2001
).
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Barton, M. K. and Poethig, R. S. (1993). Formation of the shoot apical meristem in Arabidopsis thaliana an analysis of development in the wild type and in the shoot meristemless mutant. Development 119, 823-831.[Abstract]
Bharathan, G., Janssen, B. J., Kellogg, E. A. and Sinha, N. (1999). Phylogenetic relationships and evolution of the KNOTTED class of plant homeodomain proteins. Mol. Biol. Evol. 16, 553-563.[Abstract]
Bowman, J. L. and Eshed, Y. (2000). Formation and maintenance of the shoot apical meristem. Trends Plant Sci. 5, 110-115.[Medline]
Byrne, M., Timmermans, M., Kidner, C. and Martienssen, R. (2001). Development of leaf shape. Curr. Opin. Plant Biol. 4, 38-43.[Medline]
Byrne, M. E., Barley, R., Curtis, M., Arroyo, J. M., Dunham, M., Hudson, A. and Martienssen, R. A. (2000). Asymmetric leaves1 mediates leaf patterning and stem cell function in Arabidopsis. Nature 408, 967-971.[Medline]
Chuck, G., Lincoln, C. and Hake, S. (1996). KNAT1 induces lobed leaves with ectopic meristems when overexpressed in Arabidopsis. Plant Cell 8, 1277-1289.[Abstract]
Clark, S. E. (2001). Meristems: start your signaling. Curr. Opin. Plant Biol. 4, 28-32.[Medline]
Clark, S. E., Jacobsen, S. E., Levin, J. Z. and Meyerowitz, E. M. (1996). The CLAVATA and SHOOT MERISTEMLESS loci competitively regulate meristem activity in Arabidopsis. Development 122, 1567-1575.[Abstract]
Cooke, J., Nowak, M. A., Boerlijst, M. and Maynard-Smith, J. (1997). Evolutionary origins and maintenance of redundant gene expression during metazoan development. Trends Genet. 13, 360-364.[Medline]
Dockx, J., Quaedvlieg, N., Keultjes, G., Kock, P., Weisbeek, P. and Smeekens, S. (1995). The homeobox gene ATK1 of Arabidopsis thaliana is expressed in the shoot apex of the seedling and in flowers and inflorescence stems of mature plants. Plant Mol. Biol. 28, 723-737.[Medline]
Douglas, S. J., Chuck, G., Denger, R. E., Pelecanda, L. and Riggs, C. D. (2002). KNAT1 and ERECTA regulate inflorescence architecture in Arabidopsis. Plant Cell 14, 1-13.
Endrizzi, K., Moussian, B., Haecker, A., Levin, J. Z. and Laux, T. (1996). The SHOOT MERISTEMLESS gene is required for maintenance of undifferentiated cells in Arabidopsis shoot and floral meristems and acts at a different regulatory level than the meristem genes WUSCHEL and ZWILLE. Plant J. 10, 101-113.
Eshed, Y., Baum, S. F., Perea, J. V. and Bowman, J. L. (2001). Establishment of polarity in lateral organs of plants. Curr. Biol. 11, 1251-1260.[Medline]
Ferrándiz, C., Gu, Q., Martienssen, R. and Yanofsky, M. F. (2000). Redundant regulation of meristem identity and plant architecture by FRUITFULL, APETALA1 and CAULIFLOWER. Development 127, 725-734.[Abstract]
Goodrich, J., Puangsomlee, P., Martin, M., Long, D., Meyerowitz, E. M. and Coupland, G. (1997). A Polycomb-group gene regulates homeotic gene expression in Arabidopsis. Nature 386, 44-51.[Medline]
Gu, Q., Ferrándiz, C., Yanofsky, M. F. and Martienssen, R. (1998). The FRUITFULL MADS-box gene mediates cell differentiation during Arabidopsis fruit development. Development 125, 1509-1517.[Abstract]
Jackson, D., Veit, B. and Hake, S. (1994). Expression of maize KNOTTED1 related homeobox genes in the shoot apical meristem predicts patterns of morphogenesis in the vegetative shoot. Development 120, 405-413.[Abstract]
Kerstetter, R., Vollbrecht, E., Lowe, B., Veit, B., Yamaguchi, J. and Hake, S. (1994). Sequence analysis and expression patterns divide the maize knotted1-like homeobox genes into two classes. Plant Cell 6, 1877-1887.
Kerstetter, R. A., Laudencia-Chingcuanco, D., Smith, L. G. and Hake, S. (1997). Loss-of-function mutations in the maize homeobox gene, knotted1, are defective in shoot meristem maintenance. Development 124, 3045-3054.[Abstract]
Koornneef, M., van Eden, J., Hanhart, C. J., Stam, P., Braaksma, F. J. and Feenstra, W. J. (1983). Linkage map of Arabidopsis thaliana. J. Hered. 74, 265-272.
Liljegren, S. J., Ditta, G. S., Eshed, Y., Savidge, B., Bowman, J. L. and Yanofsky, M. F. (2000). SHATTERPROOF MADS-box genes control seed dispersal in Arabidopsis. Nature 404, 766-770.[Medline]
Lincoln, C., Long, J., Yamaguchi, J., Serikawa, K. and Hake, S. (1994). A knotted1-like homeobox gene in Arabidopsis is expressed in the vegetative meristem and dramatically alters leaf morphology when overexpressed in transgenic plants. Plant Cell 6, 1859-1876.
Long, J. A. and Barton, M. K. (1998). The development of apical embryonic pattern in Arabidopsis. Development 125, 3027-3035.[Abstract]
Long, J. A., Moan, E. I., Medford, J. I. and Barton, M. K. (1996). A member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis. Nature 379, 66-69.[Medline]
Mandel, M. A. and Yanofsky, M. F. (1995). The Arabidopsis AGL8 MADS box gene is expressed in inflorescence meristems and is negatively regulated by APETALA1. Plant Cell 7, 1763-1771.[Abstract]
Martienssen, R. and Dolan, L. (1998). Patterns in vegetative development. In Arabidopsis. Annual Plant Reviews, vol. 1 (ed. M. Anderson and J. Roberts), pp. 262-297. Sheffield: Sheffield Academic Press.
Martienssen, R. and Irish, V. (1999). Copying out our ABCs: the role of gene redundancy in interpreting genetic hierarchies. Trends Genet. 15, 435-437.[Medline]
Martienssen, R. A. (1998). Functional genomics: probing plant gene function and expression with transposons. Proc. Natl. Acad. Sci. USA 95, 2021-2026.
McConnell, J. R., Emery, J., Eshed, Y., Bao, N., Bowman, J. and Barton, M. K. (2001). Role of PHABULOSA and PHAVOLUTA in determining radial patterning in shoots. Nature 411, 709-713.[Medline]
Ogas, J., Kaufmann, S., Henderson, J. and Somerville, C. (1999). PICKLE is a CHD3 chromatin-remodeling factor that regulates the transition from embryonic to vegetative development in Arabidopsis. Proc. Natl. Acad. Sci. USA 96, 13839-13844.
Ori, N., Eshed, Y., Chuck, G., Bowman, J. L. and Hake, S. (2000). Mechanisms that control knox gene expression in the Arabidopsis shoot. Development 127, 5523-5532.[Abstract]
Pautot, V., Dockx, J., Hamant, O., Kronenberger, J., Grandjean, O., Jublot, D. and Traas, J. (2001). KNAT2: Evidence for a link between Knotted-like genes and carpel development. Plant Cell 13, 1719-1734.
Pelaz, S., Ditta, G. S., Baumann, E., Wisman, E. and Yanofsky, M. F. (2000). B and C floral organ identity functions require SEPALLATA MADS-box genes. Nature 405, 200-203.[Medline]
Prigge, M. J. and Wagner, D. R. (2001). The Arabidopsis SERRATE gene encodes a zinc-finger protein required for normal shoot development. Plant Cell 13, 1263-1279.
Reiser, L., Sánchez-Baracaldo, P. and Hake, S. (2000). Knots in the family tree: evolutionary relationships and functions of knox homeobox genes. Plant Mol. Biol. 42, 151-166.[Medline]
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, New York: Cold Spring Harbor Press.
Semiarti, E., Ueno, Y., Tsukaya, H., Iwakawa, H., Machida, C. and Machida, Y. (2001). The ASYMMETRIC LEAVES2 gene of Arabidopsis thaliana regulates formation of a symmetric lamina, establishment of venation and repression of meristem-related homeobox genes in leaves. Development 128, 1771-1783.[Abstract]
Serrano-Cartagena, J., Robles, P., Ponce, M. R. and Micol, J. L. (1999). Genetic analysis of leaf form mutants from the Arabidopsis Information Service collection. Mol. Gen. Genet. 261, 725-739.[Medline]
Shuai, B., Reynaga-Peña, C. and Springer, P. S. (2002). The LATERAL ORGAN BOUNDARIES gene defines a novel, plant specific gene family. Plant Physiol. (in press).
Siegfried, K. R., Eshed, Y., Baum, S. F., Otsuga, D., Drews, G. N. and Bowman, J. L. (1999). Members of the YABBY gene family specify abaxial cell fate in Arabidopsis. Development 126, 4117-4128.[Abstract]
Smith, L. G., Greene, B., Veit, B. and Hake, S. (1992). A dominant mutation in the maize homeobox gene, Knotted-1, causes its ectopic expression in leaf cells with altered fates. Development 116, 21-30.[Abstract]
Springer, P. S., McCombie, W. R., Sundaresan, V. and Martienssen, R. A. (1995). Gene trap tagging of PROLIFERA, an essential MCM2-3-5-like gene in Arabidopsis. Science 268, 877-880.
Sundaresan, V., Springer, P., Volpe, T., Haward, S., Jones, J. D. G., Dean, C., Ma, H. and Martienssen, R. (1995). Patterns of gene action in plant development revealed by enhancer trap and gene trap transposable elements. Genes Dev. 9, 1797-1810.
Sussex, I. M. (1954). Experiments in the cause of dorsiventrality in leaves. Nature 174, 351-352.
Sussex, I. M. (1955). Morphogenesis in Solanum tuberosum L.: Experimental investigation of leaf dorsiventrality and orientation in the juvenile shoot. Phytomorphology 5, 286-300.
The Arabidopsis Genome Initiative (2000). Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408, 796-815.[Medline]
Timmermans, M. C., Hudson, A., Becraft, P. W. and Nelson, T. (1999). ROUGH SHEATH2: a Myb protein that represses knox homeobox genes in maize lateral organ primordia. Science 284, 151-153.
Tsiantis, M., Schneeberger, R., Golz, J. F., Freeling, M. and Langdale, J. A. (1999). The maize rough sheath2 gene and leaf development programs in monocot and dicot plants. Science 284, 154-156.
Tsukaya, H. and Uchimiya, H. (1997). Genetic analyses of the formation of the serrated margin of leaf blades in Arabidopsis: combination of a mutational analysis of leaf morphogenesis with the characterization of a specific marker gene expressed in hydathodes and stipules. Mol. Gen. Genet. 256, 231-238.[Medline]
Venglat, S. P., Dumonceaux, T., Rozwadowski, K., Parnell, L., Babic, V., Keller, W., Martienssen, R., Selvaraj, G. and Datla, R. (2002). The homeobox gene BREVIPEDICELLUS is a key regulator of inforescence architecture in Arabidopsis. Proc. Natl. Acad. Sci. USA (in press).
Vollbrecht, E., Reiser, L. and Hake, S. (2000). Shoot meristem size is dependent on inbred background and presence of the maize homeobox gene, knotted1. Development 127, 3161-3172.[Abstract]
Waites, R., Selvadurai, H. R., Oliver, I. R. and Hudson, A. (1998). The PHANTASTICA gene encodes a MYB transcription factor involved in growth and dorsoventrality of lateral organs in Antirrhinum. Cell 93, 779-789.[Medline]
This article has been cited by other articles:
![]() |
J. L. Micol and S. Hake The Development of Plant Leaves Plant Physiology, February 1, 2003; 131(2): 389 - 394. [Full Text] [PDF] |
||||
![]() |
C. M. Ha, G.-T. Kim, B. C. Kim, J. H. Jun, M. S. Soh, Y. Ueno, Y. Machida, H. Tsukaya, and H. G. Nam The BLADE-ON-PETIOLE 1 gene controls leaf pattern formation through the modulation of meristematic activity in Arabidopsis Development, January 1, 2003; 130(1): 161 - 172. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. Kumaran, J. L. Bowman, and V. Sundaresan YABBY Polarity Genes Mediate the Repression of KNOX Homeobox Genes in Arabidopsis PLANT CELL, November 1, 2002; 14(11): 2761 - 2770. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Hamant, F. Nogue, E. Belles-Boix, D. Jublot, O. Grandjean, J. Traas, and V. Pautot The KNAT2 Homeodomain Protein Interacts with Ethylene and Cytokinin Signaling Plant Physiology, October 1, 2002; 130(2): 657 - 665. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||