|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00457

1 Labortory of Genetics, University of Wisconsin, Madison, WI 53706, USA
2 Syngenta Biotechnology Inc., 3054 Cornwallis Road, Durham, NC 27709, USA
3 Department of Biology and Center for Molecular Genetics, University of
California, San Diego, La Jolla, CA 92093, USA
4 Crop Genetics Research, Pioneer-A DuPont Company, 7300 NW 62nd Avenue,
Johnston, IA 50131, USA
* Present address: Instituto de Ecologia, Universidad Nacional Autónoma
de México (UNAM), AP-Postal 70-275, Coyoacán 04510,
México DF, Mexico
Author for correspondence (e-mail:
jdoebley{at}facstaff.wisc.edu)
Accepted 18 February 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Maize, Inflorescence architecture, FLORICAULA, LEAFY
| INTRODUCTION |
|---|
|
|
|---|
Within the angiosperms, the divergence of monocots and dicots is estimated
to have occurred over 150 million years ago
(Wikstrom et al., 2001
). While
the basic organization of flowers is conserved between these groups, both
monocots and dicots include some species with distinctive types of flowers.
Among monocots, the grasses in particular have highly divergent floral
morphology when compared with typical dicots. For example, the grasses do not
have clear homologs to the sepals and petals. Nevertheless, despite
differences in floral morphology, at least some aspects of ABC gene function
in flower development are conserved between maize (a grass) and dicots
(Ambrose et al., 2000
;
Mena et al., 1996
).
Currently, little is known about grass genes that act upstream of the
conserved floral organ identity genes to regulate the transition from
vegetative to reproductive growth and to control inflorescence architecture
and floral meristem identity. Work with dicots, especially Arabidopsis
thaliana and Antirrhinum majus, has begun to define a conserved
transcriptional network upstream of the ABC genes
(Araki, 2001
;
Bradley et al., 1997
;
Bradley et al., 1996
;
Carpenter et al., 1995
;
Ferrandiz et al., 2000
).
Central to this network is the meristem identity gene FLORICAULA
(FLO) from Antirrhinum and its Arabidopsis homolog
LEAFY (LFY) (Coen et
al., 1990
; Weigel et al.,
1992
). FLO/LFY plays an important role in the
reproductive transition and controls flower development by establishing the
expression of the ABC floral organ identity genes
(Coen and Meyerowitz, 1991
;
Huala and Sussex, 1992
;
Parcy et al., 1998
;
Weigel and Meyerowitz, 1994
).
Mutant phenotypes of FLO/LFY homologs in several other dicot species
suggest that the function of FLO/LFY during reproductive development
is largely conserved among the dicots, though its function during other stages
of development may vary (Ahearn et al.,
2001
; Hofer et al.,
1997
; Molinero-Rosales et al.,
1999
; Souer et al.,
1998
).
To begin addressing whether the regulatory network involving
FLO/LFY-like genes upstream of the ABC genes is conserved between
maize and dicots, we analyzed loss-of-function mutants for the duplicate maize
FLO/LFY homologs, zfl1 and zfl2. The maize mutant
phenotypes revealed that zfl1 and zfl2 play similar roles in
the reproductive transition and in flower development as their dicot homologs.
The mutant phenotype observed in flowers specifically suggests a conserved
role for the zfl genes as upstream regulators of the maize
counterparts of the dicot ABC floral organ identity genes. The mutant
phenotype also suggests that the zfl genes play a novel quantitative
role in inflorescence phyllotaxy, supporting zfl2 as a candidate gene
for a maize domestication quantitative trait locus (QTL) controlling
differences in inflorescence architecture between maize and its wild ancestor,
teosinte (Doebley, 1992
).
| MATERIALS AND METHODS |
|---|
|
|
|---|
Zap II (Stratagene) using mRNA from ear primordia of the maize inbred
line A632. We recovered and sequenced a 1323 bp zfl1 cDNA clone
(GenBank AY179882) that was then used to screen genomic libraries constructed
in
Dash II (Stratagene) with BamHI digested genomic DNA of
the maize inbred lines W22 and A632. From the W22 library, we isolated a 17 kb
BamHI clone that contained zfl1 (GenBank AY179883) and a 10
kb BamHI clone that contained zfl2. From A632, a 10 kb clone
was isolated for zfl1 and a 17 kb clone was isolated and sequenced
for zfl2 (GenBank AY179881). Because of a conserved BamHI
site just downstream of the ATG start codon in both genes, the genomic clones
are missing the first three base pairs of the coding sequence. Similar and identical amino acids in protein alignment were identified using Boxshade v.3.1.1 (http://workbench.sdsc.edu) with default settings. Percentage identity and similarity were calculated by 2-way BLAST (http://www.ncbi.nlm.nih.gov) using the BLOSUM62 amino acid similarity matrix with default settings except that `filter' was turned off.
Isolation of Mutator insertions in zfl1 and zfl2
Approximately 42,000 F1 plants carrying active Mutator
(Mu) transposable elements were screened at Pioneer Hi-Bred
International by PCR for Mu insertions in zfl1 and
zfl2 using a Mu terminal repeat specific primer
(5'AGAGAAGCCAACGCCAWCGCCTCYATTTCGTC3') in combination with either
a zfl1 (5'TGTGTGTTTTGCCTCTGCGAGCAATGTG3') or
zfl2 (5'GGATCTCGGAGCTCGGGTTCAC3') specific primer
(Meeley and Briggs, 1995
). PCR
products were sequenced to verify insertions. Two zfl1 insertion
events (zfl1-mum1, zfl1-mum2) and six zfl2 insertion events
(of which three were analyzed; zfl2-mum1, zfl2-mum2, zfl2-mum4) were
identified. To generate families segregating for the Mu insertion
alleles at both zfl1 and zfl2, plants carrying the different
insertion alleles were first crossed to the W22 inbred line for one or two
generations to improve the vigor of the stocks. The progeny of these crosses
were then inter-crossed to create a set of plants heterozygous for an
insertion and wild-type allele at both zfl1 and zfl2. Doubly
heterozygous plants were either selfed to create a family segregating for both
zfl1 and zfl2 in W22 background, or crossed to a
`Mu-Killer' stock (les28/+; a1-mum1) that suppresses
Mu activity to further improve plant vigor
(Martienssen and Baron, 1994
).
The progeny of these latter crosses were selfed to obtain plants segregating
for both zfl1 and zfl2 in a background in which the
mutagenic effects of Mu had been quelled.
Throughout this breeding process, we used restriction fragment length
polymorphism (RFLP) analysis to trace the insertion and wild-type alleles.
Specific alleles were identified by RFLP analyses in which genomic DNAs was
digested with HindIII (for zfl1-mum2; zfl2-mum4, and
zfl1-mum1; zfl2-mum2 segregants) or XbaI (for zfl1-mum1;
zfl2-mum1 segregants), Southern blotted, and probed as previously
described (Doebley and Stec,
1991
) with a zfl1 cDNA probe. Novel RFLPs were associated
with zfl Mu insertion alleles by PCR with Mu- and
zfl-specific primers.
Phenotyping
Phenotypic characterization of the double mutants was performed using three
families that segregated for different combinations of the insertion alleles:
(i) MK family zfl1-mum1; zfl2-mum1 in Mu-Killer
background (299 plants), (ii) W1 family zfl1-mum2; zfl2-mum4
in W22 background (87 plants) and (iii) W2 family zfl1-mum2;
zfl2-mum2 in W22 background (55 plants). Association of quantitative
phenotypes with zfl genes was tested in the MK family segregating for
zfl1-mum1; zfl2-mum1 using analysis of variance (ANOVA) in the JMP
software program (SAS Institute). The traits analyzed included days to pollen
shed, total leaf number, number of long tassel branches, and ear and tassel
rank (inflorescence phyllotaxy). Inflorescence phyllotaxy was measured as the
number of ranks of spikelet-pairs around the circumference of the ear or
central tassel spike (Doebley,
1992
).
RNA isolation and analysis
TRI reagent (Molecular Research Center) was used to isolate total cellular
RNA. RNA for RT-PCR was isolated from several developmental stages and tissues
of the W22 inbred line. Vegetative shoot apical meristems (Veg. SAM) were
pooled from seven plants to obtain sufficient tissue for RNA isolation. `Early
ear' RNA was obtained from three ears collected from three plants, and `older
ear' RNA was from two ears. `Young tassel' RNA was isolated from a mixture of
tissue from five plants, and `older male' RNA was obtained from the tassel of
a single plant. Vegetative leaf RNA was also obtained from a single plant. RNA
used for northern analysis was isolated from developing ears of wild-type and
zfl1-mum1; zfl2-mum1 double mutant plants segregating in the
Mu-killer background.
For RT-PCR, 1 µg of total RNA was reverse transcribed with Superscript II (Invitrogen) using a primer designed to anneal to both zfl1 and zfl2 (5'ACATCGACGACGCAGCTAGA3'). PCR reactions were performed across intron 2 with a primer pair designed to amplify both zfl genes (5'GAACGGGCTTGACTACCT3'; 5'GCGTAGCAGTGCACGTAG3'). Since zfl2 possesses a PstI site in this PCR product that is absent in zfl1, RT-PCR products were restricted with PstI to differentiate between the transcripts of the two genes. The fragments were visualized on 3.5% MetaPhor agarose gels (BioWhittaker Molecular Applications). As a cDNA synthesis control, the same RNA samples were reverse transcribed with a mixture of two maize actin primers (5'TCATGGCAGTTCATGTATTG3'; 5'AACTCTGAGGCAACACGTTA). Actin PCR reactions were performed in parallel with zfl reactions, using a primer pair that spans an 883 bp intron (5'CATGAGGCCACGTACAACTC3'; 5'TCATGGCAGTTCATGTATTG3') and gives a 415 bp product. Primers were designed based on GenBank sequences AY104628 and U60508.
For northern blots, 6 µg total RNA was electrophoresed in formaldehyde
gels and transferred as previously described
(Sambrook et al., 1989
) to
Hybond-XL nylon membranes (Amersham). Membranes were hybridized with a
32P-labeled zfl exon 3 probe and washed as previously
described (Doebley and Stec,
1991
). The same blots were stripped and probed with a maize
ubiquitin cDNA probe to verify equivalent loading and RNA quality
(Christiansen and Quail,
1989
).
Histology and in situ hybridization
Samples for histological analysis were fixed in FAA (3.7% formaldehyde, 5%
acetic acid, 50% ethanol), dehydrated in an ethanol series and infiltrated
with Histoclear (National Diagnostics). Samples were then embedded in
Paraplast Plus (Oxford Labware). 8-10 µm sections were mounted on ProbeOn
Plus glass slides (Fisher Scientific), stained in 0.5% aqueous Safranin
overnight, counterstained with 1% Fast Green FCF in 95% ethanol for 30-60
seconds, and cleared in Histoclear. Some sections were stained directly with
aqueous 0.05% Toluidine Blue O for 10-30 minutes. The protocols were adapted
from Berlyn and Miksche (Berlyn and
Miksche, 1976
).
Methods for preparing tissue from immature male inflorescences and in situ
hybridization with digoxigenin-labeled RNA probes were described previously
(Ambrose et al., 2000
). The
antisense RNA probe was generated by first subcloning a 426 bp
SacI-HincII fragment of the zfl1 cDNA into the
SacI HincII restriction sites of pBluescript SK
(Stratagene). This clone was then linearized by cutting at an internal
NotI restriction site and transcribed with T7 RNA polymerase in the
presence of digoxigenin-coupled UTP (DIG RNA labeling mix; Boehringer
Mannheim) to produce an in situ hybridization probe containing 287 bases of
zfl1 sequence. The probe spans parts of exons one and two and is 89%
identical between zfl1 and zfl2.
Scanning electron microscopy (SEM)
Developing ears and tassels from wild-type and zfl double mutant
plants in either the MK or W2 families were fixed in 2% glutaraldehyde in
phosphate buffer (0.05 M KPO4 pH 7.0) overnight at 4°C, then
dehydrated in an ethanol series and critical point dried. Mounted samples were
sputter coated with gold and viewed at 5 kV accelerating voltage in a Hitachi
S570 SEM.
| RESULTS |
|---|
|
|
|---|
|
Genomic Southern blots probed with zfl1 cDNA consistently revealed
two bands in maize inbreds W22 and A632, suggesting that zfl1 and
zfl2 are the only FLO/LFY homologs in maize. These genes
were previously mapped and are listed as ucsd(lfya) (=zfl1)
and ucsd(lfyb) (=zfl2) in the Maize Database
(www.agron.missouri.edu).
zfl1 maps near umc44a on chromosome 10, while zfl2
maps near umc6a on chromosome 2. These chromosomal regions contain
numerous other duplicate genes thought to have arisen via genome duplication
(Berhan et al., 1993
;
Devos and Gale, 1997
;
Gale and Devos, 1998
;
Moore et al., 1995
). We
calculated synonymous nucleotide divergence (Ks) between
zfl1 and zfl2 as described by Gaut and Doebley
(Gaut and Doebley, 1997
). The
divergence (Ks=0.1798) is within the range observed for many other
duplicated maize genes, suggesting that the zfl genes were duplicated
in the tetraploidy event thought to have occurred approximately 11 million
years ago in the lineage leading to maize and its relatives
(Gaut and Doebley, 1997
).
Expression of zfl1 and zfl2
Expression studies in numerous species have shown that FLO/LFY
homologs are transcribed both prior to and during reproductive development. To
determine whether this is true of the zfl genes in maize, we used an
RT-PCR approach that distinguishes the two transcripts
(Fig. 2). We detected both
zfl1 and zfl2 transcripts in 20-day old vegetative apices
(including a few leaf primordia) and during male and female reproductive
development (Fig. 2B).
Expression was strongest relative to actin controls during early reproductive
development. We did not detect zfl transcripts in samples from
developing leaves (Fig.
2B).
|
Transposon mutagenesis of zfl1 and zfl2
Using a reverse genetics approach, we isolated and analyzed two independent
Mutator (Mu) transposon insertion alleles of zfl1
(zfl1-mum1 and zfl1-mum2) and three independent insertion
alleles of zfl2 (zfl2-mum1, zfl2-mum2 and
zfl2-mum4) (Fig. 1B).
All Mu alleles analyzed carry insertions in one of the first two
exons of zfl1 or zfl2.
To determine whether the insertion alleles are loss-of-function (RNA nulls), we used northern blot analysis with zfl1-mum1 and zfl2-mum1. Since these Mu insertion alleles had novel restriction fragment length polymorphisms (RFLPs), we could identify plants homozygous for insertion alleles at both zfl1 and zfl2 (double mutants) by Southern hybridization (Fig. 3A). A northern blot with total RNA from immature ears of double mutant and wild-type plants produced a hybridization signal at about 1400 nt for wild-type plants, but RNA from plants doubly homozygous for zfl1 and zfl2 Mu alleles showed no signal (Fig. 3B). The failure to detect normal transcript suggests that zfl1-mum1 and zfl2-mum1 are likely null alleles, and is consistent with the anticipated consequence of Mu transposon insertions within the exons of these genes.
|
2<12.9; P>0.12). A novel qualitative phenotype
(loss of floral meristem identity, described below) was observed in both
families at frequencies of 12/299 (MK family) and 5/87 (W1 family). This
phenotype was found only in plants homozygous for insertion alleles at both
zfl1 and zfl2, and all such double homozygotes exhibited
this phenotype. The frequency of the novel phenotype in both families fit a
15:1 ratio as expected for two redundant loci (
2
2.6;
P
0.10).
Loss of zfl function affects the vegetative to reproductive
transition
Vegetative development in zfl1; zfl2 double mutant plants is
normal (Fig. 4A), but
morphological defects become apparent during the transition to reproductive
development (Fig. 4A-D).
Whereas wild-type maize plants switch abruptly from forming leaves to forming
tassel branches, in zfl1; zfl2 double mutants, this transition is
severely compromised. The upper nodes of zfl1; zfl2 double mutant
plants regularly produce `tassel ears,' branched reproductive structures with
husk leaves surrounding a female inflorescence often with a terminal spike of
male flowers (Fig. 4C,D). Toward the tip of the plant, these structures become progressively more like
standard long tassel branches (Fig.
4D). We quantified the frequency of `tassel ears' in a family (MK)
of 299 plants segregating for zfl-mum1 and zfl2-mum1. In
this family, the double mutant plants generated from zero to eight `tassel
ears' (avg. 3.4±0.9 vs. 0 in wild-type siblings). In double mutant
plants, internodes between the `tassel ears' are frequently short and twisted,
with leaves often partially fused to two adjacent nodes. These aberrant
internodes are interspersed with normal internodes, resulting in a twisted
stem and uneven leaf distribution in the upper part of the plant, a phenotype
that is strikingly similar to the terminal ear1 mutant in maize
(Veit et al., 1998
). Above the
aberrant internodes, zfl double mutants form a reduced number of
tassel branches (avg. 0.6±0.9 vs. 9.7±0.6 in wild-type siblings)
and a normal central tassel spike with polystichous spikelet-pair phyllotaxy
as in their wild-type siblings.
|
Loss of zfl function disrupts floral development
The wild-type maize ear bears its flowers in spikelets, which are arranged
in pairs along the axis of the ear (Fig.
5A). During spikelet development, a pair of glumes is initiated
first, followed by the lower and upper florets. The lower floret aborts early
in development such that each female spikelet has only one mature floret
(Fig. 5A,C). Each female floret
initiates a lemma, palea, three stamens and a gynoecium. The stamen primordia
subsequently abort (Fig. 5C).
The gynoecial primordium forms a ridge that expands to enclose the developing
ovule and then part of the gynoecial ridge elongates to form the silk
(Fig. 5E,G,I)
(Cheng et al., 1983
). Growth
of the female floret meristem terminates with differentiation of a single
ovule (Fig. 5I, Ov).
|
Similar to the ear, the wild-type maize tassel bears its flowers in
spikelets, which are arranged in pairs along the axis of the tassel branches
and central spike (not shown). Tassel spikelet meristems initiate a pair of
glumes, followed by the lower and upper florets, both of which develop fully
(Fig. 6A,C). Male florets
consist of a lemma and palea that subtend two lodicules and three stamens.
Like female florets, wild-type male florets are initially bisexual, but the
central gynoecium aborts while the three stamens develop to maturity
(Cheng et al., 1983
).
|
Second and third whorl organ development in male flowers is severely affected in double mutant plants. The second whorl lodicules of wild-type male florets swell at maturity to open the florets and facilitate pollen shed. Lodicules of double mutant plants are frequently chimeric with lemma/palea-like outgrowths or are missing entirely, and consequently, the florets rarely open at maturity. The third whorl of wild-type male florets contains three stamens. Double mutant florets develop few or no stamens (Fig. 6D-H), and those that do develop show defects including twisting (Fig. 6F,G), a decreased number and size of locules (Fig. 6D), and lemma or palea-like outgrowths (Fig. 6G, asterisk). Though pollen grains are sometimes present in the locules, these plants do not shed pollen, suggesting defects in stamen maturation or dehiscence.
Quantitative variation associated with zfl genotype
In addition to the qualitative morphological defects resulting from loss of
zfl function, we found statistically significant associations
(P<0.05) between some quantitative traits and active zfl
copy number. This was done using the MK family of 299 plants segregating for
the zfl1-mum1 and zfl2-mum1 alleles. All plants were
genotyped by RFLP analysis at both zfl1 and zfl2, and
classified for total number of active (wild-type) copies of zfl from
zero (double mutant) to four (fully wild type). Associations between
phenotypic traits and zfl1 and zfl2 genotype and total
zfl copy number were assessed by ANOVA. Dominance/additivity (d/a)
ratios were calculated to determine whether trends were additive
(|d/a|<0.5) or dominant (|d/a|>0.5), where a=wt/2-mut/2 and d=Het
(mut/2+wt/2). Data from the double mutant class were excluded (except
where noted) to ensure that quantitative trends were not influenced by the
major morphological defects of the double mutant genotypic class.
Flowering time is significantly associated with genotype for both zfl1 and zfl2 whether measured in developmental (leaf number) or actual (days to pollen shed) time (Fig. 7A). An additive trend of increasing leaf number is associated with a decreasing number of active zfl1 copies, while zfl2 is associated with a dominant trend (Fig. 7A). Similarly, an additive trend of increasing time to pollen shed is significantly associated with a decreasing number of active zfl1 copies, while zfl2 is associated with a dominant trend (Fig. 7A).
|
We measured inflorescence phyllotaxy by scoring tassel and ear rank (the number of spikelet-pair ranks, or vertical rows, produced around the circumference of the male and female primary inflorescence axes). A statistically significant additive trend of decreasing tassel rank is associated with a decreasing number of active zfl1 copies (Fig. 7B). The association of tassel rank with zfl2 shows the same trend, although the P value for statistical significance falls just above the usual P=0.05 cut off. A statistically significant additive decrease in ear rank is associated with decreasing active copy number of both zfl1 and zfl2 (Fig. 7B).
| DISCUSSION |
|---|
|
|
|---|
Concordant with the similarity in mutant phenotype between zfl in
maize and FLO/LFY in dicots, these genes share a similar expression
pattern during floral development. zfl mRNA is expressed throughout
early floral meristems and subsequently relegated to developing organ
primordia (Fig. 2C-H). This
pattern is similar to the floral expression patterns of FLO/LFY-like
genes reported in several dicot species
(Coen et al., 1990
;
Hofer et al., 1997
;
Kelly et al., 1995
;
Molinero-Rosales et al., 1999
;
Souer et al., 1998
;
Weigel et al., 1992
). The
conserved expression pattern and similar mutant effects on floral development,
suggest that dicot FLO/LFY and zfl play a conserved role in
floral development.
Divergent expression patterns of FLO/LFY homologs have been
reported for two grasses, rice and Lolium temulentum
(Gocal et al., 2001
;
Kyozuka et al., 1998
). The
rice homolog, RFL, was detected in developing panicle branches, but
not in initiating branch or flower meristems. Kyozuka et al. proposed that
RFL may be important for inflorescence architecture and is probably
not essential for flower patterning
(Kyozuka et al., 1998
).
The Lolium temulentum homolog, LtLFY, was initially detected
in spikelet meristems, glumes and lemmas, but not during later stages of
floret development (Gocal et al.,
2001
). It will be interesting as more data become available to
determine whether diversity in FLO/LFY expression patterns is
characteristic of monocots in general. However, since both FLO and LFY can act
non cell-autonomously during flower development
(Hantke et al., 1995
;
Sessions et al., 2000
) and LFY
protein has been detected in cells in Arabidopsis flowers where
LFY mRNA was not observed (Parcy
et al., 1998
), mutants in additional monocot species are needed to
address whether the diversity of expression patterns reflects a diversity of
functions.
ZFL functions in the reproductive transition
FLO and LFY have been implicated in Antirrhinum
and Arabidopsis in coordinating the abrupt transition from vegetative
to inflorescence development by ensuring that independent aspects of
inflorescence fate are adopted simultaneously
(Bradley et al., 1996
;
Ferrandiz et al., 2000
;
Liljegren et al., 1999
). This
function appears to be shared by the zfl genes of maize. The
transition from vegetative to reproductive state occurs more gradually in
zfl double mutants than in wild-type plants with some vegetative
characteristics being maintained after the onset of the reproductive
phase.
Several other mutants in maize also have aberrant expression of vegetative
traits in inflorescences. These mutants, including the dominant
Teopod mutations, Tp1-Tp3
(Poethig, 1988
),
Lax-midrib1-O (Schichnes and
Freeling, 1998
) and liguless2
(Walsh and Freeling, 1999
),
have been characterized as having defective phase transitions. All of these
mutants show, to varying degrees, development of abnormal transition nodes
expressing both vegetative and reproductive characteristics, suggesting
defects in generating an abrupt boundary between the vegetative and
reproductive phases (Freeling et al.,
1992
; Poethig,
1988
). Given the similarity in phenotypes among these mutants and
the zfl mutant, it would be of interest to test if they act in the
same or different developmental pathways.
ZFL functions in inflorescence architecture
zfl mutants have a dramatically reduced number of tassel branches
and there is a quantitative association between an increase in zfl2
copy number and an increase in the number of long tassel branches. These
observations suggest that in maize, zfl plays a direct role in
promoting branch establishment in addition to its roles in flower development.
A function for zfl in promoting inflorescence branching is somewhat
difficult to reconcile with results in dicots. Most FLO/LFY single
mutants in dicots show an increase in branching due to the conversion of
flowers into shoots (Coen et al.,
1990
; Molinero-Rosales et al.,
1999
; Schultz and Haughn,
1991
; Weigel et al.,
1992
), suggesting FLO/LFY suppresses branching by promoting flower
development. However, LFY has been implicated in promoting branch meristem
establishment when combined with the Arabidopsis wiggum
(wig) and filamentous flower (fil) mutations
(Running et al., 1998
;
Sawa et al., 1999
). Thus, it
is plausible that ZFL promotes inflorescence branching, although in a genetic
background-dependent manner.
We have also observed a quantitative decrease in inflorescence phyllotaxy that is associated with decreasing zfl activity in a family segregating for zfl1-mum1; zfl2-mum1 (Fig. 7B). We confirmed this association in an independent family segregating for zfl1-mum2; zfl2-mum4 (The W1 family; data not shown). An effect on inflorescence phyllotaxy has not been described for FLO/LFY homologs in other species. This suggests that ZFL may play a novel role in promoting higher orders of inflorescence phyllotaxy in maize, perhaps by influencing inflorescence meristem organization or size to promote formation of increased numbers of primordia around the circumference of the meristem. We caution, however, that at present our knowledge of the quantitative effects on inflorescence phyllotaxy only show them to be `associated' with ZFL, and must await confirmation using transgenic methodologies.
Possible roles for FLO/LFY homologs in morphological evolution
Though FLO/LFY homologs have conserved functions in flower
development in divergent species (Ahearn et
al., 2001
; Coen et al.,
1990
; Hofer et al.,
1997
; Molinero-Rosales et al.,
1999
; Schultz and Haughn,
1991
; Souer et al.,
1998
; Weigel et al.,
1992
), several species appear to have evolved additional functions
for this gene. For example, the pea and tomato homologs promote compound leaf
development (DeMason and Schmidt,
2001
; Hofer et al.,
1997
; Molinero-Rosales et al.,
1999
), and the tobacco NFL genes are required for proper
shoot apical meristem development (Ahearn
et al., 2001
). In violet cress, changes in FLO/LFY
expression have also been associated with an accelerated reproductive
transition and the concurrent change in inflorescence structure
(Shu et al., 2000
).
Defects associated with loss of ZFL in maize suggest that the role of the zfl genes in flower patterning does not differ dramatically between maize and dicots. However, variation in the number of active copies of zfl is associated with variation in inflorescence structure. This observation suggests a novel role for zfl in inflorescence architecture in maize and perhaps other grasses. Crucially, varying zfl copy number from one to four showed significant associated effects on inflorescence branching and phyllotaxy without compromising flower development. Therefore, natural or human selection might quantitatively alter grass inflorescence architecture by modulating ZFL activity. Since FLO/LFY homologs share conserved roles in flower development, but variable roles in other aspects of development, involvement of these genes in morphological evolution of flowering plants may reflect independent appropriations to roles outside flower development. Dramatic changes in protein function are likely to be limited by the constraint that these genes are essential for normal flower development in diverse species. Thus, we anticipate that these novel functions result principally from alterations in the pattern of FLO/LFY expression or from changes in downstream targets.
Finally, we have shown that an increase in the number of active copies of
zfl is associated with an increase in the number of ranks of
spikelet-pairs around the circumference of the maize ear. This is one of the
key morphological changes involved in the evolution of maize from its
progenitor, teosinte (Zea mays ssp. parviglumis).
Domesticated maize produces decussate (four ranked) or polystichous (many
ranked) ears and tassels, while teosinte invariably produces two-ranked
(distichous) inflorescences (Beadle,
1939
; Galinat,
1983
). A number of QTL controlling ear rank differences between
maize and teosinte have been identified. An ear rank QTL of large-effect that
maps near zfl2 on chromosome 2 was identified in multiple studies,
while a smaller and more variable QTL that maps to chromosome 10 near
zfl1 was identified in a few studies
(Doebley, 1992
). The
associated trends between zfl copy number and ear rank support the
candidacy of zfl1 and zfl2 as the genes underlying these QTL
and suggest that human selection for increasing ear rank (higher kernel row
number) during maize domestication may have led to increased ZFL2 activity in
the inflorescence meristem.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Ahearn, K. P., Johnson, H. A., Weigel, D. and Wagner, D. R.
(2001). NFL1, a Nicotiana tabaccum LEAFY-like
gene, controls meristem initiation and floral structure. Plant Cell
Physiol. 42,1130
-1139.
Ambrose, B. A., Lerner, D. R., Ciceri, P., Padilla, C. M., Yanofsky, M. F. and Schmidt, R. J. (2000). Molecular and genetic analyses of the silky1 gene reveal conservation in floral organ specification between eudicots and monocots. Mol. Cell 5,569 -579.[CrossRef][Medline]
Araki, T. (2001). Transition from vegetative to reproductive phase. Curr. Opin. Plant Biol. 4, 63-68.[CrossRef][Medline]
Beadle, G. (1939). Teosinte and the origin of
maize. J. Hered. 30,245
-247.
Berhan, A. M., Hulbert, S. H., Butler, L. G. and Bennetzen, J. L. (1993). Structure and evolution of the genomes of Sorghum bicolor and Zea mays. Theor. Appl. Genet. 86,598 -604.[CrossRef]
Berlyn, G. and Miksche, J. (1976). Botanical Microtechnique and Cytochemistry. Ames, IA: Iowa State University Press.
Bowman, J. L., Smyth, D. R. and Meyerowitz, E. M. (1991). Genetic interactions among floral homeotic genes of Arabidopsis. Development 112, 1-20.[Abstract]
Bradley, D., Ratcliffe, O., Vincent, C., Carpenter, R. and Coen,
E. (1997). Inflorescence commitment and architecture in
Arabidopsis. Science
275, 80-83.
Bradley, D., Vincent, C., Carpenter, R. and Coen, E. (1996). Pathways for inflorescence and floral induction in Antirrhinum. Development 122,1535 -1544.[Abstract]
Carpenter, R., Copsey, L., Vincent, C., Doyle, S., Magrath, R. and Coen, E. (1995). Control of flower development and phyllotaxy by meristem identity genes in Antirrhinum. Plant Cell 7,2001 -2011.[Abstract]
Cheng, P. C., Greyson, R. I. and Walden, D. B. (1983). Organ initiation and the development of unisexual flowers in the tassel and ear of Zea mays. Amer. J. Bot. 70,450 -462.[CrossRef]
Christiansen, A. H. and Quail, P. H. (1989). Sequence analysis and transcriptional regulation by heat shock of polyubiquitin transcripts from maize. Plant Mol. Biol. 12,619 -632.[CrossRef]
Coen, E. S. and Meyerowitz, E. M. (1991). The war of the whorls: genetic interactions controlling flower development. Nature 353,31 -37.[CrossRef][Medline]
Coen, E. S., Romero, J. M., Doyle, S., Elliott, R., Murphy, G. and Carpenter, R. (1990). floricaula: a homeotic gene required for flower development in Antirrhinum majus.Cell 63,1311 -1322.[CrossRef][Medline]
DeMason, D. A. and Schmidt, R. J. S. (2001). Roles of the uni gene in shoot and leaf development of pea (Pisum sativum): phenotypic characterization and leaf development in the uni and uni-tac mutants. Int. J. Plant. Sci. 162,1033 -1051.[CrossRef]
Devos, K. M. and Gale, M. D. (1997). Comparative genetics in the grasses. Plant Mol. Biol. 35, 3-15.[CrossRef][Medline]
Doebley, J. (1992). Mapping the genes that made maize. Trends Genet. 8,302 -307.[Medline]
Doebley, J. and Stec, A. (1991). Genetic analysis of the morphological differences between maize and teosinte. Genetics 129,285 -295.[Abstract]
Ferrandiz, C., Gu, Q., Martienssen, R. and Yanofsky, M. F. (2000). Redundant regulation of meristem identity and plant architecture by FRUITFULL, APETALA1 and CAULIFLOWER.Development 127,725 -734.[Abstract]
Freeling, M., Bertrand-Garcia, R. and Sinha, N. (1992). Maize mutants and variants altering developmental time and their heterochronic interactions. BioEssays 14,227 -236.[CrossRef][Medline]
Gale, M. D. and Devos, K. M. (1998).
Comparative genetics in the grasses. Proc. Natl. Acad. Sci.
USA 95,1971
-1974.
Galinat, W. C. (1983). The origin of maize as shown by key morphological traits of its ancestor, teosinte. Maydica 28,121 -138.
Gaut, B. S. and Doebley, J. F. (1997). DNA
sequence evidence for the segmental allotetraploid origin of maize.
Proc. Natl. Acad. Sci. USA
94,6809
-6814.
Gocal, G. F., King, R. W., Blundell, C. A., Schwartz, O. M.,
Andersen, C. H. and Weigel, D. (2001). Evolution of
floral meristem identity genes. Analysis of Lolium temulentum genes
related to APETALA1 and LEAFY of Arabidopsis.Plant Physiol. 125,1788
-1801.
Hantke, S. S., Carpenter, R. and Coen, E. S. (1995). Expression of floricaula in single cell layers of periclinal chimeras activates downstream homeotic genes in all layers of floral meristems. Development 121, 27-35.[Abstract]
Hofer, J., Turner, L., Hellens, R., Ambrose, M., Matthews, P., Michael, A. and Ellis, N. (1997). UNIFOLIATA regulates leaf and flower morphogenesis in pea. Curr. Biol. 7,581 -587.[CrossRef][Medline]
Huala, E. and Sussex, I. M. (1992).
LEAFY interacts with floral homeotic genes to regulate
Arabidopsis floral development. Plant Cell
4, 901-913.
Kelly, A. J., Bonnlander, M. B. and Meeks-Wagner, D. R. (1995). NFL, the tobacco homolog of FLORICAULA and LEAFY, is transcriptionally expressed in both vegetative and floral meristems. Plant Cell 7, 225-234.[Abstract]
Kyozuka, J., Konishi, S., Nemoto, K., Izawa, T. and Shimamoto,
K. (1998). Down-regulation of RFL, the
FLO/LFY homolog of rice, accompanied with panicle branch initiation.
Proc. Natl. Acad. Sci. USA
95,1979
-1982.
Liljegren, S. J., Gustafson-Brown, C., Pinyopich, A., Ditta, G.
S. and Yanofsky, M. F. (1999). Interactions among
APETALA1, LEAFY, and TERMINAL FLOWER1 specify meristem fate.
Plant Cell 11,1007
-1018.
Ma, H. and dePamphilis, C. (2000). The ABCs of floral evolution. Cell 101, 5-8.[CrossRef][Medline]
Martienssen, R. and Baron, A. (1994). Coordinate suppression of mutations caused by Robertson's mutator transposons in maize. Genetics 136,1157 -1170.[Abstract]
Meeley, R. B. and Briggs, S. P. (1995). Reverse genetics for maize. Maize Newsletter 69, 67-82.
Mena, M., Ambrose, B. A., Meeley, R. B., Briggs, S. P.,
Yanofsky, M. F. and Schmidt, R. J. (1996). Diversification of
C-function activity in maize flower development.
Science 274,1537
-1540.
Molinero-Rosales, N., Jamilena, M., Zurita, S., Gomez, P., Capel, J. and Lozano, R. (1999). FALSIFLORA, the tomato orthologue of FLORICAULA and LEAFY, controls flowering time and floral meristem identity. Plant J. 20,685 -693.[CrossRef][Medline]
Moore, G., Devos, K. M., Wang, Z. and Gale, M. D. (1995). Cereal genome evolution. Grasses, line up and form a circle. Curr. Biol. 5,737 -739.[CrossRef][Medline]
Ng, M. and Yanofsky, M. F. (2001). Function and evolution of the plant MADS-box gene family. Nat. Rev. Genet. 2,186 -195.[CrossRef][Medline]
Parcy, F., Nilsson, O., Busch, M. A., Lee, I. and Weigel, D. (1998). A genetic framework for floral patterning. Nature 395,561 -566.[CrossRef][Medline]
Patel, N. H. (1994). Evolution of insect
patterning. Proc. Natl. Acad. Sci. USA
91,7385
-7386.
Poethig, R. S. (1988). Heterochronic mutations
affecting shoot development in maize. Genetics
119,959
-973.
Running, M. P., Fletcher, J. C. and Meyerowitz, E. M. (1998). The WIGGUM gene is required for proper regulation of floral meristem size in Arabidopsis.Development 125,2545 -2553.[Abstract]
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning, A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Sawa, S., Ito, T., Shimura, Y. and Okada, K.
(1999). FILAMENTOUS FLOWER controls the
formation and development of Arabidopsis inflorescences and floral
meristems. Plant Cell
11, 69-86.
Schichnes, D. and Freeling, M. (1998). Lax-midrib1-O, a systemic heterochronic mutant of maize. Amer. J. Bot. 85,481 -491.[Abstract]
Schultz, E. A. and Haughn, G. W. (1991).
LEAFY, a homeotic gene that regulates inflorescence development in
Arabidopsis. Plant Cell
3, 771-781.
Sessions, A., Yanofsky, M. F. and Weigel, D.
(2000). Cell-cell signaling and movement by the floral
transcription factors LEAFY and APETALA1.Science 289,779
-782.
Shu, G., Amaral, W., Hileman, L. C. and Baum, D.A.
(2000). LEAFY and the evolution of rosette flowering in
violet cress (Janopsidium aucale, Brassicaceae). Amer. J.
Bot. 87,634
-641.
Souer, E., van der Krol, A., Kloos, D., Spelt, C., Bliek, M., Mol, J. and Koes, R. (1998). Genetic control of branching pattern and floral identity during Petunia inflorescence development. Development 125,733 -742.[Abstract]
Veit, B., Briggs, S. P., Schmidt, R. J., Yanofsky, M. F. and Hake, S. (1998). Regulation of leaf initiation by the terminal ear1 gene of maize. Nature 393,166 -168.[CrossRef][Medline]
Walsh, J. and Freeling, M. (1999). The liguleless2 gene of maize functions during the transition from the vegetative to the reproductive shoot apex. Plant J. 19,489 -495.[CrossRef][Medline]
Weigel, D., Alvarez, J., Smyth, D. R., Yanofsky, M. F. and Meyerowitz, E. M. (1992). LEAFY controls floral meristem identity in Arabidopsis. Cell 69,843 -859.[CrossRef][Medline]
Weigel, D. and Meyerowitz, E. M. (1994). The ABCs of floral homeotic genes. Cell 78,203 -209.[CrossRef][Medline]
Wikstrom, N., Savolainen, V. and Chase, M. W. (2001). Evolution of the angiosperms: calibrating the family tree. Proc. Royal Soc. Lond. B. Biol. Sci. 268,2211 -2220.[Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
G. Chuck, R. Meeley, and S. Hake Floral meristem initiation and meristem cell fate are regulated by the maize AP2 genes ids1 and sid1 Development, September 15, 2008; 135(18): 3013 - 3019. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Sundberg, A. R. Orr, and T. D. Pizzolato Phyllotactic pattern is altered in the transition to flowering in the early ears of Zea mays landrace chapalote (Poaceae) Am. J. Botany, |