|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online July 21, 2003
doi: 10.1242/10.1242/dev.00594
Department of Cell and Structural Biology and Program in Cell and Developmental Biology, University of Colorado Health Sciences Center, 4200 East Ninth Avenue, Denver, CO 80262, USA e-mail: joan.hooper{at}uchsc.edu
Accepted 9 May 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Hedgehog, Smoothened, Frizzled, Morphogen, Drosophila
| INTRODUCTION |
|---|
|
|
|---|
Transcriptional responses to Hh are mediated by the Ci/Gli family of
transcription factors, which can act both as repressors and activators of
transcription (Dominguez et al.,
1996
; Aza-Blanc et al.,
1997
; Ruiz i Altaba,
1997
; Methot and Basler,
1999
; Wang et al.,
2000a
). The choice between these activities is regulated by Hh and
implemented by a cytoplasmic complex that includes full length Ci (Ci155), the
serine-threonine kinase Fused (Fu), the kinesin-like Costal (Cos) and
Suppressor of Fused (Sufu) (Robbins et
al., 1997
; Sisson et al.,
1997
; Monnier et al.,
1998
; Stegman et al.,
2000
). Ci155 appears to be a latent precursor form. In the absence
of Hh, limited proteolysis takes Ci155 to its repressor form, CiR
(Aza-Blanc et al., 1997
;
Robbins et al., 1997
;
Methot and Basler, 2000
). This
processing involves Cos, Fu regulatory domain (FuReg), phosphorylation of Ci
by PKA, GSK3 and CKI, and a ubiquitin E3 ligase activity mediated by Slimb and
Cul1 (Jiang, 2002
). Absence of
Hh also prevents Ci155 from entering the nucleus by a redundant mechanism that
requires either Cos and a Cos-binding site on Ci, or FuReg with Sufu and a
Sufu-binding site on Ci (Methot and
Basler, 2000
; Stegman et al.,
2000
; Wang et al.,
2000b
; Wang and Holmgren,
2000
; Lefers et al.,
2001
). In the presence of Hh, the complex dissociates from
microtubules, recruits Sufu, and hyperphosphorylates Fu and Cos
(Therond et al., 1996
;
Robbins et al., 1997
;
Stegman et al., 2000
;
Nybakken et al., 2002
). This
curtails processing to CiR, allows nuclear access of Ci155, promotes depletion
of Ci155 and generates the transcriptional activator, CiA
(Ohlmeyer and Kalderon, 1998
;
Chen et al., 1999
;
Wang and Holmgren, 1999
).
Whether CiA differs from Ci155 by post-translational modification, by
associated factors, and/or by subcellular localization has not been
determined. Full activation of Ci requires activity of Fu and Cos
(Ohlmeyer and Kalderon, 1998
;
Wang et al., 2000b
;
Lefers et al., 2001
).
Extensive analysis has failed to delineate simple roles for any of these
components in regulation of Ci, or which components are the primary targets of
Hh regulation.
Hh influences the Ci regulatory complex through two transmembrane proteins,
Patched (Ptc) and Smoothened (Smo). Ptc binds Hh with nanomolar affinity
(Chen and Struhl, 1996
;
Marigo et al., 1996
;
Stone et al., 1996
;
Fuse et al., 1999
). Ptc is
then internalized and traffics Hh to endosomal compartments where both are
degraded (Capdevila et al.,
1994
; Tabata and Kornberg,
1994
; Alcedo et al.,
2000
; Denef et al.,
2000
; Incardona et al.,
2000
; Incardona et al.,
2002
). In the process, Hh signaling is activated through Smo, a
member of the serpentine receptor superfamily
(Ingham et al., 1991
;
Alcedo et al., 1996
;
van den Heuvel and Ingham,
1996
). Ptc might regulate Smo through direct physical association,
but the bulk of the two proteins is not co-localized, does not
coimmunoprecipitate, and a 45:1 ratio of Smo:Ptc results in 80% reduction in
Smo activity (Stone et al.,
1996
; Murone et al.,
1999
; Denef et al.,
2000
; Johnson et al.,
2000
; Taipale et al.,
2002
). This suggests a catalytic mechanism for inhibition of Smo
by Ptc.
How Smo activates downstream signaling is unknown. Smo activity correlates
with its phosphorylation and accumulation at the cell surface
(Alcedo et al., 2000
;
Denef et al., 2000
;
Ingham et al., 2000
). This
phosphorylation and cell-surface accumulation may be a consequence of
signaling, rather than being necessary for signaling
(Kalderon, 2000
; Incardona,
2002; Taipale, 2002). Smo has a large N-terminal extracellular domain that is
evolutionarily conserved (Stone et al.,
1996
). Analogous to other serpentine receptors, this should be a
ligand-binding domain that regulates Smo activity. However, there is no
evidence that Smo has an extracellular ligand, nor any regulator other than
Ptc. Structure function studies of rat Smoothened suggested that the
extracellular and first two to four transmembrane domains are necessary for
its association with and regulation by Ptc, while its third intracellular loop
and seventh transmembrane domain activate downstream signaling
(Xie et al., 1998
;
Murone et al., 1999
).
Serpentine receptors generally couple to heterotrimeric G proteins through
these latter regions, suggesting that G proteins are involved in relaying the
Smo signal. Pertussis toxin, which interferes with G
i and G
o,
interferes with Hh-directed morphogenesis in zebrafish embryos, but not in
primary myoblasts (Hammerschmidt and
McMahon, 1998
; Norris et al.,
2000
). G
o can be activated when Hh, Ptc and Smo are
co-transfected into melanophores, but the slow kinetics suggest that this
effect may be indirect (DeCamp et al.,
2000
). Given the broad range of cellular processes modulated by G
proteins and many potential mechanisms for across-regulation between pathways,
these data are equally consistent with an indirect role for G proteins in Hh
signaling. Smo has a long cytoplasmic tail, which is uncharacteristic of
G-protein-coupled receptors. This suggests that something other than G
proteins may be involved in transducing the Hh signal.
To understand how Smoothened transduces the Hh signal, we built a series of truncated and chimeric versions of Smo. Fz1, which is structurally related to Smo but has no genetic interactions with the Hh pathway, was used to generate chimeric Smo/Fz proteins. Their activity was measured through their effects on Ci, their regulation of Hh target genes, and their effects on wing patterning. We find that low and high Hh responses are independently affected by various transgenes. This leads to a model where Smo adopts three distinct states in response to zero, low and high levels of Hh. The OFF state exerts no influence on Ci or the regulatory complex, the low state binds to and inactivates Cos, while the high state involves Smo oligomers that activate Fu and Cos. In addition we find that the cytoplasmic tail of Smo attached to Fz can activate the full range of Hh responses, but in response to Wg rather than Hh. This suggests that Fz also responds to different ligand levels with distinct signaling states. Distinct signaling states of a receptor is a novel mechanism by which a morphogen could generate multiple responses to a single ligand.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
|
Transgene construction and characterization
Smo full-length cDNA was truncated using PCR to introduce a SalI
site at nucleotide 174 in its 5'UTR and a XhoI site immediately
after the termination codon. A double stranded oligonucleotide with compatible
3' overhangs and encoding a Myc epitope was inserted in frame
immediately following the putative signal sequence at the SfiI site
at nucleotide 332 (CGATGCAGCAAAAGCTCATTTCTGAAGAGGACTTGAATAGTT). An
AatI site was introduced at the end of the seventh transmembrane
domain, changing TGGACACCTTCT to TGGACGTCTTCT and resulting in T554S, P555S.
The endogenous NdeI site at I265 in the first transmembrane domain
was used for domain swaps with Fz. SmoC was generated using PCR to insert an
ATG codon embedded in a Kozak initiation consensus context, and a Myc epitope
(±a myristoylation sequence derived from Src) immediately before T554;
MycSmoC
(TTAGATCTAACCAACATGGAGCAAAAGCTCATTTCTGAATATTACTTGAATACACCTTCTTCAATTGAG),
MycMyr SmoC (inserting ATGGGCTCCTCCAAGTCCAAGCCCAAG before the first ATG of
MycSmoC). MycSmoN was generated using PCR to introduce a termination codon
into MycSmo after I255 (CCCCAAGCTTACTCGGCATGCTCATC). MycSmoT1 was generated
using PCR to introduce a termination codon into MycSmo after the first
transmembrane domain at P288 (CTACGGATACTTGTTTGGCATTC). Fz full-length cDNA (a
gift from P. Adler) was modified immediately before the stop codon by in frame
insertion of a double stranded oligonucleotide with compatible 5'
overhangs and encoding an HA epitope into the BsiW1 site at
nucleotide 1751 (GTACCCATACGACGTTCCAGACTACGCGTAGTCGAC). An AatI site
was introduced at the end of the seventh transmembrane domain by changing
CTGTATTCCAGCAAG to CTGTGGACGTCCAAG and resulting in Y553W. An NdeI
site was inserted in the first transmembrane domain by modifying GCACGGGTCTGT
to GCACGCATATGT, and resulting in V256I. Nucleotide substitutions were all
accomplished using the Altered Sites mutagenesis kit (Promega) and confirmed
by sequencing.
Chimeric transgenes were constructed by swapping Fz and Smo domains at the
AatI and NdeI sites. The chimeric, mutagenized and truncated
transgenes (Fig. 3) were
subcloned into pUAST (Brand and Perrimon,
1993
) and introduced into the germline of flies by standard
methods (Rubin and Spradling,
1982
). Multiple independent lines were established for each
transgene. Activity was scored by effects on wing vein patterning and wing
hair polarity, following expression driven by MS1096. About one in
six lines had unusually potent phenotypic effects, which correlated with
unusually high levels of protein accumulation, as assayed by
immunofluorescence. These unusual lines were judged high expressers rather
than aberrant products if similar phenotypic effects were generated by high
dosage (e.g. 4x) of more typical transgenes. Protein product of the
expected size was confirmed by western blotting of embryo extracts where
transgene expression was driven by hsGal4. Expression dosages are
expressed as the product of the Gal4 driver dosage and Uas transgene dosage.
Thus, heterozygous C765, 71B or MS1096 driving a single copy
of UasSmo is 1x; hemizygous MS1096 driving a single
copy of UasSmo is 2x; hemizygous MS1096 driving two
copies of UasSmo is 4x; and transgenes with unusually high
expression levels are High.
|
| RESULTS |
|---|
|
|
|---|
|
|
The induction of Hh responses deep in the anterior compartment by
Smo overexpression might be independent of Hh. Alternatively, Hh
levels anterior to L3 might normally be below the response threshold but might
elicit a response when the ratio of Smo to Ptc increases. To test for Hh
dependence, Hh levels were severely reduced using a temperature sensitive
allele of hhts2 (not shown). After 24 hours at the
restrictive temperature, col and Iro were not detected at the
compartment border of hhts2 homozygous discs, whereas
expression of ptc and dpp was greatly reduced
(Strigini and Cohen, 1997
).
Smo 2x restored Iro and dpp expression to
hhts2 homozygous discs, whereas high Smo restored
Iro, dpp and ptc levels but not col expression. In
all cases the restored expression was broader than its domain in wild-type
discs. We conclude that the dosage-dependent responses to Smo
overexpression are Hh independent.
FFS mediates all Hh responses but is regulated by Wg
To identify domains of Smoothened responsible for regulation of Hh
signaling, we built truncated and chimeric versions of Smo. Smo is a divergent
member of the Frizzled (Fz) family of receptors. Fzs bind their ligands, the
Wnts, through a conserved extracellular N-terminal cysteine-rich domain (CRD),
transduce the signal across the membrane via seven conserved transmembrane
domains (TM), and initiate signaling with divergent cytoplasmic tails (CT)
(Bhanot et al., 1996
;
Xu and Nusse, 1998
;
Dann et al., 2001
). Fz1, which
appears to have no genetic interactions with the Hh pathway, was used to
generate chimeric Smo/Fz proteins. Chimeras swapped the extracellular CRDs,
the TM domains and the CTs. Constructs and results are summarized in
Fig. 3.
A chimera with Fz CRD, Fz TM and Smo CT (FFS) activated the full spectrum
of Hh responses, but was regulated by Wg rather than Ptc and Hh
(Fig. 4). FFS 4x gave
some excess venation distally, between the second and third wing veins (not
shown). High FFS gave ectopic venation near the wing margin and overgrowth of
the costa (Fig. 4A). Iro and
dpp expression changed little at the border but showed a distinct new
focus at the anterior edge of the dorsal wing pouch and along the prospective
wing margin (Fig. 4B,C).
ptc and col expression were unaffected
(Fig. 4D,E). Consistent with
previous reports (Krasnow and Adler,
1994
), Fz had no effect on overall wing morphology and
affected only wing hair polarity (not shown). Thus, the effects of FFS on Hh
responses must be through the Smo cytoplasmic tail. FSS failed to
mount Hh responses, so either the chimeric junction in the first transmembrane
domains cripples this construct or the TM domains must be compatible with the
CRD for chimera activity.
|
The extracellular and TM regions of Smo are thought to mediate its regulation by Ptc, so FFS should not be regulated by Ptc. Coexpression of Ptc did not suppress the ectopic venation and overgrowth mediated by FFS, and instead allowed ectopic venation in a broad zone around the wing margin (Fig. 4G). Apparently repression of endogenous Smo (e.g. Fig. 4F) uncovers an FFS activity where Wg should be low. We did not test this interpretation by asking whether FFS can activate Hh responses without endogenous Smo. With that caveat, we conclude that FFS activates different levels of Hh signaling in response to different levels of Wg. Therefore, the cytoplasmic tail of Smo is sufficient to activate all Hh responses. The regulated activity of FFS also argues that similar structural transitions underlie signaling by Fz and by Smo.
SSF is dominant negative for high signaling
The converse chimera, with Smo CRD, Smo TM and Fz CT (SSF) had no effect on
Fz responses, and instead interfered with high but not low Hh responses
(Fig. 5). SSF 2x
generated a subtle narrowing of the L3/4 interval (not shown). Higher SSF in a
background with only one dose of wild-type Smo blocked high Hh responses; the
spacing between the third and fourth wing vein was reduced
(Fig. 5A), in concert with lost
expression of col (Fig.
5E) and reduced expression of ptc
(Fig. 5D). SSF also interfered
with two aspects of Ci155 regulation that normally accompany CiA, depletion
immediately adjacent to the border (Fig.
5M,N) and nuclear access (Fig.
5N). Lower levels of Ptc allow Hh to penetrate deeper into the
anterior compartment (Chen and Struhl,
1996
), so that dpp and Iro expression and Ci155
accumulation were expanded (Fig.
5B,C,M). Increasing dosages of SSF beyond this had no further
effect, and under no conditions did expression of SSF compromise L3. This is
distinct from overexpression of Ptc (Fig.
4F), where the `fused' phenotype is often accompanied by
interruption or elimination of L3 and loss of dpp expression
(Johnson et al., 1995
). The Fz
tail of SSF might contribute to its dominant-negative activity, though the
lack of dominant negative activity by FSF nor SFF render this less likely.
Instead the extracellular CRD and the TM domains both appear to be necessary
for the dominant negative activity of SSF.
|
The phenotypes generated by SSF overexpression are similar to those
generated by loss of fu. fu is required for transduction of high but
not low Hh responses (Mariol et al.,
1987
; Preat et al.,
1990
; Sanchez-Herrero et al.,
1996
; Mullor et al.,
1997
; Alves et al.,
1998
; Ohlmeyer and Kalderon,
1998
; Lefers et al.,
2001
; Glise et al.,
2002
; Nybakken et al.,
2002
). Fu has a kinase domain that is necessary only for high Hh
responses, and a regulatory domain that is instrumental in assembly of the Ci
regulatory complex (Robbins et al.,
1997
; Ascano et al.,
2002
; Monnier et al.,
2002
). SSF might interfere with response to high Hh by blocking
activation of Fused kinase, thus mimicking class I fu alleles, or by
preventing its assembly of Fu into the regulatory complex, thus mimicking
class II fu alleles. A genetic test for these alternatives is offered
by Sufu, the removal of which restores properly regulated Hh
signaling to class I fu alleles but constitutively activates
signaling in class II fu alleles. Removal of Sufu from wings
expressing SSF fits the latter profile
(Fig. 5F-I,O,P). Although high
Hh responses were rescued (L3-4 spacing and ptc expression), low Hh
responses were enhanced (ectopic venation, expansion of the anteroposterior
axis and of dpp expression). Finally, Sufu discs expressing
SSF allowed Ci155 to enter nuclei even deep in the anterior compartment where
Hh should be absent (Fig. 5O).
Thus, the spectrum of phenotypes generated by SSF expression is very similar
to that of class II fu alleles
(Lefers et al., 2001
). If SSF
were interfering with high Hh responses by decreasing the levels of Fu
available for signaling (e.g. like classII fu alleles), then
increasing levels of Fu should restore high signaling. Overexpression of
Fu along with SSF only weakly suppressed the `fused' phenotype
(Fig. 5J), suggesting that SSF
is acting on a regulator of Fu rather than on Fu itself.
The structure of SSF, retaining all of the transmembrane and extracellular sequences of Smo, suggests that SSF acts on a membrane protein rather than a cytoplasmic protein. If SSF were interfering with endogenous Smo, then increasing levels of wild-type Smo should restore high signaling. Indeed, the SSF phenotype was suppressed by co-expression of 2x Smo (Fig. 5K). Thus, the ratio of Smo to SSF is crucial for blockade of high signaling by SSF. SSF is unlikely to interfere with Smo through triggering its degradation, because reducing levels of Smo should affect low responses as well as high responses. Instead, we suggest that SSF titrates out Smo by direct binding, and that these Smo/SSF heterodimers cannot activate high signaling. It follows that normal high signaling may involve a dimeric (or oligomeric) form of Smo.
SmoC activates low Hh responses through endogenous Smo
For most receptors, the cytoplasmic domain without its transmembrane and
extracellular regulatory domains is constitutively active. The Smo cytoplasmic
tail (SmoC) was not constitutively active in the expected sense. Its strongest
activity was ectopic activation of low Hh responses. SmoC 2x
gave ectopic venation with no effect on L3/4 intervein (not shown).
SmoC 4x gave strong ectopic venation and variable costal
overgrowth (Fig. 7A,F,H).
Ectopic venation was accompanied by expansion of Iro and dpp
(Fig. 7B,C). Ci155 accumulated
ectopically in the costal primordium, at levels equivalent to or higher than
those normally seen within a few cell diameters of the compartment border
(Fig. 7P). Thus, SmoC
can curtail CiR production in the absence of Hh. SmoC also allowed
Ci155 to enter nuclei, even deep within the anterior compartment
(Fig. 7Q) where it is normally
excluded. Small clones overexpressing SmoC also permitted Iro
expression (not shown) and Ci155 accumulation
(Fig. 6C), indicating cell
autonomy for SmoC activity. We conclude that SmoC
constitutively activates low signaling.
|
This unexpected result was confirmed in embryos lacking all endogenous
smo activity (data not shown). smo3 germline
clone (smoGLC) embryos lose expression of wg, en and
hh during stage 10 and fail to upregulate ptc at the segment
and parasegment borders during and after stage 11
(van den Heuvel and Ingham,
1996
). UasSmo expressed under control of prdGal4
or Krgal4 rescued wg, en and ptc expression in
smoGLC embryos. No other transgene, including SmoC and FFS,
had any rescuing activity in smoGLC embryos. To test whether the
potent inhibitory effects of Ptc might mask a weak activity of SmoC, we
expressed our transgenes in embryos lacking ptc and with
near-threshold levels of smo. In ptcW,
smo3 embryos grown at 25°C, the maternal contribution of
smo+ is sufficient to sustain Hh target gene expression
until stage 11. ptc expression at the segment border, which is
fu-independent (Therond et al.,
1999
) and should be the equivalent of low signaling in wings, was
not rescued by SmoC nor FFS in ptcW,
smo3 embryos. wg expression, which requires
fu and should be equivalent to high signaling in the wing, was
prematurely eliminated during stage 10 when SmoC, SSF or Ptc
were driven by prdGal4. This recapitulated the dominant negative
effects of SSF and SmoC on a fu-dependent response, and
demonstrated that the transgenes were effectively expressed. The failure to
rescue wg or ptc expression, even with near-threshold
endogenous Smo and without Ptc, confirms that SmoC has no ability to activate
Hh target genes in the absence of endogenous Smo.
SmoC may act by interfering with costal
In addition to activating low Hh responses, SmoC interfered with
high Hh responses. SmoC 4x reduced the L3/4 spacing as well as
ptc and col expression
(Fig. 7A,D,E). It interfered
with the depletion of Ci155 immediately adjacent to the compartment border
that normally accompanies CiA (Fig.
7P,Q). It also prevented Ci155 accumulation to normal levels in
the zone three to eight cells from the compartment border
(Fig. 7P). The net effect of
SmoC expression, including both ectopic low responses and curtailed
high responses, was to drive all cells towards the low response state,
regardless of Hh. This might be through two activities of SmoC, one
mediating inhibition of high signaling and the other mediating activation of
low signaling. A simpler alternative is provided by the striking similarities
between the phenotypes of SmoC overexpression and cos loss.
Like SmoC overexpression, insufficient cos compromises both
full activation and full inhibition of Hh signaling
(Forbes et al., 1993
;
Wang et al., 2000b
;
Wang and Holmgren, 2000
). In
the presence of Hh, cos-null clones fail to activate high Hh
responses; En is not turned on and Ptc accumulates only to moderate levels
(Wang et al., 2000b
).
cos null clones also activate low Hh responses without Hh; clones
deep in the anterior compartment express dpp
(Wang et al., 2000b
) and Iro
(data not shown), and allow Ci155 accumulation and nuclear entry
(Sisson et al., 1997
;
Wang and Holmgren, 1999
;
Wang et al., 2000b
).
Hypomorphic cos alleles give overgrowth of the costa
(Grau and Simpson, 1987
)
similar to that driven by SmoC
(Fig. 7F). Published data do
not address whether low signaling in cos- cells requires
endogenous Smo activity (Methot and
Basler, 2000
). The similarity between the phenotypes of
SmoC overexpression and insufficient Costal suggests that
SmoC may act through interfering with Cos.
If SmoC were acting by interfering with Cos then increasing levels of Cos
should suppress the effects of SmoC. An extra copy of
cos+ suppressed all SmoC effects, including the
ectopic venation and the costal overgrowth indicative of low signaling, and
the L3/4 narrowing indicative of high signaling
(Fig. 7F-I). Thus the dual
activities of SmoC could occur through a single mechanism,
inactivating or sequestering Costal. The restoration of high signaling by
cos+ is specific to SmoC as
cos+ failed to suppress the L3/4 narrowing of SSF
(Fig. 7O) and had no effect in
a wild-type background (not shown). This indicates that SmoC and SSF
are interfering with high signaling through different mechanisms. Fu might be
a target for misregulation by SmoC as Class II fu alleles
affect both CiR production and high responses
(Lefers et al., 2001
).
Co-expression of Fu with SmoC rescued high responses, the
L3/4 narrowing, but enhanced low responses, the ectopic venation and costal
overgrowth (Fig. 7J). Thus, Fu
is unlikely to be the primary target through which SmoC exerts its
effects. Finally, co-expression of Smo effectively suppressed both
the ectopic venation and L3/4 narrowing of SmoC, while 50% reduction
of smo (in smo3 heterozygotes) enhanced both
SmoC activities (not shown). These data suggest that SmoC
constitutively drives Smo into a state that inactivates Cos, thereby
permitting activation of low Hh responses. As cos mutants are
constitutively in the low state, whereas excess cos+
restores the OFF state to Smo and FFS
(Fig. 7M-N), it follows that
normal low signaling results from inactivation of Cos by Smo.
| DISCUSSION |
|---|
|
|
|---|
Three states of Smoothened signaling may dictate three states of the
Ci regulatory complex
We have identified two mutant forms of Smo that regulate downstream
signaling through different activities. These mutant forms of Smo mimic
phenotypes of mutants in other components of the Hh pathway, as well as normal
responses to different levels of Hh
(Mullor and Guerrero, 2000
;
Wang and Holmgren, 2000
).
These data suggest a model where Smo can adopt three distinct states that
instruct three distinct states of the Ci regulatory complex
(Fig. 9). The model further
suggests that Smo regulates Ci through direct interactions between Fu, Cos and
the cytoplasmic tail of Smo. This is consistent with the failure of numerous
genetic screens to identify additional signaling intermediates, and with the
exquisite sensitivity of low signaling to Cos dosage.
|
The low state is normally found approximately five to seven cells from the
compartment border, where cells are exposed to lower levels of Hh. These cells
express Iro, moderate levels of dpp, no Col and basal levels of Ptc.
They accumulate Ci155, indicating that little CiA or CiR is made. That Ci155
can enter nuclei but is insufficient to activate high responses. The physical
state of the Ci regulatory complex in the low state has not been investigated.
Cells take on the low state regardless of Hh levels when Ci is absent
(Methot and Basler, 1999
),
when Cos is absent (Wang et al.,
2000b
) or when SmoC is expressed, and are strongly biased towards
that state in fu(classII); Su(fu) double mutants
(Methot and Basler, 2000
;
Lefers et al., 2001
). This
state normally requires input from Smo, which becomes constitutive in the
presence of SmoC. As SmoC drives only low responses and cannot activate high
responses, this identifies a low state of Smo that is distinct from both OFF
and high. We propose that the low state is normally achieved when Smo
inactivates Cos, perhaps by direct binding of Cos to Smo and dissociation of
Cos from Ci155. Neither CiR nor CiA is made efficiently, and target gene
expression is similar to that of ci null mutants.
The high state is normally found in the two or three cells immediately
adjacent to the compartment border where there are high levels of Hh. These
cells express En, Col, high levels of Ptc and moderate levels of Dpp. They
make CiA rather than CiR (Ohlmeyer and
Kalderon, 1998
), and Ci155 can enter nuclei. In this state a
cytoplasmic Ci regulatory complex consists of phosphorylated Cos,
phosphorylated Fu, Ci155 and Sufu (Therond
et al., 1996
; Robbins et al.,
1997
; Sisson et al.,
1997
; Monnier et al.,
1998
; Stegman et al.,
2000
). Dissociation of Ci from the complex may not precede nuclear
entry, as Cos, Fu, and Sufu are all detected in nuclei along with Ci155
(Methot and Basler, 2000
).
Sufu favors the low state, whereas Cos and Fu cooperate to allow the high
state by repressing Sufu, and also by a process independent of Sufu
(Methot and Basler, 2000
;
Wang et al., 2000b
;
Lefers et al., 2001
). This
high state is the universal state in ptc mutants and requires input
from Smo. As this state is specifically lost in fu mutants, Fu may be
a primary target through which Smo activates the high state. SSF specifically
interferes with the high state by a mechanism that is most sensitive to dosage
of Smo. This suggests SSF interferes with the high activity of Smo itself. We
suggest that dimeric/oligomeric Smo is necessary for the high state, and that
Smo:SSF dimers are non-productive. Cooperation between Smo cytoplasmic tails
activates Fu and thence Cos. The activities of the resulting Fu* and Cos* are
entirely different from their activities in the OFF state, and mediate
downstream effects on Sufu and Ci.
Regulation of Smo
We find that the cytoplasmic tail of Smo is sufficient to activate all Hh
responses, and that its activity is regulated through the extracellular and TM
domains. This is exemplified by the FFS chimera, which retains the full range
of Smo activities, but is regulated by Wg rather than Hh. The extracellular
and transmembrane domains act as an integrated unit to activate the
cytoplasmic tail, as all chimeras interrupting this unit failed to activate
any Hh responses, despite expression levels and subcellular localization
similar to those of active SSF or FFS. As is true of other serpentine
receptors, a global rearrangement of the TM helices is likely to expose
`active' (Cos regulatory?) sites on the cytoplasmic face of Smo. The
extracellular domain of Smo must stabilize this conformation and Ptc must
destabilize it. But how? Ptc may regulate Smo through export of a small
molecule, which inhibits Smo when presented at its extracellular face
(Chen et al., 2002
;
Taipale et al., 2002
). Hh
binding to Ptc stimulates its endocytosis and degredation, leaving Smo behind
at the cell surface (Denef et al.,
2000
; Incardona et al.,
2002
). Thus, Hh would separate the source of the inhibitor (Ptc)
from Smo, allowing Smo to adopt the low state. Transition from low to high
might require Smo hyperphosphorylation (see below). The high state, which is
likely to involve Smo oligomers, might be favored by cell surface accumulation
if aggregation begins at some threshold concentration of low Smo.
Alternatively, these biochemical changes may all be unnecessary for either the
low or high states of Smo.
There is no suggestion that Ptc has multiple states in response to
different levels of Hh. Ptc mutants that fail to derepress signaling
(Mullor and Guerrero, 2000
),
or that constitutively derepress signaling
(Johnson et al., 2000
;
Martin et al., 2001
;
Strutt et al., 2001
;
Johnson et al., 2002
)
coordinately affect both high (e.g. En) and low (e.g. Iro) responses. Thus, we
suggest that Smo and not Ptc is the first step in which the Hh pathway adopts
three distinct states.
Fz signaling
Both Hhs and Wnts act as morphogens, with different levels of ligand
dictating different intracellular responses
(Zecca et al., 1996
;
Neumann and Cohen, 1997
;
Ingham and McMahon, 2001
).
Those intracellular responses are respectively initiated by Smo and Fz. Fz and
Smo have a high degree of sequence similarity in their extracellular and
transmembrane domains (Alcedo et al.,
1996
). The similarity must extend to function, as graded levels of
Wg acting through the FFS chimera drive low and then high signaling by the Smo
cytoplasmic tail. This suggests unanticipated complexity in Fz function, where
low levels of Wnts `low-activate' Fz while higher levels trigger
oligomerization-dependent `high activation'. Fz8 CRD crystallizes as a dimer,
suggesting a physical basis for Fz family oligomerization
(Dann et al., 2001
).
Multiple signaling states for serpentine receptors
There is precedent within the serpentine receptor superfamily for
dimerization/oligomerization and for multiple signaling states.
ß2-adrenergic receptor (ß2AR), the archetypical serpentine receptor
has at least three states (reviewed by
Pitcher et al., 1998
;
Brzostowski and Kimmel, 2001
;
Pierce et al., 2002
). In the
absence of ligand, ß2AR is OFF. The agonist-occupied state favors a
global conformational change which allows the cytoplasmic loops and tail to
activate heterotrimeric G proteins as well as the receptor kinase, GRK2. GRK2
then phosphorylates the cytoplasmic tail of ß2AR. In the phosphorylated
state, ß2AR binds ß-arrestin. ß2AR + ß-arrestin1 then
assemble novel trafficking and signaling complexes which mediate endocytosis,
Src binding and ERK activation. Complementation between two inactive ß2AR
mutant forms demonstrates that adjacent molecules can exchange helices to
reconstitute a functional receptor; that is, ß2AR can homodimerize.
Moreover, a peptide derived from the sixth TM domain simultaneously blocks
dimerization and activation (Hebert et
al., 1996
). There is substantial parallel between this model of
ß2AR signaling and our model of Smo signaling. Each recruits and
activates a kinase when the receptor is stimulated. Each stimulated receptor
then becomes a substrate for assembly of a new signaling complex. We suggest
that multiple signaling states could be a general mechanism by which
serpentine receptors translate different levels and/or kinetics of ligand
exposure into distinct responses.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Alcedo, J., Ayzenzon, M., von Ohlen, T., Noll, M. and Hooper, J. E. (1996). The Drosophila smoothened gene encodes a seven-pass membrane protein, a putative receptor for the hedgehog signal. Cell 86,221 -232.[CrossRef][Medline]
Alcedo, J., Zou, Y. and Noll, M. (2000). Posttranscriptional regulation of smoothened is part of a self-correcting mechanism in the Hedgehog signaling system. Mol. Cell 6, 457-465.[CrossRef][Medline]
Alves, G., Limbourg-Bouchon, B., Tricoire, H., Brissard-Zahraoui, J., Lamour-Isnard, C. and Busson, D. (1998). Modulation of Hedgehog target gene expression by the Fused serine-threonine kinase in wing imaginal discs. Mech. Dev. 78,17 -31.[CrossRef][Medline]
Ascano, M., Jr, Nybakken, K. E., Sosinski, J., Stegman, M. A.
and Robbins, D. J. (2002). The carboxyl-terminal
domain of the protein kinase fused can function as a dominant inhibitor of
hedgehog signaling. Mol. Cell. Biol.
22,1555
-1566.
Aza-Blanc, P., Ramirez-Weber, F. A., Laget, M. P., Schwartz, C. and Kornberg, T. B. (1997). Proteolysis that is inhibited by hedgehog targets Cubitus interruptus protein to the nucleus and converts it to a repressor. Cell 89,1043 -1053.[CrossRef][Medline]
Berman, D. M., Karhadkar, S. S., Hallahan, A. R., Pritchard, J.
I., Eberhart, C. G., Watkins, D. N., Chen, J. K., Cooper, M. K.,
Taipale, J., Olson, J. M. et al. (2002). Medulloblastoma
growth inhibition by hedgehog pathway blockade.
Science 297,1559
-1561.
Bhanot, P., Brink, M., Samos, C. H., Hsieh, J. C., Wang, Y., Macke, J. P., Andrew, D., Nathans, J. and Nusse, R. (1996). A new member of the frizzled family from Drosophila functions as a Wingless receptor. Nature 382,225 -230.[CrossRef][Medline]
Blair, S. S. (1992). Engrailed expression in the anterior lineage compartment of the developing wing blade of Drosophila. Development 115,21 -33.[Abstract]
Brand, A. H. and Perrimon, N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118,401 -415.[Abstract]