|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 24 September 2003
doi: 10.1242/dev.00759
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mount Sinai School of Medicine, Brookdale Department of Molecular, Cell and Developmental Biology, 1 Gustave L. Levy Place, New York, NY 10029, USA
* Author for correspondence (e-mail: marek.mlodzik{at}mssm.edu)
Accepted 29 July 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Canoe/AF6, Egfr, Ommatidial rotation, Planar cell polarity (PCP), roulette (rlt), Argos, Flamingo
| Introduction |
|---|
|
|
|---|
During this process each ommatidium rotates 90° towards the equator and
thus in opposite directions in the dorsal and ventral halves. This
morphogenetic event is remarkable, as it requires groups of cells to undergo a
coordinated precise movement: cells of each ommatidial precluster stick
together and move as a unit with respect to the surrounding epithelial cells
(Mlodzik, 1999
;
Reifegerste and Moses, 1999
).
The rotation of ommatidial preclusters is initiated in the third instar eye
imaginal disc, shortly after the Fz/PCP-Notch signaling interplay specifies
cell fate, and is visibly appreciated around column 6 posterior to the
morphogenetic furrow (see Fig.
1A-C). It is completed by column 15-18 approximately 20-24 hours
later. During this process, the rotation angles of individual ommatidia can be
visualized with markers that highlight either the R3/R4 precursor pair or the
R1/R6 pair. Interestingly, ommatidial rotation appears to be a two-step
process as clusters stop for 3-4 columns after undergoing the first 45°
rotation and before initiating the second 45° to complete the 90°
rotation. In the adult eye the rotation is represented in the precise mirror
image arrangement of the two chiral ommatidial forms that face each other on
opposite sites of the equator (see Fig.
1D,E).
|
The requirement of rok in ommatidial rotation provides the only
link to the Fz/PCP pathway as Rho-kinase acts downstream of RhoA in several
cellular contexts. Particularly in the Drosophila wing, rok
has been shown to act downstream of Fz/Dishevelled and RhoA in PCP
establishment, affecting wing hair number (2-3 cell) but not their orientation
(Winter et al., 2001
).
rok has been reported to affect rotation (and photoreceptor number),
but not the R3/R4 cell fate decision (which is equivalent to wing hair
orientation). This might suggest that some aspects of wing hair growth and
rotation are shared through similar regulatory input into cytoskeletal
regulation.
The nmo gene encodes a distant member of the Map kinase family,
and in nmo mutants most ommatidia arrest at a rotation angle of
approximately 45°, failing to execute the second 45° turn
(Choi and Benzer, 1994
). In
sca, mutant clusters generally rotate more than 90°
(Chou and Chien, 2002
). In
contrast, rlt mutant ommatidia rotate both less and more than the
normal 90° (approximately 50% each) (see
Fig. 1F), suggesting a general
regulatory role in this process. The observation that nmo is
epistatic to rlt and that nmo, rlt double mutants show the
nmo phenotype (with ommatidia arresting at around 45°), lead to
the hypothesis that rlt is required to stop rotation
(Choi and Benzer, 1994
).
Here we show that rlt is a rotation-specific allele of the
Egfr-inhibitory ligand Argos. Both reduction and increase in Egfr signaling
lead to defects in ommatidial rotation, suggesting that Egfr signaling is
generally required to regulate this process. Using a combination of mutant
analysis, genetic interactions and specific Ras-effector loop mutations we
have identified both the Raf/MAPK cascade and the novel Ras effector Canoe/AF6
as a mediator of Egfr/Ras signaling in this process
(Kuriyama et al., 1996
). Our
data indicate that Canoe/AF6 provides a link from Egfr to cytoskeletal
elements in this developmentally regulated cell motility process. Furthermore,
we provide evidence that Egfr signaling acts on cell adhesion via effects
through the cadherin Flamingo, thus providing a link between Egfr and the PCP
genes.
| Materials and methods |
|---|
|
|
|---|
7
flies (Freeman et al., 1992
The Egfr alleles top1 and EgfrEC20
(Clifford and Schupbach, 1989
),
as well as the S48-5 allele and
UAS-
-top
(Queenan et al., 1997
) were
kindly provided by T. Schupbach. UAS-PI3K and Dp110A flies
were from Sally Leevers (Leevers et al.,
1996
). The GMR-RalG23V flies are as published
(Sawamoto et al., 1999
). The
cnoMis1 allele
(Miyamoto et al., 1995
) was
provided by D. Yamamoto. UAS-cno, cno2, cno3
(Matsuo et al., 1997
) and the
UAS-RasV12 isoforms (Karim and Rubin,
1998
) were kindly provided by U. Gaul. The signaling specificity
of the RasV12 effector loop isoforms was confirmed in Drosophila
(Karim and Rubin, 1998
;
Prober and Edgar, 2002
).
Embedding and sectioning of eyes was performed as described (Tomlinson, 1987). Crosses were performed at 25°C (except for aosw11 at 18°C). Multiple eyes were sectioned and analyzed for each genotype.
Molecular characterization of the rlt mutation
The hypomorphic behavior of the rlt allele and the absence of any
other obvious phenotype led us to the conclusion that rlt is probably
a regulatory mutant of aos. As regulatory mutations often affect
untranslated regions of a gene, whereas the protein is not altered, we
analyzed the genomic aos region in homozygous rlt flies
using overlapping PCR primers. Two of the overlapping primer sets gave PCR
products that were approximately 1 kb larger than the WT control. Sequencing
of these PCR products revealed a truncated P-element inserted in the 5'
UTR of aos within the proposed transcriptional start site at bp 55
according to the published aos sequence M91381. Primers used to
amplify the truncated P-element from genomic DNA were: 5'
CACAGACACGCACATACCG 3' and 5' CCCTCGCTCTATCGTTGTTC 3'.
Generation of the m
0.5-Gal4 construct
The m
0.5-Gal4 construct was generated by cloning a
XhoI-EcoRI m
0.5-fragment (PCR
amplified from a plasmid, kindly provided by S. Bray using primers:
5'-CCGCTCGAGTGCCATCAGATGTCAGCAAATG-3' and
5'-CGGAATTCCTTTTGGCGCACAGTCACAC-3') upstream of an
EcoRI-BamHI fragment containing the P-element
minimal-promoter (PCR amplified from pCasper 4 using the primers:
5'-CGGAATTCAAAGCCGAAGCTTACCGAAGT-3' and
5'-CGGGATCCTTTTTTTTTATTCCACGTAAGG-3').
The Gal4 gene was added as a BamHI-NotI fragment (from
pGaTB). The final construct was cloned as an Asp718-NotI fragment
from pBSSK into pCasper4. Several fly lines were established
according to standard procedures. m
0.5-Gal4 drives
expression mainly in R4 (and also weaker early in R3 and later in R7), as
confirmed by ablation experiments and expression of an UAS-GFP transgene.
Immunofluorescence
Imaginal discs were dissected, fixed and stained as described
(Freeman et al., 1992
).
Antibodies used were: rat anti-Elav (1:50), mouse anti-Boss (1:1000) (from
Developmental Studies Hybridoma Bank), rabbit anti-Bar (1:100) (a generous
gift from K. Saigo) (Higashijima et al.,
1992
), mouse anti-Fmi (1:10) (gift from Tadashi Uemura), rat
anti-DE-cadherin (DCAD2, 1:20) (gift from H. Oda)
(Oda et al., 1994
) and mouse
(Promega) or rabbit anti-ßGal (Molecular Probes) (1:2000). Images were
acquired on a Leica TCSSP (UV) confocal microscope and processed in Adobe
Photoshop.
| Results |
|---|
|
|
|---|
To confirm these results we attempted to rescue rlt with an
argos transgene. The sev-argos transgene rescues the
argos loss-of-function (LOF) eye phenotype and has no dominant effect
on eye development (Freeman,
1994
). Strikingly, sevargos completely rescued the
rlt eye phenotype to WT (Fig.
1I). These data indicated that rlt is a hypomorphic,
rotation-specific allele of aos. In addition, molecular analysis of
aosrlt revealed an insertion of a truncated P-element in
the 5' untranslated region within the proposed transcription start site
of aos (see Materials and methods for details), indicating that
rlt is most probably a regulatory mutation of aos. We will
subsequently refer to the rlt allele as
aosrlt.
rlt and argos discs exhibit rotation defects
To refine the phenotypic features of aosrlt we have
analyzed aosrlt eye imaginal discs using markers that
highlight cell-type identity and orientation of each cluster at the time when
chirality is being established and ommatidial rotation takes place
(Fig. 2 and not shown). Whereas
in WT discs a fairly regular pattern is observed with all markers
(Fig. 2A,C and not shown; see
Figure legend for markers), in aosrlt discs many clusters
reveal rotation abnormalities (Fig.
2B,D). We observe clusters that are both overrotated and
underrotated with respect to their neighbors and developmental stage
(Fig. 2B,D). Discs of the
strong aosw11 allele showed, in addition to the extra
R-cell phenotype, even more severe rotation defects
(Fig. 2E), again indicating
that aos is generally required during ommatidial rotation. Based on
the relatively regular appearance of the first svp-lacZ and
Bar-positive rows (Fig. 2B,D),
it appears that the initial 45° rotation step is less affected.
|
0.5lacZ
marker, highlighting the R4 photoreceptor, appears normal within the R3/R4
pair (not shown; see below). Thus we conclude that argos is generally
required for the process of ommatidial rotation, but has no effect on
chirality and associated R3/R4 cell-fate decisions.
Ommatidial rotation is controlled by Egfr signaling
The requirement of Argos as an inhibitory ligand of Egfr
(Jin et al., 2000
) and the
identification of argosrlt suggested that Egfr signaling
plays a critical role in ommatidial rotation. As Egfr is very
pleiotropic with multiple requirements throughout development and eye
patterning in particular (Bogdan and
Klambt, 2001
; Casci and
Freeman, 1999
; Freeman,
1997
; Schweitzer and Shilo,
1997
; Van Buskirk and
Schupbach, 1999
), it is not possible to analyze the role of
Egfr in ommatidial rotation using mitotic clones of null alleles.
However, hypomorphic alleles of Egfr allow the analysis of rotation
defects. Eyes of the Egfrtop1 allele
(Clifford and Schupbach, 1989
),
for example, are mildly rough and reveal, beside the expected photoreceptor
loss (Freeman, 1997
), many
ommatidia with rotation defects (Fig.
3A). Similarly, rotation is affected in hetero-allelic
Egfrtop1/EgfrEC20 combinations
(Fig. 3B).
|
|
88/+ background
(Fig. 4), arguing for a
requirement of the conserved Ras/MAPK/Pnt cascade in rotation downstream of
Egfr. This is further supported by the fact that aos is a direct
transcriptional target of the ETS domain transcription factor Pointed
(pnt), which is itself activated by the MAPK Rolled
(Golembo et al., 1996
|
Several point mutations have been identified within the Raseffector loop
(amino acids 34-41) that abrogate the binding to and activation by Ras of
specific effectors (Joneson et al.,
1996
; Karim and Rubin,
1998
; Rodriguez-Viciana et
al., 1997
) (see also Fig.
5). The specificity of the existing Ras-effector loop mutations
has been thoroughly tested in Drosophila imaginal discs
(Prober and Edgar, 2002
).
Prober and Edgar show that RasV12[S35], able to interact with Raf in cell
culture, can activate ERK/Rolled (via Raf) and induce Ras/Raf/ERK-specific
transcriptional responses in wing and eye imaginal discs (figures 3,7 in
Prober and Edgar) (Prober and Edgar,
2002
). In contrast, RasV12[G37], unable to bind Raf in cell
culture, cannot activate these responses, but is still capable of activating
PI3K-specific read-outs (figures 3,7 in Prober and Edgar)
(Prober and Edgar, 2002
).
Therefore we tested the Raseffector loop mutations in constitutively activated
RasV12 for their effects on ommatidial rotation.
|
0.5-Gal4 driver (see Materials and methods for
detail). RasV12 effects on photoreceptor number and fate were thus strongly
reduced. To determine the full effect of activated Ras expression under the
control m
0.5-Gal4, we expressed constitutively active
RasV12 that activates all known Ras-effectors. This gave rise to eyes with
some gain and loss of photoreceptors and severe misrotations
(Fig. 5A). The equivalent
expression of RasV12[S35], thought to activate mainly Raf, also resulted in
rotation abnormalities and occasional gain or loss of photoreceptors, again
supporting a requirement of the Raf/MAPK cascade
(Fig. 5B). Strikingly, expression of RasV12[G37] and RasV12[C40] also caused misrotations, suggesting an involvement of additional Ras-effectors in this process. In particular, RasV12[G37], in which Raf activation is abolished (or at least strongly reduced), resulted in severe rotation defects (Fig. 5C,E), suggesting that PI3K, Rgl/Ral or Canoe might play a role in this cell motility process. Similarly, RasV12[C40], eliminating Raf activation, but maintaining weaker activation of other effectors, also showed rotation abnormalities, albeit weaker than RasV12[G37] (Fig. 5D). Moreover, expression of RasV12[C40] under the control of the sevenless (sev) promoter (in R3/R4, R1/R6 and R7) resulted in strong rotation defects that were comparable to those seen with RasV12[G37] under sev control (Fig. 5E,F). Taken together, these data suggested an involvement of PI3K, Rgl/Ral or Canoe in ommatidial rotation.
Canoe is involved in ommatidial rotation
To confirm the RasV12[G37] effect and determine which of the three known
effectors activated by RasV12[G37] is required in ommatidial rotation, we
analyzed PI3K, Ral and Canoe directly. UAS-PI3K expressed under
m
0.5-Gal4 had no effect on rotation (not shown),
suggesting that PI3K is not required in this process. This is further
supported by the lack of rotation defects in dPI3K mutant clones
(Leevers et al., 1996
). In
contrast, expression of activated Ral
(Sawamoto et al., 1999
) as
well as m
0.5-Gal4>UAS-Cno exhibits
rotation defects (Fig. 6A and
not shown).
|
Effects of Egfr signaling on cell adhesion components during
ommatidial rotation
As ommatidial rotation is a cell biological event, it is probable that
among the main read-outs affected are cell-adhesion properties of the
precluster cells and effects on cytoskeletal elements. This is further
supported by our observations that (1) Raf/MAPK-independent and thus
transcription-independent Egfr/Ras signaling pathways are important, and (2)
that canoe is required in this context. To address this further, we
performed two sets of experiments. First, we tested for genetic interactions
between the dosage-sensitive Star/+ rotation
phenotype and selected factors required in cell adhesion and cytoskeletal
regulation; and second, we directly analyzed whether cell-adhesion components
such as cadherins and integrins are normally localized in
aosrlt and cnoMis1 mutant
backgrounds.
To specifically test the involvement of cytoskeletal elements and adhesion
as well as junctional components, we tested candidate genes for dominant
interaction of the mild Star rotation phenotype
(Table 1). This genetic data
argue for an involvement of DE-Cadherin/shotgun, the atypical
cadherin Flamingo (Fmi) (Usui et al.,
1999
), the adherens junction protein canoe, non-muscle
myosin II (zipper), the septin peanut, and capulet,
a protein with actin and adenylate cyclasebinding ability.
Next we examined the expression of Fmi and DE-cadherin in ommatidial preclusters during rotation. Strong LOF alleles of Egfr and its signaling components also affect cell proliferation, fate specification and survival, making the analysis of cell adhesion and junctional components in the context of rotation rather difficult. Thus we analyzed localization of the cadherins and Arm/ß-catenin in imaginal discs of the rotation-specific aosrlt allele.
Although the overall expression and localization of DECadherin and
Arm/ß-catenin are largely unaffected
(Fig.
7A,A'',B,B'',C,C'',D,D'' and not shown), the
localization of Fmi is changed in aosrlt discs
(Fig.
7A,A',B,B',G,H). In WT, Fmi is initially present
apically in all cells of the morphogenetic furrow and subsequently becomes
asymmetrically enriched in the R3/R4 precursor pair (column 4-5,
Fig. 7A,C,G)
(Das et al., 2002
). In and
posterior to column 6 Fmi is expressed at the membrane of R4, and largely
depleted from R3 membranes that do not touch R4, forming a horseshoe-like
R4-specific pattern (Fig.
7A,A',G). In contrast, in aosrlt discs
Fmi restriction to the R4 precursor is generally delayed, and often not
established even in columns 8-12, where high levels of Fmi are still seen
around the apical membrane cortex of R3 and R4
(Fig. 7B,H). As Fmi is thought
to act as a homophyllic cell-adhesion molecule
(Usui et al., 1999
), its
increased presence on R3 membranes should have a direct effect on Fmi
localization in neighboring cells and thus possibly the adhesive properties of
the precluster. It is worth noting that although Fmi is required during PCP
establishment and R3/R4 cell-fate specification, the delay in Fmi restriction
to R4 has no significant effect on the R3/R4 cell-fate decision. Although Fmi
interacts with Fz and Notch in this context, the R4-specific
m
-lacZ marker does not differ significantly from WT
(Fig. 7E,F) and adult
aosrlt eyes also display no defects in R3/R4
specification. Thus, it appears that the delay in Fmi localization
specifically affects ommatidial rotation, probably through adhesion, and
possibly explains the broad range of rotation angles in
aosrlt and other Egfr pathway mutants.
|
| Discussion |
|---|
|
|
|---|
|
An alternative interpretation of the observed Egfr rotation defects could be a general regulatory input from Egfr signaling into the process of rotation. Egfr/Ras signaling could serve as a `gas' or `brake' pedal throughout the process, thus regulating the strength of another signaling input. This is supported by the observations that ommatidia can be significantly overrotated before the end of the process, suggesting a continuous Egfr input.
Nevertheless, the phenotypes observed in third instar eye imaginal discs
suggest that the first 45° rotation is much less affected than the second
step. This indicates that Egfr signaling plays an important role in the second
45° turn, and serves a lesser role in the first rotation step (see also
Brown and Freeman, 2003
). In
summary, we suggest that if Egfr signaling is deregulated, either through a
reduction in aos or Egfr function, rotation is disturbed
during the second 45° step. We propose that the restriction of Egfr
signaling, required for correct rotation, is mediated by an autoregulatory
feedback loop via aos. In parallel, the mechanistic cell motility
aspects of rotation are probably regulated at least in part via the Ras
effector Cno.
Ommatidial rotation and cell adhesion factors
The enhancement of the rotation defects in S heterozygous eyes
through several cell adhesion molecules and cytoskeletal regulators implicates
Egfr signaling in controlling the mechanistic `cellmotility process'. Our
results, showing that expression of the cadherin Fmi is altered in
aosrlt eye discs, suggest that Egfr signaling impinges on
cell-adhesion properties of the ommatidial precluster. It is interesting to
note that in WT the expression of DE-cadherin and Fmi are almost exclusive
within the early precluster: membranes between the R8, R2 and R5 cells show
high levels of DE-cadherin, whereas the membranes of the R3/R4 precursors show
high Fmi levels (Fig.
7A,A'',B,B'',G,H). Thus the regulation of such
differences among distinct cadherin proteins might be important for normal
ommatidial rotation to occur. The input of Egfr signaling on cell adhesion is
further supported by the genetic interactions of Star with
fmi and DE-cadherin/shotgun.
These analyses of the regulation of cell adhesion molecules in the context of ommatidial rotation will help to start unravel the mechanistic aspects of rotation.
The role of Canoe in ommatidial rotation
The Egfr/Ras/Cno link is intriguing for several reasons. The cno
gene was originally identified as a mutation affecting the dorsal closure
process during embryogenesis (Jürgens, 1984;
Takahashi et al., 1998
). Cno
shows a genetic and molecular link to Ras: it contains two Ras-interacting
domains and binds both WT Ras and activated Ras-V12
(Kuriyama et al., 1996
;
Matsuo et al., 1997
). In
addition, Cno has been postulated to link cytoskeletal elements to cellular
junctions via its ability to bind actin
(Mandai et al., 1997
), its
interaction with ZO-1/Pyd and its homology with kinesin and myosin-like
domains (Takahashi et al.,
1998
). Thus Cno could directly mediate an Egfr/Ras signal to
cytoskeletal and cell architecture elements through its association with
adherens junctions and its kinesin and myosin-like domains
(Miyamoto et al., 1995
).
Interestingly, Zipper does not only show a similar interaction with
Star, like Cno (Table
1), but it is also required during embryonic dorsal closure
(Young et al., 1993
), and thus
a more general Cno-Zipper link might exist in cell motility contexts.
A second interesting feature of cno is that it has been
genetically linked to sca and Notch signaling
(Miyamoto et al., 1995
).
First, the phenotype of the sca1 allele is strongly
enhanced by cno/+. Second, cno alleles
also display Notch-like phenotypes in the wing and a GOF
Notch allele, NotchAbruptex, is suppressed by
cno (Miyamoto et al.,
1995
). Although the biochemical role of Sca remains obscure, it
has been linked to Notch, possibly as a Notch ligand, in several contexts
(Powell et al., 2001
). Thus as
sca has recently been implicated in ommatidial rotation
(Chou and Chien, 2002
), the
link between Cno and Sca/Notch is intriguing. Taken together, Cno could serve
as a factor integrating signaling input from different pathways, e.g. Egfr and
Notch in this process, and relaying this to cytoskeletal elements. The Canoe
link is also interesting from a disease point of view as its human homologue
AF6 is the critical partner of ALL1 in a chimeric protein associated with
myeloid leukemia (Prasad et al.,
1993
). Thus taken together, Cno could serve as a factor
integrating signaling input from different pathways, e.g. Egfr and Notch in
ommatidial rotation, and relaying this to the regulation of cell adhesion and
cytoskeletal elements in the context of a developmental patterning process or
disease.
Concluding remarks
We demonstrate that Egfr/Ras signaling plays a general role in the
regulation of ommatidial rotation. We further identify Canoe as an effector of
Ras in this context. Although much was known about how ommatidial chirality
and the associated R3/R4 cell-fate decision are regulated (Fz/PCP-Notch
signaling), no clear link between the mechanistic aspects of ommatidial
rotation and Fz/PCP signaling previously existed. We show a first link between
Egfr signaling and PCP genes, namely Fmi. A further connection between Egfr
signaling and PCP establishment is provided by Zipper, which acts downstream
of Fz/Dsh and Rok in wing PCP (Winter et
al., 2001
) and modifies the Star rotation phenotype. The
identification of the Egfr pathway and its regulation of Fmi/cadherin-mediated
cell adhesion will serve as an important entry point to further such
studies.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Adler, P. N. (2002). Planar signaling and morphogenesis in Drosophila. Dev. Cell 2, 525-535.[CrossRef][Medline]
Bogdan, S. and Klambt, C. (2001). Epidermal growth factor receptor signaling. Curr. Biol. 11,R292 -295.[CrossRef][Medline]
Brown, K. E. and Freeman, M. (2003). Egfr
signalling defines a protective function for ommatidial orientation in the
Drosophila eye. Development
130,5401
-5412.
Casci, T. and Freeman, M. (1999). Control of EGF receptor signalling: lessons from fruitflies. Cancer Metastasis Rev. 18,181 -201.[CrossRef][Medline]
Choi, K.-W. and Benzer, S. (1994). Rotation of photoreceptor clusters in the developing Drosophila eye requires the nemo gene. Cell 78,125 -136.[CrossRef][Medline]
Chou, Y. H. and Chien, C. T. (2002). Scabrous controls ommatidial rotation in the Drosophila compound eye. Dev. Cell 3,839 -850.[CrossRef][Medline]
Clifford, R. J. and Schupbach, T. (1989).
Coordinately and differentially mutable activities of torpedo, the
Drosophila melanogaster homolog of the vertebrate EGF receptor gene.
Genetics 123,771
-787.
Cooper, M. T. D. and Bray, S. J. (1999). Frizzled regulation of Notch signalling polarizes cell fate in the Drosophila eye. Nature 397,526 -529.[CrossRef][Medline]
Das, G., Reynolds-Kenneally, J. and Mlodzik, M. (2002). The atypical cadherin Flamingo links Frizzled and Notch signaling in planar polarity establishment in the Drosophila eye. Dev. Cell 2,655 -666.[CrossRef][Medline]
Fanto, M. and Mlodzik, M. (1999). Asymmetric Notch activation specifies photoreceptors R3 and R4 and planar polarity in the Drosophila eye. Nature 397,523 -526.[CrossRef][Medline]
Fortini, M. E., Simon, M. A. and Rubin, G. M. (1992). Signalling by the sevenless protein tyrosine kinase is mimicked by Ras1 activation. Nature 355,559 -561.[CrossRef][Medline]
Freeman, M. (1994). Misexpression of the Drosophila argos gene, a secreted regulator of cell determination. Development 120,2297 -2304.[Abstract]
Freeman, M. (1997). Cell determination strategies in the Drosophila eye. Development 124,261 -270.[Abstract]
Freeman, M., Klämbt, C., Goodman, C. S. and Rubin, G. M. (1992). The argos gene encodes a diffusible factor that regulates cell fate decisions in the Drosophila eye. Cell 69,963 -975.[CrossRef][Medline]
Golembo, M., Schweitzer, R., Freeman, M. and Shilo, B. Z. (1996). Argos transcription is induced by the Drosophila EGF receptor pathway to form an inhibitory feedback loop. Development 122,223 -230.[Abstract]
Higashijima, S., Kojima, T., Michiue, T., Ishimaru, S., Emori,
Y. and Saigo, K. (1992). Dual Bar homeo box genes of
Drosophila required in two photoreceptor cells, R1 and R6, and
primary pigment cells for normal eye development. Genes
Dev. 6,50
-60.
Jin, M. H., Sawamoto, K., Ito, M. and Okano, H.
(2000). The interaction between the Drosophila secreted
protein argos and the epidermal growth factor receptor inhibits dimerization
of the receptor and binding of secreted spitz to the receptor. Mol.
Cell Biol. 20,2098
-2107.
Joneson, T., White, M. A., Wigler, M. H. and Bar-Sagi, D. (1996). Stimulation of membrane ruffling and MAP kinase activation by distinct effectors of RAS. Science 271,810 -812.[Abstract]
Jürgens, G., Wieschaus, E., Nüsslein-Volhard, C. and Kluding, H. (1984). Mutations affecting the pattern of the larval cuticle in Drosophila melanogaster. Wilhelm Roux's Arch. Dev. Biol. 193,283 -295.[CrossRef]
Karim, F. and Rubin, G. M. (1998). Ectopic expression of activated Ras1 induces hyperplastic growth and increased cell death in Drosophila imaginal tissues. Development 125,1 -9.[Abstract]
Kolodkin, A. L., Pickup, A. T., Lin, D. M., Goodman, C. S. and Banerjee, U. (1994). Characterization of Star and its interactions with sevenless and EGF receptor during photoreceptor cell development in Drosophila. Development 120,1731 -1745.[Abstract]
Kuriyama, M., Harada, N., Kuroda, S., Yamamoto, T., Nakafuku,
M., Iwamatsu, A., Yamamoto, D., Prasad, R., Croce, C. and Canaani, E.
et al. (1996). Identification of AF-6 and canoe as putative
targets for Ras. J. Biol. Chem.
271,607
-610.
Lee, J. R., Urban, S., Garvey, C. F. and Freeman, M. (2001). Regulated intracellular ligand transport and proteolysis control EGF signal activation in Drosophila. Cell 107,161 -171.[CrossRef][Medline]
Leevers, S. J., Weinkove, D., MacDougall, L. K., Hafen, E. and Waterfield, M. D. (1996). The Drosophila phosphoinositide 3-kinase Dp110 promotes cell growth. EMBO J. 15,6584 -6594.[Medline]
Lesokhin, A. M., Yu, S. Y., Katz, J. and Baker, N. E. (1999). Several levels of EGF receptor signaling during photoreceptor specification in wild-type, Ellipse, and null mutant Drosophila. Dev. Biol. 205,129 -144.[CrossRef][Medline]
Mandai, K., Nakanishi, H., Satoh, A., Obaishi, H., Wada, M.,
Nishioka, H., Itoh, M., Mizoguchi, A., Aoki, T. and Fujimoto, T. et
al. (1997). Afadin: a novel actin filament-binding protein
with one PDZ domain localized at cadherin-based cell-to-cell adherens
junction. J. Cell Biol.
139,517
-528.
Matsuo, T., Takahashi, K., Kondo, S., Kaibuchi, K. and Yamamoto, D. (1997). Regulation of cone cell formation by Canoe and Ras in the developing Drosophila eye. Development 124,2671 -2680.[Abstract]
Miyamoto, H., Nihonmatsu, I., Kondo, S., Ueda, R., Togashi, S.,
Hirata, K., Ikegami, Y. and Yamamoto, D. (1995). canoe
encodes a novel protein containing a GLGF/DHR motif and functions with Notch
and scabrous in common developmental pathways in Drosophila. Genes
Dev. 9,612
-625.
Mlodzik, M. (1999). Planar polarity in the Drosophila eye: a multifaceted view of signaling specificity and cross-talk. EMBO J. 18,6873 -6879.[CrossRef][Medline]
Mlodzik, M. (2002). Planar cell polarization: do the same mechanisms regulate Drosophila tissue polarity and vertebrate gastrulation? Trends Genet. 18,564 -571.[CrossRef][Medline]
Oda, H., Uemura, T., Harada, Y., Iwai, Y. and Takeichi, M. (1994). A Drosophila homolog of cadherin associated with armadillo and essential for embryonic cell-cell adhesion. Dev. Biol. 165,716 -726.[CrossRef][Medline]
Powell, P. A., Wesley, C., Spencer, S. and Cagan, R. L. (2001). Scabrous complexes with Notch to mediate boundary formation. Nature 409,626 -630.[CrossRef][Medline]
Prasad, R., Gu, Y., Alder, H., Nakamura, T., Canaani, O., Saito,
H., Huebner, K., Gale, R. P., Nowell, P. C. and Kuriyama, K.
(1993). Cloning of the ALL-1 fusion partner, the AF-6 gene,
involved in acute myeloid leukemias with the t(6;11) chromosome translocation.
Cancer Res. 53,5624
-5628.
Prober, D. A. and Edgar, B. A. (2002).
Interactions between Ras1, dMyc, and dPI3K signaling in the developing
Drosophila wing. Genes Dev.
16,2286
-2299.
Queenan, A. M., Ghabrial, A. and Schupbach, T. (1997). Ectopic activation of torpedo/Egfr, a Drosophila receptor tyrosine kinase, dorsalizes both the eggshell and the embryo. Development 124,3871 -3880.[Abstract]
Reich, A. and Shilo, B. Z. (2002). Keren, a new ligand of the Drosophila epidermal growth factor receptor, undergoes two modes of cleavage. EMBO J. 21,4287 -4296.[CrossRef][Medline]
Reifegerste, R. and Moses, K. (1999). The genetics of epithelial polarity and pattern in the Drosophila retina. BioEssays 21,275 -285.[CrossRef][Medline]
Rodriguez-Viciana, P., Warne, P. H., Khwaja, A., Marte, B. M., Pappin, D., Das, P., Waterfield, M. D., Ridley, A. and Downward, J. (1997). Role of phosphoinositide 3-OH kinase in cell transformation and control of the actin cytoskeleton by Ras. Cell 89,457 -467.[CrossRef][Medline]
Sawamoto, K., Okabe, M., Tanimura, T., Mikoshiba, K., Nishida, Y. and Okano, H. (1996). The Drosophila secreted protein Argos regulates signal transduction in the Ras/MAPK pathway. Dev. Biol. 178,13 -22.[CrossRef][Medline]
Sawamoto, K., Yamada, C., Kishida, S., Hirota, Y., Taguchi, A., Kikuchi, A. and Okano, H. (1999). Ectopic expression of constitutively activated Ral GTPase inhibits cell shape changes during Drosophila eye development. Oncogene 18,1967 -1974.[CrossRef][Medline]
Schweitzer, R. and Shilo, B. Z. (1997). A thousand and one roles for the Drosophila EGF receptor. Trends Genet. 13,191 -196.[CrossRef][Medline]
Takahashi, K., Matsuo, T., Katsube, T., Ueda, R. and Yamamoto, D. (1998). Direct binding between two PDZ domain proteins Canoe and ZO-1 and their roles in regulation of the jun N-terminal kinase pathway in Drosophila morphogenesis. Mech. Dev. 78,97 -111.[CrossRef][Medline]
Tomlinson, A. and Ready, D. F. (1987). Cell fate in the Drosophila ommatidium. Dev. Biol. 123,264 -275.[Medline]
Tomlinson, A. and Struhl, G. (1999). Decoding vectorial information from a gradient: sequential roles of the receptors Frizzled and Notch in establishing planar polarity in the Drosophila eye. Development 126,5725 -5738.[Abstract]
Usui, T., Shima, Y., Shimada, Y., Hirano, S., Burgess, R. W., Schwarz, T. L., Takeichi, M. and Uemura T. (1999). Flamingo, a seven-pass transmembrane cadherin, regulates planar cell polarity under the control of Frizzled. Cell 98,585 -595.[CrossRef][Medline]
Van Buskirk, C. and Schupbach, T. (1999). Versatility in signalling: multiple responses to EGF receptor activation during Drosophila oogenesis. Trends Cell Biol. 9,1 -4.[CrossRef][Medline]
Winter, C. G., Wang, B., Ballew, A., Royou, A., Karess, R., Axelrod, J. D. and Luo, L. (2001). Drosophila Rho-associated kinase (Drok) links Frizzled-mediated planar cell polarity signaling to the actin cytoskeleton. Cell 105, 81-91.[CrossRef][Medline]
Young, P. E., Richman, A. M., Ketchum, A. S. and Kiehart, D.
P. (1993). Morphogenesis in Drosophila requires
nonmuscle myosin heavy chain function. Genes Dev.
7, 29-41.
This article has been cited by other articles:
![]() |
M. Sese, M. Corominas, H. Stocker, T. I. Heino, E. Hafen, and F. Serras The Cdi/TESK1 kinase is required for Sevenless signaling and epithelial organization in the Drosophila eye J. Cell Sci., December 15, 2006; 119(24): 5047 - 5056. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Mirkovic and M. Mlodzik Cooperative activities of Drosophila DE-Cadherin and DN-Cadherin regulate the cell motility process of ommatidial rotation Development, September 1, 2006; 133(17): 3283 - 3293. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Vrailas, D. R. Marenda, S. E. Cook, M. A. Powers, J. A. Lorenzen, L. A. Perkins, and K. Moses smoothened and thickveins regulate Moleskin/Importin 7-mediated MAP kinase signaling in the developing Drosophila eye Development, April 15, 2006; 133(8): 1485 - 1494. [Abstract] [Full Text] [PDF] |
||||
| < | |||||