|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 3 December 2003
doi: 10.1242/dev.00915
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Biological Sciences, Vanderbilt University, Nashville, TN 37235,
USA
2 Department of Anatomy and Embryology, Facultad de Veterinaria, Universidad
Complutense, 28040 Madrid, Spain
Author for correspondence (e-mail:
lilianna.solnica-krezel{at}vanderbilt.edu)
Accepted 6 October 2003
 |
SUMMARY |
|---|
 TOP SUMMARY IntroductionMaterials and methodsResultsDiscussionREFERENCES |
|---|
Key words: Convergence, Extension, Gastrulation, knypek, silberblick (wnt11), pipetail (wnt5), subduction
|
Introduction |
|---|
|
TOPSUMMARYIntroductionMaterials and methodsResultsDiscussionREFERENCES |
|---|
). The germ layers form through the internalization of
prospective mesendodermal cells beneath the ectoderm, and epiboly enlarges
their surface. Convergence and extension movements narrow the germ layers from
belly to back and lengthen them rostrocaudally. Formation of the posterior
body uses the mechanisms that shape the anterior body during gastrulation as
well as posterior-specific behaviors
(Griffith et al., 1992;
Kanki and Ho, 1997;
Schoenwolf, 1984). In
zebrafish, chick and mouse embryos, a cell aggregate (the tailbud, composed of
dorsal and ventral derived cells) contributes to the tail and posterior trunk
tissues (Hamburger and Hamilton,
1992; Hogan et al.,
1994; Kanki and Ho,
1997; Tam, 1984;
Tam, 1986). The zebrafish
tailbud forms at late gastrulation; cells originating from dorsal and ventral
gastrula regions arrive at the vegetal pole and close over the ventral yolk
plug (Fig. 1) (Kimmel et al., 1995;
Westerfield, 1995). Within the
tailbud, the cells are spatially restricted according to their gastrula
origin, such that the ventrally originating cells constitute the posterior
half, whereas the dorsal derived cells occupy the anterior tailbud
(Fig. 1) (Kanki and Ho, 1997). Cell
fates and gene expression patterns are restricted within the tailbud of chick,
frog, and zebrafish embryos, indicating that tail formation is a conserved
process that is not simply mediated by the addition of cells to the posterior
end (Beck and Slack, 1998;
Catala et al., 1995;
Gaertner, 1949;
Gont et al., 1993;
Hammerschmidt and Nüsslein-Volhard,
1993; Joly et al.,
1992; Joly et al.,
1993b; Kanki and Ho,
1997; Schoenwolf,
1977; Schulte-Merker et al.,
1992; Talbot et al.,
1995; Tucker, 1995). However, elevated cell proliferation in
dorsal medial regions might contribute to tail extension in zebrafish
(Kanki and Ho, 1997).
|
). Within
the extending tail, dorsal convergence of paraxial cells and anteroposterior
(AP) tissue extension as observed during gastrulation continues until the tail
everts (Kanki and Ho, 1997).
Concurrently, posterior tailbud cells move anteriorly and laterally (laterad
divergence) to avoid the midline (Kanki
and Ho, 1997). Posterior tailbud cells undergo subduction,
movement underneath the anterior tailbud cells, at the boundary between the
ventral-derived posterior and dorsal-derived anterior tailbud. This type of
movement is not observed in the gastrula, where the ventral and dorsal
blastopore lips do not meet (Kanki and Ho,
1997).
Several genes required for tail formation have been identified and recent
studies suggest that a combination of high levels of Bmp, canonical Wnt and
Nodal signaling activity in the ventral region of the zebrafish gastrula
specify a tail-organizer region that can induce ectopic tails upon
transplantation (Agathon et al.,
2003). Little, however, is known about how the diverse cell
movements underlying posterior body morphogenesis are regulated. Fibroblast
growth factor (Fgf) signaling is important for normal gastrulation and trunk
and tail formation, upstream of Tbx genes (which encode T-box transcription
factors) (Amaya et al., 1991;
Amaya et al., 1993;
Griffin et al., 1995;
Griffin et al., 1998;
Isaacs et al., 1994;
Isaacs et al., 1992;
Schulte-Merker and Smith,
1995). Heterozygous brachyury mutant mice and mutants in
its zebrafish homologue, no tail (ntl), exhibit tail
truncations (Chesley, 1935;
Halpern et al., 1993).
Although homozygous mutant mice have more severe caudal mesoderm and
gastrulation defects than zebrafish ntl mutants, this is probably due
to compensation by partially redundant Tbx genes that act downstream of Fgf
signaling during gastrulation and trunk development in zebrafish
(Chesley, 1935;
Griffin et al., 1995;
Griffin et al., 1998;
Halpern et al., 1993;
Wilson et al., 1995). Fgf and
Tbx are proposed to regulate cell adhesion during gastrulation, but it is not
clear which/whether tail-specific cell movements require their function
(Griffin et al., 1995;
Ho and Kane, 1990;
Isaacs et al., 1992;
Wilson et al., 1995;
Yamamoto et al., 1998).
Zebrafish Nodal-related signaling is essential for endoderm and
dorsolateral mesoderm induction. Yet elimination of Nodal signaling in
cyclops;squint compound mutants and in maternal-zygotic mutants for
the Nodal cofactor one-eyed pinhead (MZoep), permits
relatively normal posterior mesoderm formation and has relatively little
effect on tail extension (Feldman et al.,
1998; Griffin and Kimelman,
2002; Schier and Shen,
2000). The role of Nodal signaling in posterior body development
has been revealed by genetic interactions; oep cooperates with the
Tbx genes ntl and spadetail (spt) to regulate
posterior tissue specification (Griffin
and Kimelman, 2002; Schier et
al., 1997). Although Spt has also been implicated in modulating
cell adhesion and motility as a positive regulator of paraxial
protocadherin expression (Yamamoto et
al., 1998), its interaction with Zoep affects presomitic
mesoderm progenitor differentiation rather than motility
(Griffin and Kimelman, 2002).
These studies suggest that several pathways coordinate tissue specification
and morphogenesis within the posterior body.
Mutational analyses in zebrafish identified many genes regulating cell
movements and behaviors required for normal convergence and extension during
gastrulation (Hammerschmidt et al.,
1996; Solnica-Krezel et al.,
1996), including those that encode components of a non-canonical
Wnt signaling pathway (Heisenberg et al.,
2000; Kilian et al.,
2003; Topczewski et al.,
2001). Altered activity of non-canonical Wnt ligand genes
silberblick (slb)/wnt11 and pipetail
(ppt)/wnt5, results in morphogenesis defects without
affecting cell fates (Heisenberg et al.,
2000; Makita et al.,
1998; Rauch et al., 1997). Similarly, inactivation of the putative
Wnt signaling modulator glypican Knypek (Kny) impairs mediolateral (ML) cell
elongation underlying convergence and extension movements
(Topczewski et al., 2001).
Zebrafish ppt and kny but not slb mutant embryos
exhibit shorter tails, suggesting a role for these genes in tail morphogenesis
(Hammerschmidt et al., 1996;
Heisenberg et al., 2000; Rauch
et al., 1997; Solnica-Krezel et al.,
1996; Topczewski et al.,
2001).
To investigate whether non-canonical Wnt signaling regulates cell movements within the developing tail and to identify genes that it might cooperate with during this process, we generated double mutants for loss of ntl and non-canonical Wnt signaling components, slb, ppt and kny. Here, we show that ppt;ntl and kny;ntl compound mutants exhibit synergistic posterior body shortening. These defects are not due to impaired posterior mesoderm specification and patterning, nor decreased proliferation or excess apoptosis. Cell tracing during tail development reveals that both the gastrulation-like movements and tailbud unique movements are impaired in double mutants. Specifically, ntl interacts genetically with both ppt and kny to regulate convergence and extension movements within the posterior tailbud, and to promote normal subduction movements. We demonstrate that these genes co-operate to regulate specific cell movements during posterior body morphogenesis through a mechanism parallel to Fgf signaling, cad1 or known Tbx genes.
|
Materials and methods |
|---|
|
TOPSUMMARYIntroductionMaterials and methodsResultsDiscussionREFERENCES |
|---|
).
Embryos were obtained from natural spawnings and morphologically staged as
described previously (Kimmel et al.,
1995). Embryos were genotyped using linked z markers for
ntlb195, by PCR amplification followed by restriction
digest for pptta98 (primers: forward,
GATTACTGCCTGCGCAATGAAAC; reverse, GGTCTTGAACTGGTCGTACACGCGG; followed by
SacII digestion, giving 29 bp and 100 bp products for the mutant
allele), slbtz216 (primers: forward, GTGAGGCAGCGTTTGTGGTT;
reverse, CGTAGTAGCGAAGGTTATCTCCACATT; followed by MseI digestion,
giving 27 bp and 141 bp products for the mutant allele) and
knym119 (primers: forward, TCCATGTTAGGTCTCGCTGA; reverse,
CCTCAGGGCTGTAGGGTCTA; followed by EcoRV digestion, giving a 310 bp
fragment for the wild type and 230 and 80 bp fragments for the mutant
allele).
In situ hybridization
Whole mount in situ hybridization was performed according to Thisse and
Thisse (Thisse and Thisse,
1998). Embryos were photographed with a Zeiss Axiophot using
either Axiocam digital camera or a 35 mm camera.
Cell labeling/movement analysis
Photoactivation of caged fluorescein in cells at the ventral blastoderm
margin was performed as described in Myers et al.
(Myers et al., 2002a), except
that embryos were fixed at bud and six-somite stages. For tailbud uncaging,
embryos were loaded with caged dye as described by Sepich et al.
(Sepich et al., 2000) and then
posterior tailbud cells were uncaged at the bud to two-somite stages and fixed
at 20 somites. For cell transplantations, donor embryos were labeled with
Rhodamine dextran (Molecular Probes) and transplanted to unlabeled hosts at
blastula stages as described by Westerfield (Westerfield, 1996).
Cell proliferation
Embryos were fixed and stained as described previously
(Topczewski et al., 2001)
except that, in situ hybridization with digoxigenin-labeled paraxial
protocadherin (papc), detection with fast red preceded
immunohistochemistry. The primary antibody was a monoclonal mouse
anti-phosphohistone (Sigma) and the secondary antibody was a CY2 anti-mouse
IgG (Jackson Immuno). Images were acquired using the Zeiss LSM 510 laser
scanning inverted microscope.
|
Results |
|---|
|
TOPSUMMARYIntroductionMaterials and methodsResultsDiscussionREFERENCES |
|---|
;
Chesley, 1935;
Conlon and Smith, 1999;
Wilson et al., 1995). By
contrast, zebrafish null ntl mutants lack notochord and posterior
tail tissues but exhibit a milder gastrulation defect characterized by
impaired convergence but normal extension
(Amacher et al., 2002;
Glickman et al., 2003;
Griffin et al., 1995;
Griffin et al., 1998;
Halpern et al., 1993).
Therefore, other genes might compensate for loss of ntl in zebrafish
gastrula. Although zebrafish embryos harboring mutations in non-canonical Wnt
signaling components also exhibit shortened AP axes by early segmentation
stages, they form the normal number of somites (Rauch et al., 1997;
Solnica-Krezel et al., 1996).
To investigate whether ntl interacts with non-canonical Wnt signaling
we constructed ppt;ntl, kny;ntl and
slb;ntl double mutants
(Fig. 2). At 26 hours
post-fertilization (hpf), compared to the individual mutants
(Fig. 2A-E), the
slb;ntl (Fig.
2F) mutants exhibited only the combined deficiencies expected for
loss of ntl (Fig. 2E)
and slb (Fig. 2B)
function: they lacked differentiated notochord and displayed tail truncations
and variable synopthalmia and cyclopia
(Halpern et al., 1993;
Heisenberg and Nusslein-Volhard,
1997). By contrast, ppt;ntl
(Fig. 2H) and
kny;ntl (Fig.
2I) double mutants showed a synergistic phenotype, characterized
by a dramatically shortened axis and yolk extension, such that only head and
anterior trunk are clearly distinguishable. The additive slb;ntl
phenotype was not surprising, because posterior wnt11 expression has
previously been shown to require ntl
(Fig. 2J,K)
(Makita et al., 1998). By
contrast, compared to the wild type (Fig.
2L), tailbud and lateral aspects of wnt5 expression were
only slightly reduced in ntl mutants
(Fig. 2M), indicating that
posterior wnt5 expression does not absolutely require ntl.
Similarly, compared with the wild type
(Fig. 2N), kny tailbud
expression was mildly reduced in ntl
(Fig. 2O) mutants, indicating
that it does not entirely depend on ntl function. The persistence of
ppt and kny expression in ntl mutants is consistent
with these genes functioning in parallel pathways during posterior
morphogenesis.
|
). Morphological analysis of ppt(wnt5);slb(wnt11)
double mutants at 1 day post-fertilization (dpf) revealed more pronounced
shortening of the posterior body in the double mutants
(Fig. 2G), compared with single
mutants (Fig. 2B,C)
(Westfall et al., 2003).
Therefore, whereas slb(wnt11) largely compensates for
ppt(wnt5) function in more anterior parts of the gastrula
(Kilian et al., 2003), the
reverse is true in the posterior region, where ppt(wnt5) activity
suffices for normal posterior body extension in the absence of
slb(wnt11).
By the six-somite stage, wild-type (Fig.
3A), ppt (Fig.
3B), kny (Fig.
3C) and ntl (Fig.
3D) embryos were morphologically distinct from the shorter
ppt;ntl (Fig.
3E) and kny;ntl
(Fig. 3F) double mutants. At
this stage, the differences between ppt;ntl
(Fig. 3E) embryos were greater
than those between kny;ntl
(Fig. 3F) and the individual
mutants. At the 16-somite stage, wild-type
(Fig. 3G), ppt
(Fig. 3H) and kny
(Fig. 3I) somites were
separated by the midline chordamesoderm tissue. Although anterior somites were
normal in ntl (Fig.
3J), ppt;ntl
(Fig. 3K) and
kny;ntl (Fig.
3L), the caudal somites were medially fused as previously reported
for ntl (Halpern et al.,
1993). In the wild type (Fig.
3G) and ppt (Fig.
3H) and ntl (Fig.
3J) individual mutants, caudal tissues extended beyond the
posterior limit of the yolk tube extension, whereas posterior tissue ended
abruptly in ppt;ntl embryos (Fig.
3K). Although the yolk tube had not extended in both kny
(Fig. 3I) and kny;ntl
(Fig. 3L) mutant embryos, the
double mutants exhibited a shorter axis.
|
). In wild-type (Fig.
4A), ppt (Fig.
4C) and kny (Fig.
4D) embryos, the stripes were separated in the posterior tailbud
region. By contrast, the gta2 stripes were less well separated in
ntl (Fig. 4B) and were
fused caudally to form a horseshoe-shaped domain in ppt;ntl
(Fig. 4E) and
kny;ntl (Fig.
4F) embryos. The expression of pax2.1 in the optic
stalks, otic vesicles and midbrainhindbrain boundary (MHB)
(Krauss et al., 1991) was
normal in all individual and double mutant embryos. However, pronephric duct
expression extended more caudomedially in ntl, ppt;ntl and
kny;ntl double mutants, and, like gta1 and gta2
expression, it surrounded the tailbud (data not shown). Double mutant embryos
lacked myoD expression in posterior adaxial cells and displayed
broader somites (Fig. 4A-F)
(Hammerschmidt et al., 1996;
Solnica-Krezel et al., 1996;
Topczewski et al., 2001;
Weinberg et al., 1996).
|
;
Griffin et al., 1998).
Therefore, we examined spt expression in double mutant clutches
(Fig. 4G-L). Compared with the
wild-type (Fig. 4G),
ppt (Fig. 4I) and
kny (Fig. 4J) embryos
exhibited broader spt expression domains, consistent with their
respective convergence and extension defects. Expression of spt was
weaker in the double mutants (Fig.
4K,L) than in ntl
(Fig. 4H) single mutants,
suggesting that reduced spt might contribute to their posterior
shortening. However, because ppt;ntl and kny;ntl mutants do
not phenocopy spt;ntl double mutants and spt expression is
not abolished in ppt;ntl and kny;ntl, the phenotypic
differences between these double mutant classes probably reflect distinct
underlying mechanisms.
Mutation of the zebrafish caudal (cad1) homeobox gene
results in a shortened trunk and loss of the tail
(Golling et al., 2002),
prompting us to investigate whether Tbx and Wnt proteins interact to regulate
cad1 expression. Zebrafish cad1 was expressed in the
neuroectoderm and mesoderm of the caudal mass in wild-type
(Fig. 4M), ppt
(Fig. 4O) and kny
(Fig. 4P) embryos during
segmentation stages (Joly et al.,
1992). Expression of cad1 was reduced in the mesoderm of
ntl (Fig. 4N) embryos
and was similarly reduced in the caudal mass of ppt;ntl
(Fig. 4Q) and kny;ntl
(Fig. 4R) mutants. Therefore,
Ntl and non-canonical Wnt components interact to mediate posterior development
via a mechanism that does not involve regulation of cad1
expression.
Murine T and zebrafish ntl mutants exhibit excess neuronal markers
in the posterior body (Nguyen et al.,
2000). We detected an increase relative to the wild type of
isl1 neural marker expression in ppt;ntl and
kny;ntl mutants that was comparable to that observed in single
ntl mutants (Fig.
4S-X). We concluded that ntl and non-canonical Wnt
components do not co-operate to limit neural cell fates in the posterior body.
Together, these expression data indicate that gross AP patterning of the
embryo is intact in the double mutants. Furthermore, the persistence of
posterior mesodermal and neuroectodermal markers indicates that defective
specification or maintenance of posterior tissues does not underlie the
compound mutant phenotypes.
Tailbud expression of bmp4 but not Fgf genes requires both Ntl and non-canonical Wnt signaling
Fgf signaling is important for mesoderm induction and patterning,
gastrulation movements, and maintenance of Tbx gene expression through a
mutually dependent feedback mechanism
(Gerhart, 1989;
Griffin et al., 1995;
Isaacs et al., 1992;
Kimelman and Kirschner, 1987;
Slack et al., 1987;
Smith et al., 1991).
Furthermore, dominant negative Fgf receptor overexpression results in more
severe defects than observed for ntl mutants, including loss of trunk
and tail in Xenopus (Amaya et al.,
1991) and zebrafish (Griffin
et al., 1995). However, inactivation of the zebrafish
acerebellar (ace)/fgf8 gene does not produce
posterior body deficiencies, possibly owing to overlapping and redundant Fgf
genes (Reifers et al., 1998).
Thus, the ppt;ntl and kny;ntl posterior defects might be a
consequence of further impairment of Fgf activity owing to synergistic
regulation by Ntl and non-canonical Wnts. To test this possibility, we
analysed the expression of fgf8, fgf3 and the Fgf-induced feedback
antagonist sef (Furthauer et al.,
2002; Kiefer et al.,
1996; Tsang et al.,
2002) during gastrulation and somitogenesis
(Fig. 5A-L, and data not
shown). At the 18-somite stage, fgf8 was expressed in the forebrain,
MHB, somites and tailbud (Reifers et al.,
1998) of wild-type (Fig.
5A), ppt (Fig.
5B) and kny (Fig.
5C) embryos. Despite normal fgf8 expression in all
rostral tissues and the trunk somites, its tailbud expression was reduced to a
similar degree in ntl (Fig.
5D), ppt;ntl (Fig.
5E) and kny;ntl (Fig.
5F) mutants. As for fgf8, expression of fgf3 was
similarly reduced in ntl and double mutants (data not shown). At the
16-somite stage, sef transcripts were detected in the forebrain, MHB,
somites and ectoderm and mesoderm of the caudal mass of wild-type
(Fig. 5G), ppt
(Fig. 5H) and kny
(Fig. 5I) embryos. In
ntl (Fig. 5J),
ppt;ntl (Fig. 5K) and
kny;ntl (Fig. 5L) mutants sef expression was normal in rostral tissues and somites, but
was equally reduced in the caudal mass, particularly in the ectoderm.
Together, these data suggest that ntl and non-canonical Wnt
components do not interact to regulate Fgf activity, so reduced Fgf signaling
is an unlikely cause for the posterior defects of double-mutant embryos.
|
). In
zebrafish and mice, null mutations in Bmp pathway components result in ventral
tail tissue deficiencies and patterning defects
(Connors et al., 1999;
Kishimoto et al., 1997;
Winnier et al., 1995;
Yang et al., 1999) and are
associated with decreased tail progenitor migration into the tailbud in the
zebrafish (Myers et al.,
2002a). Hence, we examined bmp4 expression at gastrula
and tailbud stages. During early gastrulation, individual and double mutants
could not be distinguished from wild-type gastrulae (data not shown). By
contrast, at the five-somite stage, bmp4 was expressed in the
anterior prechordal plate of wild-type, single- and double-mutant embryos
(Fig. 5M-R), whereas tailbud
expression was severely reduced in ntl
(Fig. 5P) embryos and was
absent in ppt;ntl (Fig.
5Q) and kny;ntl (Fig.
5R) mutants. These data indicate that ntl and
non-canonical Wnt components act together to promote bmp4 expression
in the developing tailbud, which might contribute to the synergistic double
mutant phenotype.
Cell proliferation and death cannot account for the tail extension defects in kny;ntl and ppt;ntl double mutants
During vertebrate development, Bmp signaling regulates both cell
proliferation and cell death (Ashique et
al., 2002; Hogan,
1996a; Hogan,
1996b). To investigate whether loss of bmp4 expression in
the developing tail was associated with decreased cell proliferation or
enhanced cell death in compound mutant embryos, we analysed cell proliferation
using an anti-phosphohistone antibody (pH3) that recognizes M-phase cells
(Ajiro et al., 1996;
Chadee et al., 1995;
Mahadevan et al., 1991). Given
the altered double mutant morphology, we used paraxial protocadherin
(papc) expression in presomitic mesoderm (PSM)
(Yamamoto et al., 1998) as a
landmark to ensure that equivalent cell populations were evaluated. We
determined the incidence of pH3-positive cells within the paraxial mesoderm
adjacent to the notochord, previously shown to exhibit the highest mitotic
indices during zebrafish tailbud development
(Fig. 6A)
(Kanki and Ho, 1997). At the
five-somite stage, the papc expression domain included the forming
somites, adaxial cells and undifferentiated paraxial mesoderm in wild-type
(Fig. 6B), ppt
(Fig. 6C) and kny
(Fig. 6D) embryos, but was
broader mediolaterally and shortened anteroposteriorly in ppt and
kny, as expected for their convergence and extension defects
(Topczewski et al., 2001;
Rauch et al., 1997). In ntl mutants, papc expression was
weaker in paraxial mesoderm and absent in adaxial cells
(Fig. 6E)
(Odenthal et al., 1996). In
ppt;ntl (Fig. 6F) and
kny;ntl (Fig. 6G)
embryos, papc expression was altered as predicted for the combined
individual mutant phenotypes. The mitotic indices (MIs) for wild-type (MI=4.9;
n=13 embryos; 5568 cells), ppt (MI=4.0; n=6
embryos; 2875 cells; p >0.3), ppt;ntl (MI=4.1; n=4
embryos; 1706 cells; P>0.1), ntl (MI=4.1; n=5
embryos; 2366 cells; P>0.1), kny (MI=4.5; n=7
embryos; 2737 cells; P>0.5) and kny;ntl (MI=3.5;
n=5 embryos; 2262 cells; P>0.1) embryos were not
significantly different. Furthermore; the MI for double mutants did not
statistically differ from the individual mutants (ppt vs ppt;ntl,
P>0.8; kny vs kny;ntl, P>0.2; ntl vs
ppt;ntl, P>0.9; ntl vs kny;ntl, P>0.3);
therefore, reduced cell proliferation in the paraxial mesoderm cannot account
for the severe tail extension defects in compound mutants.
|
) (data not shown). Compared with the wild type and individual
mutants, ppt;ntl and kny;ntl embryos did
not exhibit increased cell death in the tail region during early tail
formation (data not shown). By contrast, increased cell death was observed in
ntl and double mutants at the 22-somite stage (data not shown), when
apoptosis of the tail was morphologically apparent in ntl and double
mutants. However, this was well after the double-mutant tail extension defects
were morphologically manifested (Fig.
3). Therefore, increased cell death probably does not underlie the
early tail extension defects, although it contributes to later truncation of
the tail.
Impaired movements of posterior tailbud cells underlie defective tail extension
Tailbud formation is initiated when blastoderm margin cells arrive at the
ventral yolk plug forming the `core' of cells that will mostly contribute to
the posterior body (Kimmel et al.,
1995; Westerfield,
1995). Fate mapping studies in the zebrafish have shown that
posterior tailbud cells are ventral derived
(Kanki and Ho, 1997;
Kimmel and Law, 1985;
Myers et al., 2002a;
Warga and Nüsslein-Volhard,
1998). One possible explanation for the posterior defects in the
double mutants is failure of progenitor cells to reach the posterior bud. To
investigate whether double mutants enter tail extension stage with a deficit
in contributing cells, we labeled cells in the ventral blastoderm margin
during early gastrulation and monitored their position at bud stage and before
the tailbud extension stage (Fig.
7A) (Myers et al.,
2002a). Because gene expression analysis revealed
gta1-positive cells in posterior medial regions of the compound
mutants' tailbuds (Fig. 4E,F),
we also asked whether these ectopic cells arose because of impaired cell
movements or altered fate. In the wild type and in all mutants, the labeled
cell groups moved from the ventral blastoderm margin into the posterior
tailbud region (Fig. 7B,C).
Subsequently, during early segmentation, they became displaced laterally and
extended anteroposteriorly (Fig.
7D; n=49). By the six-somite stage, the labeled cell
groups formed an elongated array positioned laterally, overlapping with
gta1 expression. In ppt
(Fig. 7E) (n=4) and
kny (Fig. 7F)
(n=16), the labeled cells overlapped with lateral gta1
expression, but their (and gta1 cells') convergence and extension
were reduced compared with the wild type
(Fig. 7D) and the ntl
mutant (Fig. 7G) (n=9). Notably, in ppt;ntl
(Fig. 7H) (n=6) and
kny;ntl (Fig. 7I) (n=3), the labeled cells remained in the posterior bud, overlapping
the ectopic gta1 expression domain. These data indicate that the
movements that bring the posterior body precursors to the tailbud region are
normal in the double mutants. However, the movements that shift cells from the
posterior tailbud into paraxial positions and extend the posterior body are
impaired in double mutants.
|
).
Specifically, posterior tailbud cells move beneath the advancing anterior
tailbud cells (subduction) and anteriorly but laterally around them (extension
and laterad divergence, respectively)
(Kanki and Ho, 1997). To
examine these movements directly in ppt;ntl and kny;ntl
mutants, we labeled uniformly sized small cell groups within the posterior
tailbud before the tail extension phase as described previously
(Topczewski et al., 2001) and
assessed their position and extension at the 18-somite stage
(Fig. 8A). In wild-type embryos
(Fig. 8a,a';
n=32) the labeled cells were positioned beneath the ectoderm
(Fig. 8B) and lateral to the
midline (Fig. 8b) as expected
for cells that have undergone subduction and anterior laterad movements.
Similar position of labeled cells was observed in slb
(Fig. 8C, c; n=6)
mutants, and measurements revealed that AP extension of the labeled cell array
was not significantly different from the wild type (98% of wild-type
extension; P>0,42). In ppt
(Fig. 8E,e; n=5) and
kny single mutants (Fig.
8F,f; n=9) the labeled cells were found lateral to the
midline in the deep mesendoderm, but the array extension was reduced compared
to wild type (85% of wild-type extension for ppt; P<0.05;
82% of wild-type extension for kny). Whereas, in ntl embryos
(Fig. 8D,d; n=11),
labeled cells were positioned within the mesendoderm indicative of normal
subduction, their position along the midline revealed that subsequent anterior
laterad movements did not occur. Measurements indicated that extension of the
labeled cell array was not reduced compared to the wild type (97% of wild-type
length; n=6, P>0.38). These cell movement analyses,
together with morphological observations
(Fig. 2), support the notion
that the functions of ntl and slb alone are not required for
posterior body extension, but that ppt and kny are both
essential for these movements. Furthermore, these studies reveal the
requirement for ntl function in laterad divergence movements. In
ppt;ntl (Fig. 8G,g)
and kny;ntl (Fig.
8H,h), although some labeled cells were found within mesendoderm,
others remained within the epiblast, indicating that subduction movements were
impaired. Additionally, labeled cell arrays did not extend much (47% of
wild-type length for ppt;ntl, n=5; 33% of wild-type length for
kny;ntl, n=5), nor did they move laterally. Therefore, Ntl and
non-canonical Wnt components synergistically regulate posterior tailbud
extension cell movements. In addition, they co-operate to mediate normal
subduction movements.
|
).
Alternatively, ntl mutant cells could be unable to respond to
divergence signals or to execute such a movement. To distinguish between these
possibilities, we carried out mosaic analyses. When ntl mutant cells
were transplanted into the ventral region of wild-type gastrulae, they
underwent normal subduction and, notably, also normal divergence
(Fig. 8I,i; n=4).
These results demonstrate that the divergence movement defect in ntl
mutants is non-cell-autonomous and probably occurs because of the failure of
the anterior tailbud tissue to extend posteriorly and form the posterior
midline. |
Discussion |
|---|
|
TOPSUMMARYIntroductionMaterials and methodsResultsDiscussionREFERENCES |
|---|
;
Kilian et al., 2003;
Topczewski et al., 2001).
Here, we have analysed genetic interactions between these genes to ask whether
they functionally interact during posterior body morphogenesis. The
slb;ntl compound mutants display only additive defects, without
further caudal deficiencies compared with ntl mutants. Accordingly,
late expression of wnt11 in the posterior body
(Fig. 2), but not anterior nor
early gastrula expression, depends on ntl function
(Makita et al., 1998). The
absence of tail defects in slb single mutants suggests that
additional partially overlapping signals must compensate for loss of posterior
Wnt11 during tail formation, a notion supported by the stronger phenotype
observed for slb;ppt double mutants
(Fig. 1)
(Kilian et al., 2003;
Westfall et al., 2003).
Similar to ntl mutants, ppt/wnt5 and kny single
mutants exhibit shortened tails without loss of tail tissues
(Hammerschmidt et al., 1996;
Solnica-Krezel et al., 1996).
In contrast to slb;ntl mutants, both ppt;ntl and
kny;ntl double mutants display early tail elongation defects beyond
those expected for the combined individual mutant phenotypes. Furthermore,
ppt and kny expression persist in ntl mutants.
Together, these data indicate that kny and ppt act in a
parallel pathway that cooperates with ntl during posterior body
development.
ppt;ntl and kny;ntl do not co-operate to specify posterior tissues
Genetic lesions and dominant negative interference have revealed roles for
several genes in trunk and tail formation including ntl, other Tbx
genes, papc, Fgf genes and caudal
(Amaya et al., 1991;
Chesley, 1935;
Golling et al., 2002;
Griffin et al., 1995;
Halpern et al., 1993;
Ho and Kane, 1990;
Yamamoto et al., 1998).
Because mutations in the murine brachyury gene or interference with
Fgf signaling in frog and fish result in more severe posterior defects than
those observed in zebrafish ntl mutants, redundant mechanisms have
been proposed to operate downstream of Fgf during zebrafish trunk and tail
development (Griffin et al.,
1995). Therefore, it was possible that simultaneous inactivation
of ntl and ppt or kny genes leads to synergistic
loss of Fgf activity and the severe posterior defects in double mutants.
However, we found no further reduction in expression of fgf3, fgf8 or
the Fgf feedback antagonist sef compared with individual mutants.
Based on these data, we propose that impaired Fgf activity does not account
for the synergistic double mutant defects.
Previous studies in zebrafish have demonstrated overlapping function of Tbx
genes during tail and trunk morphogenesis, with spt;ntl double
mutants displaying more severe posterior defects than either individual mutant
(Amacher et al., 2002;
Griffin et al., 1998).
Significant spt expression persists in ppt;ntl and
kny;ntl double mutants, indicating that it is not synergistically
regulated by Ntl and non-canonical Wnt components. In support of this, the
ppt;ntl and kny;ntl compound mutants do not phenocopy the
spt;ntl defects. Although spt;ntl double mutants exhibit
severe trunk and tail mesoderm deficits, ppt;ntl and kny;ntl
double mutants only have mesoderm deficiencies comparable to those observed in
ntl single mutants (Amacher et
al., 2002). Furthermore, expression of myoD in posterior
somites is absent from spt;ntl and from double mutants for the Nodal
cofactor oep and either ntl or spt
(Amacher et al., 2002;
Griffin et al., 1995;
Griffin et al., 1998;
Griffin and Kimelman, 2002;
Schier et al., 1997) but not
in ppt;ntl and kny;ntl double mutants.
The cad1 homeobox gene regulates posterior body specification in
Drosophila and vertebrates
(Golling et al., 2002;
Joly et al., 1992;
Macdonald et al., 1986;
Macdonald and Struhl, 1986;
Mlodzik et al., 1990;
Subramanian et al., 1995).
Mutational inactivation of and interference with Cad1 leads to posterior
truncations in the zebrafish and Drosophila, and to anterior homeotic
transformations in the mouse (Golling et
al., 2002; Joly et al.,
1992; Macdonald and Struhl,
1986; Subramanian et al.,
1995). However, persistent expression of cad1 in the
posterior tissues of double-mutant embryos indicates that their tail
elongation defects must occur through a cad1-independent mechanism.
Therefore, in contrast to Tbox and Nodal interactions and the cad1
gene, which promote posterior tissue specification and/or differentiation
(Amacher et al., 2002;
Griffin et al., 1998;
Griffin and Kimelman, 2002;
Schier et al., 1997), the
ppt;ntl and kny;ntl mutant phenotypes probably arise by a
distinct mechanism that involves regulation of morphogenetic processes.
How might bmp4 contribute to tail elongation?
Bmps regulate cell fate, proliferation, survival and cell movements
throughout development (reviewed in Ashique
et al., 2002; Hammerschmidt
and Mullins, 2002; Hogan,
1996a; Hogan,
1996b; Myers et al.,
2002b). Recent studies in Xenopus revealed
Notch-dependent and -independent functions for Bmp during tail outgrowth and
patterning (Beck et al., 2001).
Here, we show that bmp4 expression is lost at earlier developmental
stages in ppt;ntl and kny;ntl double mutant embryos than in
ntl individual mutants raising the possibility that the severe
posterior defects are due to the earlier loss of bmp4 activity.
According to the Xenopus model, Bmp4 signaling upstream of Notch
promotes tailbud outgrowth. However, we did not observe enhanced reduction of
notch6, notch1 or deltaC expression in double mutants
compared with ntl single mutants (data not shown), although we cannot
exclude the possibility that other notch and delta genes are
involved. Further supporting the notion that Bmp4-dependent regulation of
Notch signaling is probably not responsible for the synergistic tail
phenotypes, single and double zebrafish mutants in Notch/Delta and their
target genes exhibit segmentation and/or neurogenic phenotypes without loss of
tail (Appel et al., 1999;
Henry et al., 2002;
Itoh et al., 2003;
Oates and Ho, 2002;
van Eeden et al., 1998). In
Xenopus, Bmp signaling mediates tail somite formation by a mechanism
that does not use Notch (Beck et al.,
2001). Consistent with a role for Bmp signaling in tail mesoderm
specification, ntl and compound mutants fail to form tail somites.
However, this process does not appear to be synergistically affected in the
compound mutants. In zebrafish, Bmp signaling was proposed to mediate
posterior somite formation by ensuring proper tail progenitor movements during
gastrulation (Myers et al.,
2002a). Zebrafish mesodermal cells residing in the ventral
no-convergence no-extension zone (NCEZ), where Bmp activity levels are the
highest, do not undergo convergence and extension movements during
gastrulation. Instead, they move vegetally to occupy the posterior tailbud
(Myers et al., 2002a). In
dorsalized zebrafish mutants with diminished Bmp activity and reduced NCEZ,
the ventral cells fail to reach the tailbud, leading to tail truncations
(Connors et al., 1999;
Kishimoto et al., 1997;
Miller-Bertoglio et al., 1997;
Myers et al., 2002a). However,
during early and late gastrulation, dorsal and ventral marker expression
revealed overtly normal dorsoventral patterning in individual kny,
ppt and ntl mutants (Rauch et al., 1997;
Solnica-Krezel et al., 1996;
Topczewski et al., 2001) and
in kny;ntl and ppt;ntl compound mutants. Therefore, altered
dorsoventral patterning in the gastrula does not underlie the tail elongation
defects (data not shown). Accordingly, cell tracing experiments revealed
normal movement of ventral mesodermal cells into the posterior tailbud in
single and double mutants. Therefore, the posterior defects in double mutants
are not due to a failure of contributing progenitors to move into the
tailbud.
After the zebrafish tailbud forms, posterior Bmp signaling is promoted by
the Chordin antagonist Tolloid/Minifin (Mfn)
(Connors et al., 1999).
Mutations that disrupt the mfn gene lead to mild dorsalization, loss
of ventral tail tissues and reduction of somitic mesoderm. Despite these
patterning defects and reduction of bmp4 and eve1
expression, extension of the tail is largely normal in mfn mutants
(Connors et al., 1999).
Furthermore, a dramatic downregulation of eve1 expression in
ntl has been reported previously
(Joly et al., 1993a) and we
observed a comparable reduction of eve1 expression in
kny;ntl and ppt;ntl double mutants (data not shown). Given
normal extension of posterior body in ntl (Figs
2,
8) and mfn mutants,
downregulation of eve1 in posterior tissues of kny;ntl and
ppt;ntl double mutants during segmentation is unlikely to underlie
their morphogenetic defects. However, as neither mfn nor ntl
embryos exhibit complete loss of tailbud bmp4 expression as observed
in kny;ntl and ppt;ntl compound mutants, the specific
contribution of Bmp signaling to tail elongation will require further
investigation.
Aberrant cell proliferation and death do not account for early posterior body shortening
Given that Bmp regulates cell proliferation and survival
(Ashique et al., 2002), loss of
bmp4 expression in ppt;ntl and kny;ntl mutants
could lead to elevated cell death or reduced cell proliferation during tail
elongation. In either case, double-mutant embryos would have fewer cells
contributing to the posterior body. Our findings do not support this
hypothesis. Rather, we found comparable levels of cell proliferation and death
between compound and individual mutants before and during tail extension
stages. Increased cell death occurred well after the double-mutant phenotype
was manifest morphologically. At this time, cell death is visible in
ntl and in compound mutants, and probably leads to the subsequent
truncation and/or loss of posterior tissues. In support of this,
Xenopus embryos with perturbed brachyury function and
brachyury mouse mutants only exhibit apoptosis in posterior tissues
after gastrulation defects are apparent
(Chesley, 1935;
Conlon and Smith, 1999;
Yanagisawa et al., 1981). This
increase in programmed cell death was proposed to be an indirect consequence
of altered adhesion as reported for epithelial cells that occupy an
inappropriate location (Conlon and Smith,
1999; Khwaja et al.,
1997). Our cell labeling analysis supports this notion because
ventral-derived posterior tailbud cells occupy the midline region, from which
they are normally excluded (Kanki and Ho,
1997).
Convergence and extension genes interact with ntl to regulate tail-forming movements
Zebrafish tailbud morphogenesis entails regionalized cell movements
(Kanki and Ho, 1997).
Throughout the anterior and posterior tailbud, cells continue to undergo
convergence and extension movements as observed during gastrulation until the
tail eversion stage (Fig. 9)
(Kanki and Ho, 1997). We link
ntl with ppt and kny genes to the gastrulation-like
convergence and extension movements within the tailbud. Between tailbud
formation and the onset of tail extension, convergence and extension movements
within the tailbud are normal in ntl mutants and impaired in single
kny and ppt mutants, whereas double mutants have most severe
tail convergence defects (Fig.
9). Tail convergence defects were apparent by broader gene
expression domains before the onset of the tailbud extension stages.
Therefore, ntl co-operates with ppt/wnt5 and
kny/gpc4/6, possibly by regulating wnt11, to mediate the
gastrulation-like convergence and extension movements throughout the
tailbud.
|
). The
posterior tailbud cell groups also diverge from the midline via laterad
movement and extend anteroposteriorly (Fig.
9) (Kanki and Ho,
1997). In ntl single mutants, cells enter the mesendoderm
but do not exhibit laterad movements even though the array extends normally
(Fig. 9). Similarly, normal
extension of dorsal mesoderm despite impaired convergence was observed in
ntl gastrulae, but was attributed to epibolic movements
(Glickman et al., 2003).
Recent studies in Xenopus show that Xbra/ntl function
promotes convergence and extension while inhibiting cell migration; therefore,
it is possible that increased migration in the dorsal mesoderm of zebrafish
ntl mutants contributes to its extension
(Kwan and Kirschner, 2003).
The cell behaviors driving extension of posterior tissues remain to be
characterized.
In mosaic mouse embryos, brachyury mutant cells accumulate along
the length of the primitive streak but are largely absent from the lateral
paraxial mesoderm, a defect that has been associated with altered adhesion
(Wilson and Beddington, 1997;
Wilson et al., 1995). In the
mouse, restoring Ntl activity in the streak is sufficient for cells to move
into paraxial regions. Likewise, we found that ntl mutant cells in a
wild-type host can undergo normal laterad divergence movements. Thus, the
requirement for Ntl activity to promote lateral movement into paraxial
mesoderm might be conserved between mouse and zebrafish
(Wilson and Beddington, 1997).
We hypothesize that the posterior tailbud cells upon subduction encounter the
midline tissues extending from the anterior tailbud
(Kanki and Ho, 1997), which
serve as a barrier for their migration, resulting in the laterad divergence of
their movement. It will be important to test whether a simple mechanical
barrier or/and repulsive signals are involved. During tailbud extension
stages, ntl and non-canonical Wnt signaling interact to regulate
convergence and extension and tailbud unique movements. Cell labeling revealed
a synergistic function between ntl and ppt, and between
ntl and kny in facilitating posterior tailbud cell
movements. In ppt;ntl and kny;ntl compound mutants,
posterior tailbud cells fail to move from the posterior bud, fail to extend
and exhibit impaired subduction movements
(Fig. 9). We suggest that the
tail extension defects in double-mutant embryos are due to the combined loss
of ntl and parallel, partially overlapping non-canonical Wnt
signaling inputs, which synergistically regulate posterior-specific cell
movements but not posterior specification during tail morphogenesis. Moreover,
genes required for cell movements in the gastrula interact to regulate cell
movements within the developing posterior body, supporting the notion that
tail formation is in part a continuation of mechanisms mediating
gastrulation.
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
