|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 21 April 2004
doi: 10.1242/dev.01110
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Genetics Unit, Department of Biochemistry, University of Oxford, South Parks
Road, Oxford OX1 3QU, UK
2 Wellcome Trust/Cancer Research UK Gurdon Institute, University of Cambridge,
Tennis Court Road, Cambridge CB2 1QR, UK
* Author for correspondence (e-mail: woollard{at}bioch.ox.ac.uk)
Accepted 3 February 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Caenorhabditis elegans, T-box genes, Dorsal intercalation, evenskipped
| Introduction |
|---|
|
|
|---|
All T-box proteins tested so far appear to bind to the same consensus DNA
binding site (Kispert et al.,
1995
; Muller and Herrmann,
1997
). T-box genes can be divided into several subfamilies based
on sequence comparisons, and some subfamilies are highly conserved across a
wide range of phyla from Caenorhabditis elegans to humans
(Papaioannou, 2001
). The
completed C. elegans genome sequence predicts 20 T-box genes in
C. elegans, more than in any other species analysed so far, but
functions for only two, mab-9 and mls-1, have been studied in detail
(Woollard and Hodgkin, 2000
;
Kostas and Fire, 2002
). Most
of the C. elegans T-box genes appear to be highly diverged from those
found in other species, with only four genes having obvious counterparts in
other organisms (Papaioannou,
2001
). mab-9 is a member of the Tbx20 subfamily
(Papaioannou, 2001
) and is
required for cell fate specification in the developing hindgut and for proper
motor neuron function (Woollard and
Hodgkin, 2000
; Huang et al.,
2002
). mls-1, related to the Tbx1 subfamily, is necessary
for correct muscle cell fate determination
(Kostas and Fire, 2002
). Two
other T-box genes with orthologues in other organisms, F21H11.3
(tbx-2), a member of the Tbx2 subfamily, and ZK328.6
(tbx-7), related to the ascidian gene T2
(Papaioannou, 2001
), have not
yet been characterised. Unlike other species tested so far, C.
elegans does not have a recognisable Brachyury orthologue.
We have taken a reverse genetic approach to analysing T-box gene function
in C. elegans. We used RNA interference (RNAi) to survey loss of
function phenotypes for T-box genes and found that RNAi of tbx-9
resulted in a phenotype similar to that of vab-7 mutants.
vab-7 is a homologue of the Drosophila homeobox gene
even-skipped (eve), required for posterior patterning of
muscle and hypodermal cells in C. elegans
(Ahringer, 1996
); eve
homologues also have roles in posterior development in several other species
(Brown et al., 1997
;
Joly et al., 1993
). We find
that tbx-9, vab-7 and three other T-box genes act within a regulatory
pathway important for embryonic development, with vab-7 functioning
both upstream and downstream of T-box genes to regulate posterior
patterning.
| Materials and methods |
|---|
|
|
|---|
RNAi
PCR primers, including T7 or T3 RNA polymerase promoter sites, were
designed to be specific to the gene to be silenced and to amplify typically
500-900 bp of mostly exonic sequence. dsRNA was synthesised directly from
gel-purified PCR product as previously described
(Fire et al., 1998
) and
injected into young N2 adult hermaphrodites at a concentration of
1
mg/ml. Injected worms were transferred to fresh plates 6 hours following
injection and thereafter every 10-14 hours for 3 days.
RT-PCR
One hundred mixed-stage embryos were isolated from the progeny of wild
type, tbx-8(RNAi) and tbx-9(RNAi) hermaphrodites. Total RNA
was extracted using the RNeasy® RNA extraction kit (Qiagen, Crawley, UK).
RT-PCR amplification of tbx-8, tbx-9 and ama-1 (control)
mRNA was carried out on these total RNA samples using SuperscriptTM
One-Step RT-PCR with Platinum® Taq (Invitrogen, Paisley, UK).
Gene specific RT-PCR oligos (designed to anneal to either side of an intron to
enable DNA and RNA amplification to be distinguished and to give RT-PCR
products of around 200 bp) were as follows: tbx-8 (F
cgtctt-gtcacttctgttcg, R ccctctcggaatccttggc), tbx-9 (F
agtaacggcttaccagaacc, R tggggactgtgagttgctgc), ama-1 (F
ttccaagcgccgctgcgcattgtctc, R cagaatttccagcactcgaggagcgga).
Transgenic worms
Plasmids were injected into the syncytial gonad of young adult
hermaphrodite worms at concentrations of 1-50 ng/µl as described
(Mello and Fire, 1995
).
Co-transformation markers were either rol-6 (plasmid pCes1943, gift
of Diana Janke, University of British Columbia), in which case Rol progeny
from N2 injected worms were picked and stable lines selected, or
unc-119(+) (plasmid pDP#MM016ß), in which
case non-Unc progeny from unc-119 (ed3) injected worms were selected.
Where appropriate, integrated lines were generated by X-ray mutagenesis as
described previously (Mello and Fire,
1995
). Integrated lines were outcrossed several times prior to
analysis.
GFP reporter constructs
GFP fusions were made using pPD vectors kindly supplied by the Fire Lab
(Carnegie Institute of Washington). All constructs were verified by
sequencing. To make a tbx-8::GFP fusion, a PCR fragment (oligos F
aaaactgcagaccggtttggcagctacac, R aaaactgcaggccattgatttc ctgctcaatatc)
containing the entire coding and 5' intergenic region minus the stop
codon (7.7 kb) was first inserted into pBSKS+ (Stratagene) using
PstI and then sub-cloned into pPD95.77 to make an in-frame GFP
translational fusion (plasmid pAW232). Several transgenic lines were generated
carrying this construct using 20-50 ng/µl DNA, giving very similar
expression patterns. The strain described in this report is AW27
(ouEx12[pAW232 + pCes1943]). To make a tbx-9::GFP fusion, a
PCR fragment (oligos F aaaactgcaggattcaatcaaaacgggc, R
aaaactgcaggcaccaacaatatcaatatcttc) was cloned directly into pPD95.75 using
PstI to make an in-frame translational fusion (plasmid pJA57).
Several transgenic lines were generated carrying this construct, using 1
ng/µl DNA (higher concentrations were found to be toxic). Transgenic lines
gave similar expression patterns. The strain described in this report is AW22
(unc-119 (ed3); ouEx8 [pJA57 + pDP#MM016ß]). A
vab-7::GFP reporter construct was made by cloning GFP in-frame into
the SphI site of exon 1 of the vab-7 genomic rescuing
construct pJA17 (14 kb), to generate the translational fusion construct pJA64,
which was injected at a concentration of 20-50 ng/µl. This construct gave
the same expression pattern in transgenic worms as the lacZ reporter
and in-situ hybridisations previously described
(Ahringer, 1996
). The
vab-7::GFP transgenic strain described in this report is AW23
(unc-119 (ed3); ouEx9 [pJA64 + pDP#MM016ß]). The integrated
mab-9::GFP strain (eIs34) used in this study has been
described previously (Woollard and
Hodgkin, 2000
). This was crossed into vab-7(e1562) to
give the strain AW24. The integrated pal-1::GFP strain
(ctIs33) used in this study was a gift from Lois Edgar (University of
Colorado, Boulder). The elt-2::GFP reporter strain
(wIs81[elt-2::GFP;pRF4(rol-6)]) was a gift from Joel Rothman
(University of California, Santa Barbara).
Heat-shock constructs
Two hsp-16 driven tbx-9 constructs were made. pJA50
consists of the tbx-9 full-length cDNA (XbaI-KpnI
insert from cDNA clone pYK337c3) cloned into pPD49.78 (hsp16-2
driven), and pJA52 consists of the same cDNA insert cloned into pPD49.83
(hsp16-41 driven). A transgenic line was derived containing both
hsp16::tbx-9 constructs, weEx41 [pJA50 + pJA52 + pRF4
(rol-6)]. An integrated strain was subsequently derived from this,
weIs8 (strain JA1286). A similar approach was taken to construct a
strain (JA1284, weIs6) containing an integrated copy of an
extrachromosomal array containing hsp16-2 driven (pJA49) and
hsp16-41 driven (pJA51) tbx-8 cDNAs, derived from the cDNA
clone pYK325e8. Integrated heat-shock driven tbx-8 and tbx-9
strains were then crossed into an unc-119 (ed3) background and
injected with the vab-7::GFP construct described above (pJA64)
together with unc-119(+) to give the strains AW26
(unc-119(ed3); weIs8 (hsp-16::tbx-9 + rol-6); ouEx11 [pJA64 +
pDP#MM016ß]) and AW41 (unc-119(ed3); weIs6 (hsp-16::tbx-8 + rol-6);
ouEx14 [pJA64 + pDP#MM016ß]). Non Unc, Rol progeny were selected in
each case. Adult hermaphrodite worms were subsequently heat shocked at
33°C for 45 minutes and then incubated at 20°C for 2 hours and embryos
dissected for examination.
Site-directed mutagenesis
A 4.3 kb PacI-PflMI subclone (plasmid pAW223) of the
vab-7::GFP reporter pJA64 containing the putative T-box binding sites
to be mutated was used for site-directed mutagenesis. Site B was mutated first
(see legend to Fig. 8) to
generate plasmid pAW224 using the Stratagene Quickchange kit and protocols.
Mutagenesis PCR oligos were as follows: F gtacgcctcattgatgtaatgtaaaagagatgtg R
catgcggagtaactacattacattttctctacac. Site A was subsequently mutated to
generate pAW226, in which both putative T-box binding sites were mutated. PCR
oligos were as follows: F cgagcggaaaagatgtatttgaaccttcc R gctcgccttttctaca
taaacttggaagg. The mutated PacI-PflMI fragment was then
re-inserted into the vab-7::GFP reporter construct pJA64 to generate
the plasmid pAW231, a vab-7::GFP reporter in which both putative
T-box binding sites in the vab-7 regulatory region were mutated into
sites that would not be expected to permit T-box proteins to bind
(Sinha et al., 2000
).
Transgenic lines were generated using this construct that gave similar
expression patterns. The transgenic line described in this report is AW28
(ouEx13 [pAW231 + pCes1943]).
|
| Results |
|---|
|
|
|---|
|
10%). When RNAi experiments were conducted
in the rrf-3 strain, which is more sensitive to RNAi
(Simmer et al., 2002
|
To test whether tbx-8 and tbx-9 have overlapping functions, double RNAi experiments were performed. Silencing of both genes simultaneously in N2 animals gave rise to 100% embryonic or early larval lethality (50-60% embryonic arrest, 40-50% L1 arrest, n=130), with gross morphological defects in the midbody region and posterior (Fig. 2E, Fig. 4). There was a failure of body elongation, and hatched animals had large dorsal bulges in the hypodermis (Fig. 2E). We compared phenotypes observed in double RNAi experiments with those of a tbx-8 knockout allele (ok656, a presumed null allele available from the C. elegans Knockout Consortium, Oklahoma, USA), which had been subjected to tbx-9 RNAi and found that they were identical: tbx-8(ok656); tbx-9(RNAi) animals also arrest as embryos or early larvae in similar proportions (53% embryonic arrest, 46% L1 arrest, n=220), with identical morphological defects (data not shown). This demonstrates the efficacy of silencing tbx-8 and tbx-9 simultaneously by double RNAi. tbx-8(ok656) worms, like tbx-8(RNAi) animals, have no obvious defects on their own (data not shown).
|
|
Muscle cells are also affected in tbx-8/tbx-9(RNAi)
animals. In wild-type animals, body wall muscles are present as two regular
rows on the dorsal and ventral sides of the animal and can be visualised using
hlh-1::GFP or myo-3::GFP transgenic markers. In
tbx-8/tbx-9(RNAi) embryos and hatched larvae, these rows are
not regular. Muscles are often seen out of line and rows are sometimes broken
down completely, with muscle cells being bunched together laterally
(Fig. 4B,D,F). The overall
number of muscle cells, as assessed by counting nuclei expressing the muscle
marker hlh-1::GFP at the 2-fold stage, is unchanged (wild type, 58
(n=22), tbx-8/tbx-9(RNAi), 58 (n=17)),
suggesting that this is a positioning, rather than a cell fate commitment,
defect. The earliest observable muscle-positioning defect was seen around the
400 cell stage, as dorsal hypodermal intercalation was proceeding
(Fig. 4B). We cannot exclude
the possibility, therefore, that muscle-positioning defects are caused by
abberant dorsal hypodermal morphogenesis, rather than being a cell autonomous
defect. Likewise, it is possible that some of the hypodermal defects observed
were a secondary consequence of muscle-positioning defects. However, it is
known from ablation experiments that dorsal hypodermal intercalation proceeds
normally in the absence of the underlying muscle tissue
(Heid et al., 2001
),
consistent with our view that hypodermal defects in tbx-8/tbx-9(RNAi)
embryos are unlikely to be a secondary consequence of muscle-positioning
defects. Furthermore, bulges on the surface of tbx-8/tbx-9(RNAi)
animals that survived to L1 were always correlated with gross disorganisation
of hypodermis, while some bulges did not contain muscle cells (data not
shown), suggesting that hypodermal defects were the primary cause.
Intestinal defects in tbx-8/tbx-9(RNAi) worms
tbx-8/tbx-9(RNAi) animals that survived to hatching had abnormal
gut morphology (Fig. 4G,H,J).
Using an elt-2::GFP intestinal cell marker, we examined the number
and positions of intestinal nuclei in wild-type and tbx-8/tbx-9(RNAi)
worms. We found that the number of intestinal cells was unchanged at the
1.5-fold stage (wild type, 19 (n=14), tbx-8/tbx-9(RNAi), 19
(n=22)). These cells were correctly positioned at this stage (data
not shown) but in hatched tbx-8/tbx-9(RNAi) animals intestinal cells
were mispositioned (Fig. 4J
compared with Fig. 4I). This
suggests a potential role for tbx-8 and tbx-9 in intestinal
morphogenesis, although it may be that tbx-8 and tbx-9 do
not have a direct role in intestinal cell positioning; positioning defects
during late embryogenesis could be a consequence of aberrant morphogenesis.
Likewise, it is possible that intestinal defects in tbx-8/tbx-9(RNAi)
worms are a secondary consequence of defective embryonic elongation.
Domains of expression of tbx-8 and tbx-9
The expression patterns of tbx-8 and tbx-9 GFP
translational fusions are shown in Fig.
5. tbx-8 and tbx-9 are both expressed in three
different cell types in the embryo, gut, muscle and hypodermis, in a largely
overlapping pattern. In all cases expression was found to be nuclear, as would
be expected for putative transcription factors. The earliest embryonic
expression of both tbx-8 and tbx-9 was detected in the E
lineage gut cell precursors Ea and Ep at the beginning of gastrulation
(
100 minutes after first cleavage)
(Fig. 5A,B). Expression was
seen in the direct descendents of Ea and Ep but was not obvious later in E
lineage nuclei (data not shown). Although the expression of tbx-8 and
tbx-9 in intestinal cells is consistent with a possible role for
tbx-8 and tbx-9 in gut development, it is not clear how the
early gut expression of tbx-8 and tbx-9 in gut cell
precursors relates to the intestinal defects seen in
tbx-8/tbx-9(RNAi) worms, which only become apparent later in
embryogenesis, as discussed above.
|
|
Overexpression of either tbx-8 or tbx-9 drives ectopic vab-7 expression
To see if tbx-8 and tbx-9 are sufficient for
vab-7 expression, we generated transgenic worms in which either
tbx-8 or tbx-9 expression was driven by two strong inducible
heat-shock promoters hsp16-2 and hsp-16-41, in addition to carrying a
vab-7::GFP reporter construct (see Materials and methods).
Following heat treatment, ectopic vab-7::GFP expression driven by
either TBX-8 or TBX-9 could be observed up to the 400-cell stage of
embryogenesis (Fig. 7A-D). No
ectopic vab-7 expression was seen as a result of heat treatment in
the absence of the tbx-8 or tbx-9 heat-shock constructs
(Fig. 7E-F). Therefore,
tbx-8 and tbx-9 are both necessary and sufficient for
vab-7 expression in embryos.
|
2 kb from the start of
transcription (Fig. 8A). As
these sites are good candidates for TBX8/9 binding, we engineered a
vab-7::GFP reporter construct in which both sites were mutated. We
found, however, that the posterior muscle and hypodermal expression pattern of
vab-7 was unchanged in transgenic embryos carrying the mutated
vab-7::GFP reporter (Fig.
8B,D,F). This suggests either that TBX-8 and TBX-9 do not regulate
vab-7 directly, or that TBX-8/9 do activate vab-7 directly,
but bind to alternative or additional binding sites, perhaps with a more
degenerate sequence. T-box proteins in other organisms have been found to
exhibit complex binding interactions with in-vivo target sites, often with a
high degree of redundancy (Kusch et al.,
2002
T-box mediated anterior repression of vab-7
Although posterior expression of vab-7 was unchanged by mutating
the two putative T-box binding sites, we did detect a marked difference in
vab-7 expression at the anterior of embryos carrying the mutated
reporter. Normally, no vab-7 expression is observable in the anterior
of embryos at any stage of development
(Ahringer, 1996
) (this report).
In transgenic lines carrying the mutated vab-7 reporter, however,
significant anterior vab-7 expression is reproducibly seen (77% of
embryos, n=48), at several different embryonic stages
(Fig. 8B,D,F). This raises the
possibility that there is a T-box factor in C. elegans that represses
vab-7 expression in the anterior of embryos and that this factor
normally binds directly to the T-box sites we have mutated. In order to
investigate this, we silenced each of the remaining 18 T-box genes singly by
RNAi and monitored the effect on wild-type vab-7 expression. We found
that silencing tbx-30 (Y59E9AR.3) resulted in comparable
ectopic anterior expression of vab-7::GFP
(Fig. 8C,E,G), thereby
phenocopying the effect of mutating the T-box binding sites in the
vab-7 reporter. There were no obvious morphological phenotypes
associated with silencing tbx-30. Silencing the other 17 C.
elegans T-box genes had no effect on vab-7::GFP expression (data
not shown). Thus, tbx-30 encodes a novel, anterior repressor of
vab-7. Examination of the amino acid sequences of TBX-8, TBX-9 and
TBX-30 revealed that there are highly acidic domains at the C-termini of TBX-8
and TBX-9 (data not shown), consistent with a role for these two genes in
transcriptional activation. No such activation domain is present in TBX-30,
however, as we would expect for a transcriptional repressor.
VAB-7 represses mab-9 expression in posterior cells
In a separate screen for genes that regulate the expression of the T-box
gene mab-9 (Pocock and Woollard, unpublished observations), we found
that mab-9 expression was altered in a vab-7 mutant
background. mab-9 is normally first expressed in embryos at the
1.5-fold stage in the nuclei of three cells around the presumptive rectum, B,
F and one hyp 7 nucleus (Fig.
9B) (Woollard and Hodgkin,
2000
). In a vab-7(e1562) mutant background, however, the
domain of mab-9 expression was more extensive, with three to four
extra mab-9 expressing nuclei appearing more posterior to the usual
mab-9 expressing nuclei (Fig.
9D). It is difficult to unambiguously assign these nuclei in a
vab-7 background, because of the disruption in normal cell
positioning in this mutant, but they appear to be muscle nuclei, and would
normally be expected to express vab-7. We examined mab-9
expression in tbx-8/tbx-9(RNAi) embryos and found similar ectopic
posterior expression (data not shown). This is consistent with the notion that
TBX-8 and TBX-9 are required for the expression of vab-7 in posterior
muscle cells, and that VAB-7 is required, in turn, to repress mab-9
expression in these cells.
|
| Discussion |
|---|
|
|
|---|
Role of tbx-8 and tbx-9 in embryonic hypodermal morphogenesis
Embryos lacking both tbx-8 and tbx-9 fail to complete
dorsal hypodermal intercalation, arresting as late embryos or short L1 larvae
with gross morphological defects. Consistent with this phenotype, we found
that tbx-8 and tbx-9 were both expressed at high levels in
dorsal hypodermal cells undergoing intercalation, suggesting that
tbx-8/tbx-9 are likely to be acting cell autonomously within
the dorsal hypodermis to control these rearrangements. Although no obvious
defect was seen on the ventral side of embryos during enclosure, the lateral
hypodermal (seam) cells were often mispositioned, or pinched out of line. This
may be a consequence of the dorsal intercalation defect, with the seam cells
not being held in line properly by the dorsal syncytium.
There are some known mutants in C. elegans with similar dorsal
hypodermal phenotypes, which might point to biochemical pathways in which
tbx-8 and tbx-9 are acting. For instance, die-1
(dorsal intercalation and elongation defective)
mutants also initiate, but fail to complete, dorsal intercalation
(Heid et al., 2001
).
tbx-8, tbx-9 and die-1 are all expressed within dorsal
hypodermal cells undergoing intercalation
(Heid et al., 2001
and this
report). die-1 encodes a zinc finger protein thought to act as a
transcriptional regulator, although it is not known at present what the
transcriptional targets of die-1 might be, or how this gene might be
regulated. It is also noteworthy that tbx-8/tbx-9(RNAi) animals
display other phenotypes in common with die-1 mutants. These include
lateral hypodermal cells being pinched out of line, body wall muscle cell
positioning defects and abnormalities in gut morphogenesis
(Heid et al., 2001
) (this
report). This would support the idea that tbx-8/tbx-9 and
die-1 may act in the same pathway to regulate several aspects of
embryonic morphogenesis.
Dorsal hypodermal intercalation in C. elegans has been likened to
the process of convergent extension (directed intercalation of cells towards
an axis of extension) in vertebrates
(Chin-Sang and Chisholm, 2000
).
Intriguingly, it has been reported that the T-box gene spadetail is
required in zebrafish embryos for lateral mesoderm cells to undergo the
convergent extension movements of gastrulation
(Griffin et al., 1998
;
Ho and Kane, 1990
).
Furthermore, Brachyury in Xenopus has also been shown to be
required for convergent extension movements
(Conlon et al., 1996
;
Conlon and Smith, 1999
).
Therefore, it seems that regulation of cell intercalation movements during
embryonic morphogenesis is a conserved T-box gene function. Since
spadetail and Brachyury have no obvious counterparts in
C. elegans, and tbx-8 and tbx-9 have no obvious
counterparts in vertebrates, we suggest that this may be an ancient role, with
its origin in a common ancestral gene.
TBX-8/TBX-9 mediated activation of vab-7
We have shown that: (1) tbx-8, tbx-9 and vab-7 have
overlapping expression domains in embryos in posterior muscle and hypodermal
cells; (2) vab-7 expression in embryos requires tbx-8/tbx-9
activity; and (3) overexpression of tbx-8 or tbx-9 is
sufficient to drive ectopic vab-7 expression throughout the embryo.
This suggests that tbx-8, tbx-9 and vab-7 function in a
common genetic pathway to control embryonic patterning events, with
tbx-8 and tbx-9 acting as upstream activators of
vab-7.
Posterior muscles (those derived from the C blastomere) in vab-7
mutants are disorganised. Muscle cells are often bunched together laterally or
even form rings with neighbouring rows
(Ahringer, 1996
). We found
similar defects in tbx-8/tbx-9(RNAi) animals, with muscle
cells being present in the correct number, but severely misplaced, consistent
with the notion that tbx-8 and tbx-9 are required for
vab-7 expression and subsequent patterning activity in C
blastomere-derived muscle cells. The muscle defects seen in
tbx-8/tbx-9(RNAi) animals were not confined to the
posterior, however, so it is likely that there are other muscle-specific
targets of tbx-8/tbx-9 besides vab-7. It is also
possible that some of the muscle defects seen in
tbx-8/tbx-9(RNAi) animals are a secondary consequence of the
other morphogenetic abnormalities. The bobbed tail appearance of
tbx-9(RNAi) and vab-7(e1562) animals is likely to be the
outcome of a hypodermal defect that is common to both situations. However,
tbx-8/tbx-9(RNAi) worms also have more severe hypodermal defects
during dorsal intercalation that are not seen in vab-7 mutants,
suggesting that TBX-8 and TBX-9 are likely to influence the expression of
multiple target genes involved in hypodermal cell rearrangements as
embryogenesis proceeds.
Overexpression of tbx-8 or tbx-9 from the strong,
inducible heat-shock promoter is sufficient to drive ectopic vab-7
expression throughout the embryo. The caudal orthologue
pal-1 has also been shown to be capable of driving ectopic
vab-7 expression, and, like tbx-8/tbx-9, is
required for vab-7 expression
(Ahringer, 1997
). It is
therefore of interest to consider whether tbx-8/tbx-9 act in
the same pathway as pal-1 to regulate vab-7 expression. We
have performed experiments, however, that show that tbx-8 and
tbx-9 were still expressed in pal-1(RNAi) embryos (data not
shown), albeit in a disorganised pattern, as would be expected if
pal-1 expression was silenced
(Hunter and Kenyon, 1996
).
Likewise, pal-1::GFP is still expressed in
tbx-8/tbx-9(RNAi) embryos (data not shown); therefore we
conclude that tbx-8/tbx-9 and pal-1 probably act in
separate, complementary pathways to regulate vab-7 expression.
The activation of evenskipped in posterior cells by T-box genes
has been reported in other systems, suggesting that this may be a conserved
mechanism for controlling posterior pattern formation. For example,
brachyenteron is required for eve expression in the hindgut
and anal pad primordia of Drosophila
(Kusch and Reuter, 1999
;
Singer et al., 1996
), and in
mouse, evx-1 expression has been shown to be dependent on
Brachyury in the posterior tail bud
(Rashbass et al., 1994
).
Likewise, no tail (ntl-zebrafish Brachyury) is
required for the maintenance of eve1 expression during tail extension
in zebrafish (Joly et al.,
1993
). Whether these examples of T-box gene mediated regulation of
eve genes involve direct or indirect effects remains to be seen. It
is also noteworthy that ectopic Xbra expression in Xenopus
causes marked induction of the eve homologue Xhox3
(Cunliffe and Smith, 1992
),
similar to the induction of vab-7 expression caused by tbx-8
or tbx-9 overexpression reported here. Perhaps the regulation of
eve has been taken over by tbx-8/tbx-9 in C.
elegans in the absence of a bona fide Brachyury homologue.
TBX-30 is likely to be a direct repressor of vab-7 expression in anterior cells
If tbx-8 and tbx-9 directly activate vab-7, then
this is not through the two T-box binding sites we have described, as mutating
these sites did not eliminate vab-7 expression. By contrast, we found
that mutating these T-box binding sites caused ectopic anterior expression of
vab-7, suggesting that vab-7 may be subject to direct
inhibitory regulation by another T-box gene. T-box genes have been shown to
act as either activators or inhibitors of target gene expression (reviewed by
Papaioannou, 2001
). By
silencing each of the C. elegans T-box genes in turn, we found that
tbx-30 normally repressed vab-7 expression in anterior cells
during embryogenesis. tbx-30 probably directly represses
vab-7 at the anterior, through the T-box binding sites we have
defined, as mutating these binding sites had exactly the same effect on
vab-7 expression as silencing tbx-30.
Inhibitory effects of VAB-7 on mab-9 expression
eve orthologues are known to function as transcriptional
repressors in a wide variety of situations and are thought to act by
interacting with the basal transcriptional machinery at specific promoters
(Han and Manley, 1993
;
Li and Manley, 1998
). The
VAB-7 protein contains two putative repressor domains that are also found in
other members of the eve family. There is a polyalanine stretch near
the N-terminus of VAB-7 and a region rich in proline and serine residues at
the C-terminus (Ahringer,
1996
). Alanine-rich and proline-rich regions have both been shown
to function in transcriptional repression
(Um et al., 1995
). Our data
suggest that VAB-7 acts to repress mab-9 expression in cells at the
very posterior of embryos at the 1.5-fold stage. Ectopic expression of
mab-9 is generally deleterious during development, resulting in
embryonic arrest or animals with posterior deformations
(Woollard and Hodgkin, 2000
).
It is possible, therefore, that inappropriate, ectopic expression of
mab-9 in posterior cells contributes to the abnormal posterior
phenotype of vab-7 mutant animals.
Overall, we have described a situation in which the activities of at least four different T-box genes in C. elegans (tbx-8, tbx-9, tbx-30 and mab-9) are linked by vab-7. A model for these regulatory interactions is depicted in Fig. 10. Although positive regulation of eve homeobox genes by T-box proteins has been reported in other systems, this is the first demonstration that an eve homeobox gene is also sensitive to T-box mediated repression, and that T-box genes themselves can be subject to repression by eve. The potential evolutionary association between the role of tbx-8 and tbx-9 in dorsal hypodermal intercalation in C. elegans and the role of T-box genes in convergent extension movements of cells in other organisms is a second intriguing connection. Perhaps the involvement of T-box genes in these kinds of cell rearrangements, which are an essential prelude to metazoan morphogenesis, will turn out to be widespread.
|
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Ahringer, J. (1996). Posterior patterning by
the Caenorhabditis elegans even-skipped homolog vab-7.
Genes Dev. 10,1120
-1130.
Ahringer, J. (1997). Maternal control of a zygotic patterning gene in Caenorhabditis elegans. Development 124,3865 -3869.[Abstract]
Bamshad, M., Le, T., Watkins, W. S., Dixon, M. E., Kramer, B. E., Roeder, A. D., Carey, J. C., Root, S., Schinzel, A., Van Maldergem, L. et al. (1999). The spectrum of mutations in TBX3: genotype/phenotype relationship in ulnar-mammary syndrome. Am. J. Hum. Genet. 64,1550 -1562.[CrossRef][Medline]
Basson, C. T., Huang, T., Lin, R. C., Bachinsky, D. R.,
Weremowicz, S., Vaglio, A., Bruzzone, R., Quadrelli, R., Lerone, M., Romeo, G.
et al. (1999). Different TBX5 interactions in heart
and limb defined by Holt-Oram syndrome mutations. Proc. Natl. Acad.
Sci. USA 96,2919
-2924.
Braybrook, C., Doudney, K., Marcano, A. C., Arnason, A., Bjornsson, A., Patton, M. A., Goodfellow, P. J., Moore, G. E. and Stanier, P. (2001). The T-box transcription factor gene TBX22 is mutated in X-linked cleft palate and ankyloglossia. Nat. Genet. 29,179 -183.[CrossRef][Medline]
Brown, S. J., Parrish, J. K., Beeman, R. W. and Denell, R. E. (1997). Molecular characterization and embryonic expression of the even-skipped ortholog of Tribolium castaneum. Mech. Dev. 61,165 -173.[CrossRef][Medline]
Chapman, D. L. and Papaioannou, V. E. (1998). Three neural tubes in mouse embryos with mutations in the T-box gene Tbx6. Nature 391,695 -697.[CrossRef][Medline]
Chin-Sang, I. D. and Chisholm, A. D. (2000). Form of the worm: genetics of epidermal morphogenesis in C. elegans. Trends Genet. 16,544 -551.[CrossRef][Medline]
Conlon, F. L. and Smith, J. C. (1999). Interference with brachyury function inhibits convergent extension, causes apoptosis, and reveals separate requirements in the FGF and activin signalling pathways. Dev. Biol. 213,85 -100.[CrossRef][Medline]
Conlon, F. L., Sedgwick, S. G., Weston, K. M. and Smith, J. C. (1996). Inhibition of Xbra transcription activation causes defects in mesodermal patterning and reveals autoregulation of Xbra in dorsal mesoderm. Development 122,2427 -2435.[Abstract]
Cunliffe, V. and Smith, J. C. (1992). Ectopic mesoderm formation in Xenopus embryos caused by widespread expression of a Brachyury homologue. Nature 358,427 -430.[CrossRef][Medline]
Esmaeili, B., Ross, J., Neades, C., Miller, D. M. III and Ahringer, J. (2002). The C. elegans even-skipped homologue, vab-7, specifies DB motoneurone identity and axon trajectory. Development 129,853 -862.
Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E. and Mello, C. C. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391,806 -811.[CrossRef][Medline]
Goh, P.-Y. and Bogaert, T. (1991). Positioning and maintenance of embryonic body wall muscle attachments in C. elegans requires the mup-1 gene. Development 111,667 -681.[Abstract]
Griffin, K. J., Amacher, S. L., Kimmel, C. B. and Kimelman, D. (1998). Molecular identification of spadetail: regulation of zebrafish trunk and tail mesoderm formation by T-box genes. Development 125,3379 -3388.[Abstract]
Han, K. and Manley, J. L. (1993).
Transcriptional repression by the Drosophila even-skipped protein:
definition of a minimal repression domain. Genes Dev.
7, 491-503.
Heid, P. J., Raich, W. B., Smith, R., Mohler, W. A., Simokat, K., Gendreau, S. B., Rothman, J. H. and Hardin, J. (2001). The zinc finger protein DIE-1 is required for late events during epithelial cell rearrangement in C. elegans. Dev. Biol. 236,165 -180.[CrossRef][Medline]
Herrmann, B. G. (1995). The mouse Brachyury (T) gene. Semin. Dev. Biol. 6, 385-394.
Ho, R. K. and Kane, D. A. (1990). Cell-autonomous action of zebrafish spt-1 mutation in specific mesodermal precursors. Nature 348,728 -730.[CrossRef][Medline]
Huang, X., Cheng, H. J., Tessier-Lavigne, M. and Jin, Y. (2002). MAX-1, a novel PH/MyTH4/FERM domain cytoplasmic protein implicated in netrin-mediated axon repulsion. Neuron 34,563 -576.[CrossRef][Medline]
Hunter, C. P. and Kenyon, C. (1996). Spatial and temporal controls target PAL-1 blastomere specification activity to a single blastomere lineage in C. elegans embryos. Cell 87,217 -226.[CrossRef][Medline]
Joly, J. S., Joly, C., Schulte-Merker, S., Boulekbache, H. and Condamine, H. (1993). The ventral and posterior expression of the zebrafish homeobox gene eve1 is perturbed in dorsalized and mutant embryos. Development 119,1261 -1275.[Abstract]
Kispert, A., Herrmann, B. G., Leptin, M. and Reuter, R.
(1994). Homologs of the mouse Brachyury gene are
involved in the specification of posterior terminal structures in Drosophila,
Tribolium, and Locusta. Genes Dev.
8,2137
-2150.
Kispert, A., Koschorz, B. and Herrmann, B. G. (1995). The T protein encoded by Brachyury is a tissue-specific transcription factor. EMBO J. 14,4763 -4772.[Medline]
Kofron, M., Demel, T., Xanthos, J., Lohr, J., Sun, B., Sive, H., Osada, S., Wright, C., Wylie, C. and Heasman, J. (1999). Mesoderm induction in Xenopus is a zygotic event regulated by maternal VegT via TGFbeta growth factors. Development 126,5759 -5770.[Abstract]
Kostas, S. A. and Fire, A. (2002). The T-box
factor MLS-1 acts as a molecular switch during specification of nonstriated
muscle in C. elegans. Genes Dev.
16,257
-269.
Kusch, T. and Reuter, R. (1999). Functions for Drosophila brachyenteron and forkhead in mesoderm specification and cell signalling. Development 126,3991 -4003.[Abstract]
Kusch, T., Storck, T., Walldorf, U. and Reuter, R.
(2002). Brachyury proteins regulate target genes through modular
binding sites in a cooperative fashion. Genes Dev.
16,518
-529.
Li, C. and Manley, J. L. (1998).
Even-skipped represses transcription by binding TATA binding protein
and blocking the TFIID-TATA box interaction. Mol. Cell
Biol. 18,3771
-3781.
Mello, C. and Fire, A. (1995). DNA Transformation. In Caenorhabditis elegans: Modern Biological Analysis of an Organism. Vol. 48 (ed. D. Shakes and H. Epstein), pp. 451-482. San Diego: Academic Press.
Mohler, W. A., Simske, J. S., Williams-Masson, E. M., Hardin, J. D. and White, J. G. (1998). Dynamics and ultrastructure of developmental cell fusions in the Caenorhabditis elegans hypodermis. Curr. Biol. 8,1087 -1090.[CrossRef][Medline]
Muller, C. W. and Herrmann, B. G. (1997). Crystallographic structure of the T domain-DNA complex of the Brachyury transcription factor. Nature 389,884 -888.[CrossRef][Medline]
Papaioannou, V. E. (2001). T-box genes in development: from hydra to humans. Int. Rev. Cytol. 207, 1-70.