First published online 2 June 2004
doi: 10.1242/dev.01161
Development 131, 3107-3120 (2004)
Published by The Company of Biologists 2004
Chip-mediated partnerships of the homeodomain proteins Bar and Aristaless with the LIM-HOM proteins Apterous and Lim1 regulate distal leg development
Jose Ignacio Pueyo and
Juan Pablo Couso*
School of Biological Sciences, University of Sussex, Falmer, Brighton BN1
9QG, UK
*
Author for correspondence
(j.p.couso{at}sussex.ac.uk)
Accepted 9 March 2004
 |
SUMMARY
|
|---|
Proximodistal patterning in Drosophila requires division of the
developing leg into increasingly smaller, discrete domains of gene function.
The LIM-HOM transcription factors apterous (ap) and
Lim1 (also known as dlim1), and the homeobox genes
Bar and aristaless (al) are part of the gene
battery required for the development of specific leg segments. Our genetic
results show that there are posttranslational interactions between Ap, Bar and
the LIM-domain binding protein Chip in tarsus four, and between Al, Lim1 and
Chip in the pretarsus, and that these interactions depend on the presence of
balanced amounts of such proteins. We also observe in vitro protein binding
between Bar and Chip, Bar and Ap, Lim1 and Chip, and Al and Chip. Together
with the previous evidence for interactions between Ap and Chip, these results
suggest that these transcription factors form protein complexes during leg
development. We propose that the different developmental outcomes of LIM-HOM
function are due to the precise identity and dosage of the interacting
partners present in a given cell.
Key words: LIM-HOM, Prd-HOM, Chip, Apterous, Legs, Drosophila, DLim1
 |
Introduction
|
|---|
Homeodomain (HOM) proteins play fundamental roles in development. The
common feature that characterises this protein family is the presence of a
homeodomain, which is involved mainly in DNA interactions
(Gehring et al., 1994
). Assays
of DNA-binding specificity with homeodomains of different HOM proteins have
shown that they bind to the same core target sequence. However, HOM proteins
regulate specific sets of downstream genes in vivo, suggesting that other
factors contribute to their specificity. The members of the LIM-HOM subfamily
are characterised by the presence of two tandem repeated LIM domains in the
N-terminal end of the protein followed by a homeodomain. Each LIM domain
consists of two tandem cystine-histidine-rich zinc-fingers
(Curtiss and Heilig, 1998
;
Jurata and Gill, 1998
). The
LIM domains do not seem to bind DNA, instead they are implicated in specific
protein-protein interactions (Arber and
Caroni, 1996
; Schmeichel and
Beckerle, 1994
). LIM-HOM proteins are involved in a wide variety
of developmental processes, and it has been suggested that LIM-HOM proteins
regulate specific genes by forming multiprotein transcriptional complexes with
other LIM-HOM proteins and/or other cofactors
(Dawid et al., 1998
;
Hobert and Westphal, 2000
).
The LIM-domain binding proteins (Ldb) can bind LIM domains with high affinity
and have been found in mouse (Ldb1/Nl1/Clim2), Zebrafish (Ldb4),
Xenopus (Xldb1) and Drosophila (Chip). Ldb proteins also
contain a homodimerisation domain, and can act as a bridge dimer between two
LIM proteins to form homo- and hetero-tetrameric complexes with LIM-HOM
transcription factors (Jurata et al.,
1998
).
Experiments in Drosophila have identified interactions in vivo
between Chip and the LIM-HOM protein Apterous (Ap). Apterous is required for
dorsoventral (DV) patterning and growth of the wing
(Cohen et al., 1992
). Dosage
interactions and other genetic experiments involving Chip and
ap, plus biochemical assays, have indicated that Ap function is
carried out by a tetramer complex comprising two molecules of Ap bridged by a
Chip dimer (Fernández-Fúnez
et al., 1998
; Milan and Cohen,
1999
; Morcillo et al.,
1997
; Rincon-Limas et al.,
2000
; van Meyel et al.,
1999
).
Ap function in the wing is regulated by Dlmo (Bx FlyBase; the
Drosophila homologue of LIM-only, a protein composed only of LIM
domains), which interacts with Chip with higher affinity than Ap to reduce the
formation of active Ap-Chip complexes
(Milan and Cohen, 2000
;
Shoresh et al., 1998
;
Weihe et al., 2001
;
Zeng et al., 1998
). In the
Drosophila CNS, Ap and Chip also interact physically and form
tetrameric complexes required for the proper fasciculation of the
ap-expressing interneurones. However, Ap function is regulated
differently in the CNS than in the wing. For instance, dlmo
(Bx) is not expressed in Ap neurones and the relative dosage between
Ap and Chip is not limiting for the formation of Ap-Chip complexes
(van Meyel et al., 2000
).
Furthermore, a combinatorial code between the LIM-HOM genes islet
(isl; tailup, tup FlyBase) and Lim3
controls motoneurone pathway selection in flies and vertebrates
(Thaler et al., 2002
;
Thor et al., 1999
). In
vertebrates, the combinatorial activities of Islet and Lim3 homologues are not
carried out by homo- or heterotetrameric complexes, instead they are carried
out by a single Ldb-mediated hexameric complex
(Thaler et al., 2002
).
Finally, it has been shown that Chip plays a role in other patterning
processes by binding non-LIM proteins, such as the HOM proteins Bcd and Fz,
and the GATA factor Pannier (Ramain et
al., 2000
; Torigoi et al.,
2000
). Therefore, Lbd specificity depends on the presence of
different cofactors in each developmental context.
In the leg of Drosophila, a regulatory network of LIM-HOM and
Prd-HOM (Paired-homeodomain) genes exists
(Pueyo et al., 2000
). The legs
of Drosophila are formed from groups of epithelial cells, which
segregate inside the embryo and grow during larval development, giving rise to
sac-like structures called imaginal discs. The most distal part of the leg
consists of five tarsal segments plus a pretarsus
(Fig. 1A). Distal leg
patterning first entails the establishment of the tarsal and pretarsal
primordia at 80-90 hours after egg laying (AEL)
(Galindo et al., 2002
),
followed by the subdivision of the tarsal field into smaller domains of gene
expression (Fig.
1B-B''')
(Galindo and Couso, 2000
).
These domains define each tarsal segment
(Kojima et al., 2000
;
Pueyo et al., 2000
) and a
joint is then intercalated between every segment
(Bishop et al., 1999
;
de Celis et al., 1998
;
Rauskolb, 2001
;
Rauskolb and Irvine, 1999
).
Thus at 80-90 hours AEL the presumptive distal region of the leg disc appears
divided into two domains of Prd-HOM gene expression: aristaless
(al) expression in the pretarsus and Bar expression in the
adjacent tarsal cells (Kojima et al.,
2000
). These patterns are activated by Distal-less (Dll) and a
distal gradient of Egfr-Ras signalling
(Campbell, 2002
;
Galindo et al., 2002
). From 90
hours AEL, Bar expression is maintained at high levels by
self-activation in the presumptive fifth tarsal segment, whereas in the fourth
tarsal segment lower levels of Bar are required for the expression of
ap (Fig.
1B-B'''). Consequently, a high dose of Bar
protein and a low dose of Bar plus Ap are necessary for the development of the
fifth and fourth tarsal segments, respectively. In the pretarsus, Al activates
the expression of the LIM-HOM gene Lim1 (also known as
dlim1) after 90 hours AEL, and a positive-feedback mechanism and
cooperation between them ensures pretarsal development. During this process,
mutual repression between Bar on the one hand and al plus
Lim1 on the other establishes a sharp tarsal/pretarsal boundary
(Pueyo et al., 2000
;
Tsuji et al., 2000
).

View larger version (61K):
[in this window]
[in a new window]
|
Fig. 1. The role of Chip and dlmo in leg development, and their
genetic relationships with apterous. (A) The distal region of a
wild-type prothoracic leg showing the distal part of the tibia (Tb), tarsal
segments one to five (t1-t5), and the distalmost organ, the claw, in the
pretarsus (c). (B-B''') Each segment of the distal part of
the leg is characterised by differential expression of the LIM-HOM Ap and Lim1
and the Prd-HOM Bar transcription factors. The images show a side view of an
everting leg imaginal disc. B shows the merged triple staining;
B'-B''' show the separate channels. Expression of a
Bar reporter gene in tarsus four and five is shown in green
(B'); Lim1 protein distribution in the pretarsus is shown in blue
(B''); and Ap protein distribution is shown in red
(B'''; yellow in overlap in B). (C) Wild-type leg imaginal
disc showing Chip protein distributed ubiquitously in the disc epithelium. (D)
Dlmo protein distribution in a late third instar leg imaginal disc. Specific
staining can be detected in a few cells in the peripodial membrane (arrow).
(E) Minute+ Chipe55 clones in leg. The tissue lacking
Chip is marked by its yellow (y) phenotype and is
outlined in black. Clones in the tibia, femur, coxa and pretarsus show a
phenotype similar to strong Lim1 mutants. The fourth tarsal segment
fails to develop, as in strong ap mutants. (F) Higher magnification
of the tip of the leg shown in E. The majority of the distal part of the leg
is y apart from two bristles that are
y+ (asterisks). In the pretarsus no claws develop
(arrowhead). In addition, only a remnant part of a joint is observed between
the last tarsal segments (arrow). (G) Leg of a DllGal4;UAS-Chip fly.
Only four tarsal segments develop and the claw organ is absent, similar to the
phenotype of Chip lack of function, which is shown in E. (H) Ap (red)
and Lim1 (green) protein expression are normal in a DllGal4;UAS-Chip
leg disc. The white dotted line denotes the edge of the distal domain of
expression of the DllGal4 line. (I) Leg of an
apGal4;UAS-dlmo fly (29°C). Although the LIM-only gene
(dlmo) is not expressed in the leg imaginal disc, Dlmo overexpression
produces loss of the fourth tarsal segment. (J) Co-expression of
UAS-Chip in an apGal4;UAS-dlmo genetic background rescues
the loss of the fourth tarsal segment.
|
|
In this study, we present more evidence for the existence of such a
regulatory network, and suggest a role for direct protein interactions, in
addition to transcriptional regulation, in its mechanism. Genetic interactions
and ectopic expression experiments highlight dosage relationships between Ap
and Bar, and between Al and Lim1, and posttranslational dominant-negative
interactions between these and other LIM-HOM proteins. The interactions
between Ap, Bar, Al and Lim1 involve Chip, which we show to be required for
the development of the distal leg regions. We show that protein interactions
between Bar, Ap and Chip exist, leading to the suggestion that Ap-Chip-Bar
protein complexes are the functional transcriptional units that control tarsus
four development. In the presumptive pretarsus, a similar relationship between
Lim1, Al and Chip exists. Synergistic cooperation between Al and Lim1 is
required to direct pretarsus development, and to repress Bar
expression and function. Ectopic expression of other LIM-HOM proteins in the
pretarsus disrupts this cooperation, which also depends on Chip and is
sensitive to changes in the dosage of the proteins involved. We reveal the
existence of protein interactions between Al and Chip, suggesting that the
Al-Chip-Lim1 protein complexes are the functional transcriptional units in the
pretarsus. Thus, our results suggest that, in the fly leg, just as in the
vertebrate head organiser (Nakano et al.,
2000
), LIM-HOM gene function is implemented by transcriptional
complexes involving LIM-HOM/Chip/Prd-HOM proteins. We propose that the
different developmental outcomes of LIM-HOM protein function are due to the
precise identity and dosage of the co-factors available locally.
 |
Materials and methods
|
|---|
Fly strains and genetic manipulations
Several fly strains in this paper were described by Pueyo et al.
(Pueyo et al., 2000
). Other
stocks were: UAS-Bar (Kojima et
al., 2000
); UAS-dlmo
(Zeng et al., 1998
);
hdpR26 (Milan et al.,
1998
); UAS-ap
HD,
UAS-ap
LIM and UAS-Lim3-ap
(OKeefe et al., 1998
);
UAS-Chip
LID, UAS-Chip
DD and
UAS-Chip-ap (van Meyel et al.,
1999
); and alex
(Campbell and Tomlinson,
1998
). The Gal4/UAS system was used to express genes in specific
patterns of expression. The Gal4 drivers employed were: dppGal4,
apGal4 and DllGal4. All flies and larvae were raised at 25°C
unless specified in the text. Clones of null Bar and Chip
alleles were generated by the FRT/FLP system. In the generation of
Bar clones, larvae of the genotype
Df(1)B263-20 FRT 18A/yw hsGFPw+FRT18A;
hsFLP122/+ were heatshocked at 37°C for 90 minutes at 24-48 hours
AEL,and then transferred to 25°C. Bar cells in
the adult were marked by the loss of the forked gene, which is
included in Df(1)Bar263-20. For staining of imaginal
discs, larvae (100-120 hours AEL) were heatshocked again at 37°C for 1
hour to induce GFP expression, left to recover for one hour and then
dissected. In the generation of null Chip clones, animals of the
genotype y w FLP; FRTG13 Chipe55/FRT42B y+ M(2)
(Morcillo et al., 1997
) were
heatshocked at 37°C for 90 minutes at 24-48 hours AEL. For the generation
of null Bar clones, labelled as above, but expressing the ap
transgene, males FRT18A Ubi-GFP; DllGal4; UAS-FLP/+ were crossed to
females Df(1)B263-20 FRT18A/FM7i; UAS-ap. For the control
cross, males FRT18A Ubi-GFP; DllGal4; UAS-FLP/+ were crossed to
females Df(1)B263-20 FRT18A/FM7i-GFP. The progeny were
raised at 18°C to avoid any mutant effects caused by the DllGal4
driver. A similar experiment was performed using the weaker babGal4
driver at 25°C, obtaining similar results.
GST pull-down assay
Glutathione-S-transferase (Gst)-Chip fusion constructs were generated and
kindly provided by Dale Dorset (Torigoi et
al., 2000
). Gst-Ap and Gst-ApLim fusion constructs were generated
by PCR amplification of the ap cDNA using specific primers. The same
forward primer AGAGAGGATCCATGGGCGTCTGCACCGA was used in both amplifications,
whereas the reverse primers were the Ap reverse primer
GAGAGAGAATTCTTCCTGAGCATCCGTTAGTCC and the ApLim reverse primer
GAGAGAGAATTCGCTATGCTGTAGTGGGTC. PCR products were firstly cloned using TA
cloning kit (Invitrogen). Positive clones were double digested with
XhoI/EcoRI and the appropriate DNA fragment was gel
extracted. Finally, the DNA fragment was cloned in the pGEX-2T vector
(Amersham Pharmacia). Expression of the Gst-fusion proteins and binding to
Gluthathione-agarose beads (Amersham Pharmacia) were performed as described by
Torigoi et al. (Torigoi et al.,
2000
). Fly extracts were obtained by homogenisation of 50 brain
and leg complexes from third instar larvae in dry ice, and resuspension in 150
µl of 50 mM Tris (pH 7.2), 150 mM NaCl, 2 mM EGTA, 5% Triton X-100 with
protease inhibitors (Roche). 100 µl of blocked beads with the GST-fusion
proteins were incubated with 300 µl of fly extract for 1 hour at 4°C.
After the binding reaction, beads were washed three times with blocking
solution, twice with PBT, and twice with PBS. 60 µl of 2xDS reducing
buffer/DTT were added to the beads and boiled. The samples were loaded in a
10% SDS-PAGE gel and analysed by western blot. Rabbit anti-BarH1
(Kojima et al., 2000
) and
guinea pig anti-Lim1 (Lilly et al.,
1999
) were used at a 1:5000 dilution, and Rat anti-Al
(Campbell, 2002
) was used at
1:10,000. Secondary antibodies coupled to peroxidase for rabbit and guinea pig
were obtained from Dako and Jackson ImmunoResearch. Finally, the ECL system
was used for detection of peroxidase reaction. In separate experiments, the
TNT Quick Coupled Transcription/Translation Systems (Promega) were used to
express BarH1 cDNA.100 µl of beads with the GST-Chip fusion
proteins were incubated with 100 µl of the TNT reaction. Following the
washes the protocol was followed as above.
Immunocytochemistry
Antibody staining procedures were performed as described previously
(Pueyo et al., 2000
).
Antibodies used were: guinea pig anti-Lim1
(Lilly et al., 1999
); rat
anti-Ap (Lundgren et al.,
1995
); rabbit anti-Dlmo (Milan
et al., 1998
); rabbit anti-ß-galactosidase (Cappel).
Secondary antibodies were obtained from Vector Laboratories and Jackson
ImmunoResearch.
 |
Results
|
|---|
The apterous and Chip genes interact during tarsus four development
The ap gene is expressed in the leg imaginal disc from 96 hours
AEL in a ring of cells corresponding to the presumptive fourth tarsal segment
(Fig.
1B,B''')
(Cohen et al., 1992
). In
strong ap mutants, the fourth tarsal segment is either absent or
reduced in size, and is fused to the fifth tarsal segment
(Fig. 2A)
(Pueyo et al., 2000
). This
ap mutant phenotype is completely rescued by expression of a
UAS-ap transgene (Fig.
2B), showing that Ap is required for the proper development of the
fourth tarsal segment.

View larger version (68K):
[in this window]
[in a new window]
|
Fig. 2. Genetic interactions between LIM-HOM proteins and Ap function. (A) Leg of
an apGal4/apUGO35 fly. The fourth tarsal segment is almost
completely lost and is fused to the fifth (arrowhead), whereas the other leg
segments are normal. (B) Rescue of the apGal4/Df(2)nap1 leg mutant
phenotype by overexpression of an ap transgene. The ap
mutant phenotype is completely rescued by one copy of the UAS-ap
construct (compare with A and Fig.
1A). (C) Rescue of an apGal4/Df(2)nap1 leg mutant
phenotype by overexpression of the chimaera protein Chip-Ap, consisting of
Chip lacking the LIM interaction domain (LID) linked to Ap lacking the LIM
domains. (D) Leg of an apGal4/Df(2)nap1;UAS-Lim3:ap-HD fly. Ectopic
expression of a chimaera protein, which consists of the LIM domains of Lim3
and the Ap homeodomain, rescues the ap mutant phenotype. (E)
apGal4;UAS-isl leg lacking the fourth tarsal segment. (F) Leg of an
apGal4/UAS-ap;UAS-isl fly. Overexpression of Ap does not overcome the
dominant-negative effect produced by ectopic Islet expression (compare with
E). (G-G'') Leg imaginal disc of an apGal/UASGFP;UAS-islet
larva. Ectopic expression of Islet does not affect either Ap or Bar
expression. (G) Bar protein distribution (blue). (G') apGal4
expression (red). (G'') Merged image.
|
|
The Chip gene is expressed ubiquitously in the legs
(Fig. 1C)
(Morcillo et al., 1997
) but no
functional requirement has been reported. We have induced clones of cells
lacking Chip and observe defects in different parts of the leg, such as tarsal
segments four and five, the pretarsus, the tibia
(Fig. 1E,F), and the coxa and
femur (not shown). Given this requirement, and the functional relationship
between Chip and Ap in the wing, we searched for possible genetic interactions
between ap and Chip. First, transheterozygous allelic
combinations between ap and Chip (apGal4 or
apUGO35/Chip371, Chip96.1,
Chipe55) did not show any mutant phenotype in the legs (data
not shown) (Pueyo et al.,
2000
). Second, UAS-ap and UAS-Chip full-length
transgenes were overexpressed in the ap domain and in both cases no
phenotype in the legs was observed (Pueyo
et al., 2000
), whereas the wings blister as described previously
(Fernández-Fúnez et al.,
1998
). Finally, overexpression of a fragment of the Ap protein
containing only the LIM domains, which interacts with Chip and acts as a
dominant-negative form of Ap in the wing
(OKeefe et al., 1998
),
did not cause any phenotype in the legs (not shown). Only stronger and more
sustained overexpression of UAS-Chip under the control of the
DllGal4 driver compromises the development of tarsus four, without
affecting ap expression (Fig.
1G,H). However, Ap and Chip proteins seem to be associated in
tarsus four, as a chimaeric Ap-Chip protein that acts as a functional Ap
protein in the wing (van Meyel et al.,
1999
) also rescues the ap leg mutant phenotype
(Fig. 2C), whereas an Ap
fragment without the LIM domains does not (data not shown). Altogether these
results indicate that although interaction between Ap and Chip is required for
the development of the leg, their relative stoichiometry is not as crucial as
it is in the wings, but rather is more similar to the situation in the
CNS.
It has been previously reported that dlmo is expressed in the
legs, but its pattern of expression has not been fully characterised
(Zeng et al., 1998
). Using
anti-Dlmo antibody and a dlmoGal4 reporter line
(Milan et al., 1998
), we did
not detect Dlmo expression in the leg tissue but in a few cells of the
peripodial disc membrane (Fig.
1D). In addition, loss-of-function dlmo alleles did not
produce a mutant leg phenotype (not shown). Another dlmo-like gene
annotated as CG5708 has been found in the fly genome
(Adams et al., 2000
). In situ
hybridisation was performed using a specific cDNA for this gene as a probe and
expression was observed in the CNS, but not in the leg imaginal discs (not
shown). Thus it appears that dlmo genes do not regulate LIM-HOM
function in the legs. Nevertheless, ectopic expression of UAS-dlmo in
the ap domain causes the loss of the fourth tarsal segment
(Fig. 1I) without removing Ap
protein expression (data not shown). As the Dlmo protein cannot bind the LIM
domains of Ap but does bind the Chip LIM-interaction domain with higher
efficiency than Ap (Milan et al.,
1998
; Weihe et al.,
2001
), it is possible that ectopic expression of Dlmo in the leg
sequesters Chip, thereby disrupting the formation of Chip-Ap complexes. In
agreement with this interpretation, partial rescue of the UAS-dlmo
dominant-negative effect was achieved by co-expression of UAS-Chip
(Fig. 1J). Therefore, although
the dlmo gene is not expressed during the development of the
wild-type leg, its ectopic expression interferes with the posttranslational
interaction of Ap and Chip. We used a similar rationale to identify further
interacting partners of Ap and Chip in the legs.
Ectopic expression of LIM-HOM genes interferes with Ap function posttranslationally
Sequence comparisons have shown that LIM-HOM proteins have been conserved
throughout evolution (Dawid et al.,
1998
; Hobert and Westphal,
2000
). Their developmental role also seems to be conserved,
because distinct neural fates are specified by identical combinations of
LIM-HOM genes in Drosophila and in vertebrates
(Thor et al., 1999
).
Furthermore, ectopic expression of vertebrate LIM-HOM orthologues induce the
same developmental effects in flies as the endogenous Drosophila
genes do, indicating that the mechanisms of action of LIM-HOM proteins are
conserved (Rincón-Limas et al.,
1999
; Tsuji et al.,
2000
). In view of these LIM-HOM functional relationships, we
tested whether other LIM-HOM proteins could rescue Ap function in legs.
Expression of UAS-Lim1 in ap mutant legs does not produce
any rescue of the ap mutant phenotype
(Pueyo et al., 2000
), and no
rescue was obtained by expressing the LIM-HOM gene islet either (not
shown). However, OKeefe et al.
(OKeefe et al., 1998
)
showed that expression of a hybrid protein containing the LIM domains of Lim3
and the homeodomain of Ap (Lim3-Ap) was able to partially rescue the
ap mutant phenotype in the wing. This functional overlap extends to
the leg as the hybrid Lim3-Ap molecule also rescues the ap mutant leg
phenotype (Fig. 2D); this shows
that the primary function of the LIM domains of Ap must be common to those of
Lim3, most likely binding of Chip as shown in other systems
(Milan et al., 1998
;
Thor and Thomas, 1997
;
van Meyel et al., 2000
).
When LIM-HOM genes (Lim3, islet) were expressed ectopically in the
ap domain of otherwise wild-type flies, the existence of an unknown
cofactor of Ap was revealed. apGal4;UAS-Lim3 and
apGal4;UAS-isl flies lack the fourth tarsal segment
(Fig. 2E). These flies still
expressed ap in the legs (Fig.
2G-G'') and their phenotype was not rescued by simultaneous
co-expression of UAS-ap
(Fig. 2F). As these LIM-HOM
proteins can interact with Chip, quenching of Chip could explain their
ap-like dominant-negative phenotypes. However, these
dominant-negative effects were also not rescued by co-expression of
UAS-Chip (data not shown). The lack of phenotypic rescue by
co-expression of either Chip or Ap could be due either to higher binding
affinities of the Islet and Lim3 proteins, or to different levels of
expression of the UAS transgenes employed. However, several UAS-ap
and UAS-Chip transgenes with different expression levels were used in
these experiments, with no rescue of the dominant-negative mutant phenotype.
An alternative explanation is that Lim3 and Islet proteins interfere with
another cofactor required for Ap function in the legs.
Overexpression of Bar suppresses the dominant-negative effect caused by ectopic LIM-HOM proteins in the ap domain
An element related to Ap function is the HOM gene Bar. Bar is
required for the development of tarsal segments four and five
(Fig. 1B,B' and
Fig. 3A)
(Kojima et al., 2000
). The
main functional role of Bar in tarsus four had been attributed to the
transcriptional activation of ap, as part of the regulatory network
patterning the distal leg (Kojima et al.,
2000
; Pueyo et al.,
2000
). Ectopic Lim1 driven by apGal4 eliminates tarsal
structures and represses Bar expression
(Fig. 3C,D-D''), leading
to the loss of Ap expression (Pueyo et
al., 2000
). As it might be expected, co-expression of Bar in
apGal4/UAS-Lim1;UAS-Bar flies produces a partial rescue of the fourth
tarsal segment (Fig. 3E).

View larger version (106K):
[in this window]
[in a new window]
|
Fig. 3. Bar is the factor affected by ectopic LIM-HOM protein expression in the
fourth tarsal segment. (A) Leg with Bar mutant clones marked by
forked phenotype in the tarsal region. A large clone along the
ventral (lower) side of the leg is outlined in black. Cells lacking
Bar do not grow properly and the tarsal segments t2-t5 appear fused.
Magnification of the distal part of the clone is shown in the inset, showing a
remnant joint (arrow) and a forked bristle (arrowhead). (B) Leg with
Bar mutant clones similar to those shown in A, except that here they
also express Ap using DllGal4 (see Materials and methods). The distal
tarsal segments are fused, similar to those observed in Bar clones.
Inset shows a magnification of the distal part of the clone, showing a
forked bristle (arrowhead) and a remnant joint (arrow). (C) Leg
imaginal disc showing Bar-lacZ reporter expression in a ring of cells
in the presumptive fourth and fifth tarsal region (green), and Lim1
distribution (red). (D-D'') Ectopic expression of the Lim1 gene
represses Bar in a dppGal;UAS-Lim1 leg imaginal disc. (D) Lim1
protein distribution. (D') Bar protein distribution, showing an absence
of Bar in the area where Lim1 is present. (D'') Merged image. (E) Leg of
an apGal4/UAS-Lim1;UAS-Bar fly. Overexpression of Bar in an
apGal4/UAS-Lim1 genetic background partially rescues the
ap-like dominant-negative effect of ectopic Lim1
(Pueyo et al., 2000 ). (F)
Overexpression of Bar in an apGal4;UAS-islet genetic background also
partially rescues the loss of the fourth tarsal segment (compare with
Fig. 2E). Magnification of the
distal part is shown in the inset. A remnant joint in the dorsal part of the
fused t4-t5 segment is seen (arrowhead). An apical bristle can also be
distinguished (out of focus; arrowhead).
|
|
However, the dominant-negative effect on tarsus four produced by ectopic
expression of Islet is not mediated by repression of either Bar or Ap
expression (Fig.
2E,G-G''). Surprisingly, this Islet effect was also partially
suppressed by co-expressing Bar (Fig.
3F). Therefore, Bar may be the Ap cofactor in tarsus four that is
interfered with by ectopic Islet and Lim3 proteins, and whose existence we
inferred in the previous section. To confirm whether there is a requirement
for Bar in fourth tarsal development apart from ap transcriptional
activation, we generated Bar mutant clones that still express
ap in the distal part of the leg (see Materials and methods).
Bar mutant clones show, as described before, a fusion of T3 to T5
tarsal segments (Fig. 3A) (Kojima et al., 2000
). When
the UAS-ap transgene was expressed in these Bar mutant
clones, no phenotypic rescue was observed
(Fig. 3B), indicating that the
functional requirement for Bar in tarsus four goes beyond the activation of
ap, and favouring its role as an Ap cofactor.
A proper balance of Bar and Ap proteins is required during tarsal development
LIM-HOM proteins can form multi-protein complexes with other HOM proteins,
either by direct interactions or through interaction with Ldb proteins
(Hobert and Westphal, 2000
).
As Bar behaves as a cofactor of Ap, Ap and Bar proteins could interact and
form a transcriptional complex to regulate target genes. In this case, changes
of dosage of either Bar or ap might disrupt the formation of
Ap-Bar complexes. To test this hypothesis, we performed gene dosage
experiments. First, the phenotypes of both Bar
(InBM2) and ap (apGal4/apUGO
at 25°C) mutants were enhanced by removing a copy of ap and
Bar, respectively (Fig.
4A-C; compare with Fig.
2A). Second, overexpression of Bar causes loss of the fourth
tarsal segment (Fig. 4E),
although Ap was still expressed in these flies
(Fig. 4D)
(Kojima et al., 2000
). As Bar
is expressed in a graded manner in the wild type, at a higher level in the
fifth tarsal segment and at a lower level in the fourth
(Fig. 1B,B'), these
observations suggest that the correct amount of Bar is necessary for the
development of the fourth tarsal segment. If Bar overexpression alters the
stoichiometry of Ap and Bar, and thus prevents the formation of functional
Ap-Bar complexes, then this dominant-negative effect should be rescued by
restoring the appropriate balance with co-expression of Ap. As predicted,
apGal4/UAS-ap;UAS-Bar flies show a completely rescued phenotype with
five tarsal segments (Fig.
4F).

View larger version (76K):
[in this window]
[in a new window]
|
Fig. 4. Bar is the limiting factor for the development of the fourth tarsal
segment. (A) Leg of an InBM2 mutant. This mutation
produces partial loss of Bar function
(Kojima et al., 2000 ). In
these mutants, 33% of the legs show a weak fusion between the fourth and fifth
tarsal segment, with the joint not properly differentiated (inset, arrowhead).
(B) Leg of a InBM2; apUGO /+ mutant.
Removal of a copy of ap enhances the mutant phenotype observed in
InBM2 mutants. Tarsus four and five are shorter and are
fused in 61% of the legs (inset, arrowhead; compare with A). (C) The
ap mutant phenotype is also enhanced by reducing Bar function in
InBM2; apUGO /apGal4 flies
(compare with Fig. 2A). Tarsus
four is completely absent (inset), and even the joint between tarsus five and
three is affected (arrowhead). (D) Overexpression of Bar does not repress Ap
expression in the fourth tarsal segment (arrow). (E) Leg of an
apGal4;UAS-Bar fly. Overexpression of Bar prevents the development of
the fourth tarsal segment. (F) Overexpression of Ap rescues completely the
phenotype caused by overexpression of Bar in the ap domain (compare
with E). (G) Ectopic expression of a hybrid molecule, consisting in the LIM
domains of Lim3 and the Ap homeodomain, completely rescues the loss of tarsus
four phenotype produced by overexpression of Bar (compare with E). (H) Rescue
of the apGal;UAS-Bar phenotype is also achieved by overexpression of
Chip. (I) Ectopic expression of Chip lacking the LIM interaction domain is not
able to rescue the dominant-negative effect produced by Bar overexpression.
(J) Ectopic expression of the Chip-Ap hybrid protein partially rescues the
apGal4;UAS-Bar phenotype, suggesting that Ap interacts with Chip to
form dimers in tarsus four. However, the hybrid protein does not rescue as
efficiently as the Ap and Chip wild-type proteins (compare with F, G and
H).
|
|
No rescue of the dominant-negative effect of UAS-Bar on tarsus
four was obtained by co-expression of Ap protein fragments lacking the LIM
domains or the homeodomain (data not shown), which suggests that an Ap protein
with functional LIM and HOM domains is required for the rescue. Interestingly,
full rescue of the Bar overexpression phenotype by co-expression of the
chimeric Lim3-Ap protein was observed (Fig.
4G), indicating again a non-specific requirement for the LIM
domains. The LIM domains could be interacting with a common cofactor, such as
Chip, in the formation of Ap-Bar functional complexes. In agreement with this
interpretation, the dominant-negative effect caused by UAS-Bar
overexpression was also completely rescued by simultaneous overexpression of
UAS-Chip, revealing that Chip is involved in the interaction between
Ap and Bar (Fig. 4H). This
hypothesis is also supported by the requirement for Chip in tarsus four
development (Fig. 1E,F), and by
the dominant-negative effect of UAS-Chip overexpression with strong
Gal4 drivers (Fig.
1G). In addition, no rescue of the UAS-Bar
dominant-negative phenotype was obtained by co-expression of Chip protein
fragments lacking the dimerisation domain or the LIM-interacting domain
(Fig. 4I), suggesting that both
domains of Chip are required for the rescue of this UAS-Bar
dominant-negative effect. Finally, to determine whether the interaction of Ap
with Bar is carried out through an Ap-Chip dimer, the chimaeric Chip-Ap fusion
protein was co-expressed with UAS-Bar. Partial rescue of the
dominant-negative phenotype was observed
(Fig. 4J), suggesting that Ap
and Chip bind to each other to form functional protein complexes and interact
with Bar in the fourth tarsal segment.
Bar interacts with Chip and Ap
To test the possibility of Chip-mediated complexes involving Bar, a direct
interaction between Bar and Chip was tested in a Gst pull-down assay. Bar
protein, both expressed in vitro or present in leg disc extracts, is retained
by Chip-Gst fusions (Fig.
5A,B), as is Lim1 (Fig.
5A,B) (Lilly et al.,
1999
) and Ap (Torigoi et al.,
2000
). This protein interaction explains the requirement for Chip
in tarsus five, and suggests that a complex of Bar-Chip is the functional
element in this segment. In tarsus four, Chip seems to also bind Ap, as shown
by the results involving the Ap-Chip chimaera in the legs (see above).
Therefore, the dominant-negative interactions between Bar and Ap (and other
LIM-HOM) proteins in tarsus four could be based on competition for Chip.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 5. Bar interacts with the Chip and Ap proteins. (A) Representation of
different domains in Chip and deleted Chip proteins. Chip contains a proline
and glutamine rich (PQ rich) region at the amino-terminal end, followed by a
Dimerisation Domain (DD). The LIM interaction domain (LID) is located at the
carboxyl-terminal end. The Other Interaction Domain (OID) appears between
amino acids 439 and 456, and mediates the interaction with Bicoid. The
Chip LID protein lacks the LIM interaction domain, and the
Chip OID lacks the OID domain. (B) Sample western blots of the affinity
chromatography experiments using leg disc extracts; Gst-Chip fusion proteins
and beads used are indicated at the top of the lanes, and the different
antibodies used for immunodetection are indicated on the left. The
Gst and Beads lanes show the lack of protein
retained by beads with the Gst protein alone, and by the Gluthathione-agarose
beads alone, respectively. Other lanes on the top row show an 62 kDa band
in the anti-Bar western blot, corresponding with the predicted size of Bar.
Bar is able to interact with Chip, and with the Chip LID- and Chip OID-deleted
proteins, but it does not interact with Gst or with beads alone. Similarly, in
the middle row a 46 kDa band is detected in the anti-Lim1 western blot,
showing that Chip interacts with Lim1. However, a decrease of signal of this
band is detected in the Chip LID lane, as has also been found with Ap
(Torigoi et al., 2000 ),
corroborating that the LID is crucial for the interaction between Ldb and
LIM-HOM proteins. The lack of the OID domain does not affect this interaction.
Finally, in the bottom row the western blot shows that Al interacts with Chip.
An 40 kDa band corresponding with the predicted size of Al is detected. A
decrease of the signal is observed in the Chip LID lane and the signal
is almost undetectable in the Chip OID lane. Thus, both protein domains
are necessary for the proper binding of Al. (C) Representation of the protein
domains in Ap and Ap-LIM proteins. The Ap protein contains two LIM domains at
the amino-terminal part of the protein followed by a homeodomain. The Ap-LIM
protein consists of the amino-terminal end containing the LIM domains. (D)
Western blot carried out similar to that shown in B, but with Gst-Ap
constructs. The same 62 kDa band was detected using the anti-Bar antibody. Bar
interacts with Ap and Ap-LIM, as well as with Chip, but it does not interact
with Gst or with beads alone. The increase of signal in the Ap-LIM lane in
comparison with in the Ap and Chip lanes is due to the higher molarity of
Ap-LIM protein loaded in comparison with Ap and Chip proteins.
|
|
However, whereas the interaction between Chip and Ap or Lim1 depends on the
LIM-interaction domain (LID) of Chip (Fig.
5A,B), and the interaction of Chip with other HOM proteins, such
as Bicoid, depends on the Other Interaction Domain (OID)
(Fig. 5A) (Torigoi et al., 2000
), the
interaction between Chip and Bar does not rely on these domains
(Fig. 5A,B). This suggests
that, in principle, binding of Bar and Ap to Chip does not need to be mutually
exclusive. These results are compatible with the possibility of Bar and Ap
being simultaneously bound to Chip in a complex. If this were the case, an
association between Ap and Bar proteins could be found. As expected, Bar
protein present in protein extracts from leg discs is retained by Gst-Ap in a
pull-down experiment (Fig.
5C,D). A fragment of Ap consisting of the LIM domains is also able
to pull down Bar in a similar experiment
(Fig. 5C,D). Altogether these
results suggest that the interaction between Ap and Bar takes place in a
protein complex that involves Chip (see Discussion).
In summary, our results show that the development of the tarsus requires
stoichiometric interactions between Bar, Ap and Chip proteins, with Bar being
the limiting factor in this process. These interactions seem to rely on: (1)
the binding of Ap and Chip through their LIM and LID domains, respectively;
(2) an interaction between Bar and Chip through a different domain; and (3)
further complexing mediated by the Chip dimerisation domain. These
interactions lead to the formation of Ap-Chip-Bar and Bar-Chip, functional
units in tarsus four and five, respectively. Direct interactions between
LIM-HOM and HOM transcription factors leading to the transcriptional
regulation of target genes have already been described
(Bach et al., 1997
).
Interactions between LIM-HOM, Chip and HOM proteins in the pretarsus
The pretarsus at the tip of the leg is composed of the claw organ (a
multicellular organ providing sensory information and grip to the substrate),
plus a muscle attachment site and its associated tendon. Lim1 and the
Prd-HOM gene al are required for pretarsus development, and display
synergistic functional interactions (Pueyo
et al., 2000
). One of the outcomes of their co-operation is the
repression of Bar expression. Thus, weak alleles of al or strong
alleles of Lim1 lead to mild ectopic Bar expression in the pretarsus
(Fig. 6A,B)
(Kojima et al., 2000
), whereas
complete loss of both al and Lim1 allows Bar to completely
invade the presumptive leg tip (Fig.
6C) (Tsuji et al.,
2000
). Reciprocally, ectopic expression of Al or Lim1 alone does
not repress Bar (Fig. 6D)
(Kojima et al., 2000
), but
ectopic expression of Lim1 plus the ensuing ectopic expression of Al
(Fig. 6F)
(Tsuji et al., 2000
) produce
loss of Bar expression (Fig.
3D-D'') (Pueyo et al.,
2000
). The repression of Lim1 plus Al on Bar expression is
reciprocal, as ectopic Bar represses Al and Lim1 expression
(Fig.
6I-I'''; compare with H-H''')
(Tsuji et al., 2000
),
producing the loss of pretarsal structures
(Fig. 6E), whereas loss of Bar
leads to ectopic expression of Lim1 (Fig.
6G). Thus, mutual antagonism between Al plus Lim1 in the pretarsus
and Bar in the tarsus leads to mutually exclusive patterns of expression, and
establishes a sharp pretarsus-tarsus boundary that is crucial for both tarsus
five and claw organ development (Kojima et
al., 2000
; Pueyo et al.,
2000
).

View larger version (87K):
[in this window]
[in a new window]
|
Fig. 6. Genetic relationships between the tarsal gene Bar and the
pretarsal genes al and Lim1. (A) Pattern of expression of a
reporter Bar-lacZ in a wild-type late third instar leg imaginal disc.
(B) A Lim1R12.4 mutant leg imaginal disc showing
Bar-lacZ reporter expression invading the pretarsal region (arrow,
compare with A). (C) Bar-lacZ expression in an al strong
mutant (alex/alice), which lacks al
and loses Lim1 expression (Pueyo
et al., 2000 ). Bar expression invades the whole pretarsal
region at the centre of the disc. (D) Bar-lacZ expression in an
alice/alex mutant background expressing Lim1
driven by the dppGal4 driver. Expression of Lim1 is not able to
repress Bar expression in the absence of Al function (compare with
Fig. 3C,D-D''). (E) Leg
from a dppGal4/UAS-Bar fly. Ectopic expression of Bar produces fusion
of the proximal segments, such as femur, tibia and the first tarsal segment
(arrow), and in the pretarsus one claw is missing (arrowhead). (F) Ectopic Al
expression (arrow) produced by dppGal;UAS-Lim1. (G) High
magnification of the pretarsal region from a leg imaginal disc with a clone of
cells deficient for Bar (outlined in white). Lim1 expression (red)
extends into the clone. (H-H''') A dppGal4/UAS-GFP
leg disc showing Lim1 protein in blue (H), Al protein in red (H'), and
the pattern of Gal4 expression in green (H''), in an otherwise
wild-type leg. (H''') Merged image.
(I-I''') A dppGal4/UAS-GFP;UAS-Bar leg disc stained
as in H. Ectopic expression of Bar represses Lim1 and Al in the pretarsus
(compare with H).
|
|
As Al, Lim1 and Bar are transcription factors, these regulatory
interactions could be directly and solely mediated by binding to their
respective regulatory regions. However, we have also uncovered functional
interactions not based on transcriptional control. When Al is ectopically
expressed in the ap domain in apGal4/UAS-al flies, neither
the expression of Bar or Ap is affected (not shown), yet a loss of tarsus four
is produced (Fig. 7A). This
dominant-negative effect is partially rescued by co-expression of Bar
(Fig. 7B), but not by
expression of Ap or Chip, indicating that, similar to LIM-HOM proteins, Al can
exert a posttranslational effect on Bar. Reciprocally, ectopic expression of
the LIM-HOM proteins Ap, Islet or Lim3 in the pretarsus leads to loss of claw
organ elements without affecting the expression of Lim1
(Fig. 7C-D'). We surmise
that the functional relationship in the wild-type pretarsus between Al and
Lim1 may be similar to that of Bar and Ap in tarsus four, i.e. putative
protein interactions leading to the formation of multimeric transcriptional
complexes. In agreement with this hypothesis, Chip binds to the LIM domains of
Lim1 (Fig. 5A,B)
(Lilly et al., 1999
) and is
required for pretarsus development (Fig.
1E,F). Strong overexpression of Chip in the pretarsus also leads
to Lim1-like mutant phenotypes
(Fig. 1G), mimicking the
results obtained in tarsus four. Supporting this hypothesis, ectopic
expression of Dlmo in the pretarsus also produces loss of claw organ without
affecting Lim1 expression (Fig.
7F,H,I). Finally, overexpression of Lim1 in the pretarsus also has
a dominant-negative phenotype, just as Bar does in the fourth tarsal segment
(Fig. 7G). It follows that, as
in the fourth tarsal segment, Chip might be participating in direct
interactions between LIM-HOM and Prd-HOM proteins. This putative interaction
with Chip seems to involve the LIM-interaction and the dimerisation domains,
as ectopic expression of a Chip fragment lacking either of these domains
produces loss of the claw organ (Fig.
7E), possibly by still being able to sequester Lim1
(Fig. 5A,B).

View larger version (88K):
[in this window]
[in a new window]
|
Fig. 7. Functional relationships between LIM-HOM, Prd-HOM, Chip and Dlmo proteins
in the pretarsus. (A) Ectopic expression of Al using the apGal4
driver produces a loss of the fourth tarsal segment. (B) Co-expression of Bar
in an apGal4/UAS-al background partially rescues the
dominant-negative effect on the development of the fourth tarsal segment
(compare with A). (C) Ectopic expression of Islet using the dppGal4
driver causes fusion of the femur, tibia and first tarsal segment. In the
pretarsus only one claw develops (arrowhead). (D,D') A
dppGal4/UAS-GFP;UAS-islet leg disc showing Lim1 protein distribution
(D, blue) and Lim1 protein distribution plus the Gal4 pattern of
expression (D', green). Ectopic expression of Islet does not repress
Lim1 expression; therefore the dominant-negative effect on Lim1 function seems
to be posttranslational. (E) Ectopic expression of a truncated Chip protein
lacking the LIM interaction domain with the DllGal4 driver produces a
similar phenotype in the pretarsus to that seen in DllGal4;UAS-Chip
flies: lack of the claws (arrowhead), and fusion of the fifth and fourth
tarsal segments (compare with Fig.
1G). (F) A DllGal4;UAS-dlmo leg. Ectopic expression of
the dlmo gene mimics the Lim1 lack-of-function phenotype.
Arrowhead denotes the pretarsus lacking the claws. (G) Ectopic expression of
Lim1 driven by the dppGal4 driver disrupts leg development causing
the fusion of femur, tibia, and tarsus one to three. In the pretarsus it
produces a similar phenotype to that seen in Lim1 mutants, or after
ectopic expression of Lim1 antagonists (arrowhead; compare with C). (H)
Pattern of Lim1 expression in a wild-type leg imaginal disc. (I) Lim1 protein
distribution in a DllGal4;UAS-dlmo leg imaginal disc. The Lim1
protein is detected in a normal number of pretarsal cells, suggesting that the
ectopic Dlmo effect on Lim1 function is not transcriptional, although part of
the Lim1 domain is disorganised (compare with H). The white dotted
line denotes the proximal limit of the DllGal4 pattern of
expression.
|
|
To test this hypothesis, a Gst pull down using different Gst-Chip
constructs was performed. Al protein from leg disc extracts is retained by the
full-length Chip construct, suggesting that a direct protein interaction
exists (Fig. 5A,B). The Al
interaction with the two other Chip deletion constructs is weaker or absent,
suggesting that both domains are required for the proper binding between Chip
and Al (Fig. 5A,B). Altogether
our results support the hypothesis of a balanced functional relationship
between Lim1, Al and Chip that can interfere with, or be interfered by, other
LIM-HOM proteins, and that might be based on multimeric, specific protein
complexes.
 |
Discussion
|
|---|
Biochemical studies in vitro have shown that LIM-HOM transcription factors
confer little transcriptional activation of target genes on their own
(Bach et al., 1995
;
German et al., 1992
). LIM-HOM
proteins interact with a variety of proteins, including members of the bHLH
family (Johnson et al., 1997
),
the POU family (Bach et al.,
1995
), the PAS family (Bach et
al., 1997
) and also other LIM family members
(Jurata et al., 1998
;
Thaler et al., 2002
;
Thor et al., 1999
), to control
specific developmental processes (Hobert
and Westphal, 2000
). It has been suggested that these protein
interactions confer specificity and modulate LIM-HOM activity
(Bach, 2000
). For example, Dlmo
proteins reduce LIM-HOM activity, and Lbd proteins such as Chip modulate
LIM-HOM activity by acting as a bridge between LIM-HOM proteins and
Chip-binding cofactors, thus leading to the formation of heteromeric
complexes. An example of regulation of LIM-HOM protein activity in different
contexts is the development of Drosophila.
A regulatory network of transcription factors controls distal leg development
Bar and ap genes are expressed in the fourth tarsal
segment and are required for its proper development, whereas the al
and Lim1 genes are expressed and required in the pretarsus
(Kojima et al., 2000
;
Pueyo et al., 2000
;
Tsuji et al., 2000
). All of
these genes encode putative transcription factors and display canonical
regulatory relationships. Thus, al activates lim1 expression
and then both genes cooperate to repress Bar expression in the
pretarsus. Reciprocally, Bar represses al and lim1
expression while activating the expression of ap in tarsus four.
After the refinement of their gene expression domains by these regulatory
interactions, Bar directs tarsus five development, whereas
cooperation between al and lim1 directs pretarsus
development (Pueyo et al.,
2000
), and cooperation between Bar and ap
directs tarsus four (this study). Our results offer more evidence for the
existence of this regulatory network, but also suggest an interesting role for
direct protein interactions in its mechanism.
The cooperation between Bar and Ap on the one hand, and Al and Lim1 on the
other, is likely to be carried out by transcriptional complexes involving Chip
(Fig. 8). The Chip protein is
required for development of the tarsus four, five and pretarsus, and Gst
experiments reveal its ability to bind Ap, Bar, Lim1 and Al
(Lilly et al., 1999
;
Milan et al., 1998
) (this
work). However, our results also show that modulation of LIM-HOM protein
activity by Chip alone does not explain distal leg development. For example,
Ap function is not modulated primarily by Chip and Dlmo. The relative amount
of Chip and Ap has to be grossly unbalanced before a phenotype is obtained in
the leg (Pueyo et al., 2000
)
(this work), and dlmo is not expressed or required in leg
development. Furthermore, the interaction between Ap and Chip does not confer
the developmental specificity that allows LIM-HOM proteins to produce
different outcomes in different parts of the leg. First, Ap and Chip also
interact in the wing and the CNS. Second, a chimaeric Lim3-Ap protein
containing the LIM domains of Lim3 and the HOM domain of Ap does not behave as
a dominant negative when expressed in tarsus four, and is even able to fulfil
Ap function and rescue ap mutants. In the distal leg, developmental
specificity seems to be achieved at the level of DNA binding and the
transcriptional control of targets genes, mediated by partnerships between
LIM-HOM and HOM proteins.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 8. Specific developmental functions are carried out by different partnerships
between interacting LIM-HOM and HOM proteins. (A) Ap function in the wing is
carried out by a complex of Ap and Chip. This unit dimerises to form a
tetrameric complex comprising two molecules of Ap bridged by a Chip dimer. The
relative stoichiometry of the two proteins is important for the formation of
these complexes. Dlmo regulates Ap function by sequestering Chip into
non-functional complexes. (B) Ap-Chip complexes are also necessary for the
proper development of Ap motoneurones. However, balanced amounts of Chip and
Ap are not required for tetrameric complex formation indicating that the
limiting factor is Ap. In addition, there is no regulation by Dlmo. (C) In the
fourth tarsal segment, Ap function might be achieved by a multiprotein
complex, comprising Ap, Bar and Chip proteins. Our experiments indicate that
the limiting factor in the formation of functional complexes is Bar, whereas
Ap and Chip are more abundant. Bar interacts with Chip but not through the OID
domain. This Ap-Chip-Bar functional unit could dimerise to produce a hexamer,
or could consist of a molecule of each Ap and Bar bridged by a dimer of Chip.
(D) High levels of Bar expression are required for the development of the
fifth tarsal segment. As loss of Chip also affects the fifth tarsal segment,
it is possible that a heterodimer of Bar and Chip is the functional unit in
tarsus five. This unit could dimerise to produce a tetramer. (E) Synergism
between Al and Lim1 is required for pretarsal development. Lim1 and Chip
interact through their LIM and LID domains, respectively, and Al is also able
to interact with Chip. In addition, genetic experiments show that Chip, Al and
Lim1 are required in balanced amounts, suggesting that the functional unit in
the pretarsus involves these three proteins simultaneously.
|
|
The evidence for this is presented first by dosage interactions between
LIM-HOM and HOM proteins. Whereas there seems to be a relative abundance of
endogenous Ap in tarsus four, an excess of Bar or Chip leads to a mutant
phenotype, which is rescued by restoring the normal balance between Ap, Bar
and Chip proteins in co-expression experiments. The effects observed could be
explained simply by independent competition and the binding of Bar and Ap to
Chip, leading, for example, to an excess of Bar-Chip complexes and a reduction
of the pool of Chip available for Ap-Chip ones. However, this hypothesis alone
does not explain the additional dominant-negative effects of ectopic LIM-HOM
and HOM proteins in tarsus four (Lim3, Islet and Al), which are also not
mediated by transcriptional regulation but are nonetheless rescued by
co-expression of appropriate endogenous proteins. For example, ectopic
expression of UAS-islet or UAS-Lim3 in the ap
domain produces loss of tarsus four without affecting Ap or Bar expression,
and simultaneous co-expression of UAS-Bar partially suppresses this
phenotype. If the sole effect of both UAS-Bar and UAS-Lim3
or UAS-islet were to quench Chip away from Ap, then simultaneous
co-expression of Bar and Lim3 or Islet should worsen the phenotype, not
correct it as observed. Moreover, ectopic expression of Islet or Lim3 proteins
is not corrected by simultaneous co-expression of either UAS-Chip or
UAS-ap. Altogether these results show instead that UAS-islet
and UAS-Lim3 must interfere posttranslationally with Bar. The most
direct explanation is that Islet and Lim3 have the ability to quench Bar
protein into a non-functional state. Interestingly, the hybrid
UAS-Lim3:ap does not behave as dominant negative but as an endogenous
Ap protein in these experiments, as it does not produce a mutant phenotype on
its own and it rescues UAS-Bar overexpression. This suggests that the
LIM domains are not very specific when it comes to interaction with Bar, and
points to the involvement of a common LIM-binding intermediary such as Chip.
These results suggest that a protein complex involving Ap, Chip and Bar is the
correct functional state of these proteins in tarsus four, and deviations from
this situation into separate Bar-Chip, Ap-Chip, or Bar-Chip-Lim3 or
Bar-Chip-Islet complexes leads to a mutant phenotype.
The notion of a protein complex involving Ap, Chip and Bar together is also
supported by the Gst pull-down assays. The domain of Chip involved in Ap
binding, the LID, is not involved in Bar binding. However, the LID and the
dimerisation domains of Chip are necessary to rescue the dominant-negative
effect of UAS-Bar on tarsus four, suggesting a requirement for the
formation of a complex with a LIM-HOM protein such as Ap. In agreement with
this view, the Ap protein, and the LIM domains of Ap alone, are able to retain
Bar protein in a Gst assay.
In the pretarsus, Al and Lim1 are possibly engaged in a partnership with
Chip similar to that suggested for Ap, Chip and Bar. Synergistic cooperation
between Al and Lim1 is required to direct pretarsus development and to repress
Bar expression and function. Their cooperation entails a close functional
relationship because a proper balance of Al, Lim1 and Chip is required, as is
shown by the loss of pretarsal structures in UAS-Chip or
UAS-Lim1 flies. Ectopic expression of LIM-HOM proteins in the
pretarsus also disrupts pretarsal development without affecting Lim1 and Al
expression. The possibility of direct protein interactions between Al, Lim1
and Chip is also suggested by the reciprocal ability of Al to interfere
posttranscriptionally with Bar and Ap in tarsus four, and by the binding of
Chip to Lim1 and to Al in in vitro experiments
(Fig. 5)
(Lilly et al., 1999
).
Different developmental outcomes correlate with different sets of interacting proteins
Comparison of tarsal development with other developmental processes
illustrates how LIM-HOM proteins are versatile factors to regulate
developmental processes. It had been observed that the outcome of LIM-HOM
activity depends on their developmental context. This context we can now
analyse as being composed of the presence, concentration and relative
affinities of other LIM-HOM proteins, Ldb adaptors, and other cofactors such
as LMO proteins and HOM proteins (Fig.
8). We propose that the different developmental outcomes of
LIM-HOM protein function could be due to the precise identity and dosage of
cofactors available locally.
Ectopic expression experiments distort these contexts and lead to
non-functional or misplaced LIM-HOM activities. In the wing, a finely balanced
amount of functional Ap protein is modulated by Dlmo and Chip
(Fig. 8A). Over-abundance of
Chip stops the formation of functional tetramers in the wing but not in the
CNS, where the relative amount of Ap, which is not modulated by Dlmo, is
limiting for the formation of Ap-Chip functional complexes
(Fig. 8B) (Fernández-Fúnez et al.,
1998
; Milan and Cohen,
1999
; Milan et al.,
1998
; OKeefe et al.,
1998
; van Meyel et al.,
1999
; van Meyel et al.,
2000
). In tarsus four (Fig.
8C), the Ap-Chip-Bar partnership is affected by experimentally
induced over-abundance of Chip, presumably also because ectopic Ap-Chip
tetramers typical of the CNS and the wing, and Bar-Chip complexes typical of
tarsus five, are produced. Similarly, an excess of Bar might be interpreted by
the cells as being a wrong developmental outcome, as high levels of Bar in the
absence of Ap direct tarsus five development
(Fig. 8D)
(Kojima et al., 2000
).
Overexpression of Ap rescues this Bar dominant-negative effect, by restoring
the relative amounts of Bar and Ap, which are determinant and limiting for
tarsus four development. Finally, the dominant-negative effects produced by
overexpression of either Chip or Lim1 in the pretarsus could either prevent
the formation of Al-Chip-Lim1 complexes
(Fig. 8E), or could favour the
existence of Lim1-Chip complexes typical of the CNS
(Lilly et al., 1999
).
The wing and the CNS models have postulated that Ap function is carried out
by an Ap-Chip tetramer; however, the molecular scenario might be more complex.
A new component of Ap-Chip complexes, named Ssdp, has been identified and is
required for the nuclear localisation of the complex
(Chen et al., 2002
;
van Meyel et al., 2003
). Thus
it is possible that an Ap-Chip tetramer also contains two molecules of Ssdp.
In addition, different types of Chip-mediated transcriptional complexes and
different regulators have been identified in other developmental contexts,
such as in sensory organ development and thorax closure, in which the GATA
factor Pannier forms a complex with Chip and with the bHLH protein
Daughterless. Heterodimers of this complex are negatively regulated by a
protein interaction with Osa (Heitzler et
al., 2003
; Ramain et al.,
2000
). Thus, although our results indicate that in different
segments of the leg there exist specific interactions between LIM-HOM, Chip
and HOM proteins, the involvement of further elements in these multiprotein
complexes is not excluded.
Partnership between Prd-HOM and LIM-HOM proteins in flies and vertebrates
Our results support a partnership between HOM and LIM-HOM proteins in the
specification of distinct segments of the leg, and the results are compatible
with Ap-Chip-Bar, Bar-Chip and Lim1-Chip-Al forming transcriptional complexes.
Although the characterisation of the target sequences, followed by further
biochemical and molecular assays, is necessary to study the transcriptional
mechanism of these interactions, it has been shown that LIM-HOM proteins can
interact specifically and directly with other transcription factors to
regulate particular genes. For instance, mouse Lim1 (Lhx1) interacts directly
with the HOM protein Otx2 (Nakano et al.,
2000
). In addition, the bHLH E47 transcription factor interacts
with Lmx1, and both synergistically activate the insulin gene
(Johnson et al., 1997
). This
interaction is specific to Lmx1, as E47 is unable to interact with other
LIM-HOM proteins such as Islet (Johnson et
al., 1997
). Moreover, Chip is able to bind to other Prd-HOM
proteins, such as Otd, Bcd and Fz, to activate downstream genes
(Nakano et al., 2000
;
Perea-Gomez et al., 1999
;
Shawlot et al., 1999
;
Varela-Echavarría et al.,
1996
). Chip also complexes with Lhx3 and the HOM protein P-Otx,
increasing their transcriptional activity
(Bach et al., 1997
). Our
results reinforce the notion of Chip as a multifunctional transcriptional
adaptor that has specific domains involved in each interaction.
Experiments in Drosophila have demonstrated a conservation of
LIM-HOM activity at the functional and developmental level in the CNS between
Drosophila and vertebrates
(Thaler et al., 2002
;
Thor et al., 1999
). In
addition, xenorescue experiments have shown that the mechanism of action of Ap
and its vertebrate homologue Lhx2 is very conserved in Drosophila
wings (Rincón-Limas et al.,
1999
), whereas ectopic expression of dominant-negative forms of
chick Lim1, Chip, Ap and Lhx2 mimic both Ap and Lhx2 loss-of-function
phenotypes (Bach et al., 1999
;
Milan and Cohen, 1999
;
OKeefe et al., 1998
;
Rodríguez-Esteban et al.,
1998
; van Meyel et al.,
1999
). The developmental role of Ap, Bar and Al in the fly leg,
and their putative molecular interactions may also have been conserved because
their vertebrate homologues Lhx2, Barx and Al4 are also co-expressed in the
limb bud (Barlow et al., 1999
;
Qu et al., 1997
;
Rincón-Limas et al.,
1999
). We would expect that the interactions between the LIM-HOM
and Prd-HOM proteins shown here represent a conserved mechanism to specify
different cellular fates during animal development.
 |
REFERENCES
|
|---|
Adams, M. D., Celniker, S. E., Holt, R. A., Evans, C. A.,
Gocayne, J. D., Amanatides, P. G., Scherer, S. E., Li, P. W., Hoskins, R. A.,
Galle, R. F. et al. (2000). The genome sequence of Drosophila
melanogaster. Science
287,2185
-2195.[Abstract/Free Full Text]
Arber, S. and Caroni, P. (1996). Specificity of
single LIM motifs in targeting and LIM/LIM interactions in situ.
Genes Dev. 10,289
-300.[Abstract/Free Full Text]
Bach, I. (2000). The LIM domain: regulation by
association. Mech. Dev.
91, 5-17.[CrossRef][Medline]
Bach, I., Rhodes, S. J., Pearse, R. V., Heinzel, T., Gloss, B.,
Scully, K. M., Sawchenko, P. E. and Rosenfeld, M. G. (1995).
P-LIM, a LIM homeodomain factor, is expressed during pituitary organ and cell
commitment and synergizes with Pit-1. Proc. Natl. Acad. Sci.
USA 92,2720
-2724.[Abstract/Free Full Text]
Bach, I., Carriere, C., Ostendorff, H. P., Andersen, B. and
Rosenfeld, M. G. (1997). A family of LIM domain-associated
cofactors confer transcriptional synergism between LIM and Otx homeodomain
proteins. Genes Dev. 11,1370
-1380.[Abstract/Free Full Text]
Bach, I., Rodriguez-Esteban, C., Carriere, C., Bhushan, A.,
Krones, A., Rose, D. W., Glass, C. K., Andersen, B., Izpisua Belmonte, J. C.
and Rosenfeld, M. G. (1999). RLIM inhibits functional
activity of LIM homeodomain transcription factors via recruitment of the
histone deacetylase complex. Nat. Genet.
22,394
-399.[CrossRef][Medline]
Barlow, A. J., Bogardi, J. P., Ladher, R. and Francis-West, P.
H. (1999). Expression of chick Barx-1 and its differential
regulation by FGF-8 and BMP signaling in the maxillary primordia.
Dev. Dyn. 214,291
-302.[CrossRef][Medline]
Bishop, S. A., Klein, T., Arias, A. M. and Couso, J. P.
(1999). Composite signalling from Serrate and Delta establishes
leg segments in Drosophila through Notch. Development
126,2993
-3003.[Abstract]
Campbell, G. (2002). Distalization of the
Drosophila leg by graded EGF-recepton activity. Nature
418,781
-785.[CrossRef][Medline]
Campbell, G. and Tomlinson, A. (1998). The
roles of the homeobox genes aristaless and Distal-less in patterning the legs
and wings of Drosophila. Development
125,4483
-4493.[Abstract]
Chen, L., Segal, D., Hukriede, N. A., Podtelejnikov, A. V.,
Bayarsaihan, D., Kennison, J. A., Ogryzko, V. V., Dawid, I. B. and Westphal,
H. (2002). Ssdp proteins interact with the LIM-domain-binding
protein Ldb1 to regulate development. Proc. Natl. Acad. Sci.
USA 99,14320
-14325.[Abstract/Free Full Text]
Cohen, B., McGuffin, M. E., Pfeifle, C., Segal, D. and Cohen, S.
M. (1992). apterous, a gene required for imaginal disc
development in Drosophila encodes a member of the LIM family of developmental
regulatory proteins. Genes Dev.
6, 715-729.[Abstract/Free Full Text]
Curtiss, J. and Heilig, J. S. (1998).
DeLIMiting development. BioEssays
20, 58-69.[CrossRef][Medline]
Dawid, I. B., Breen, J. J. and T