|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 23 June 2004
doi: 10.1242/dev.01223
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Biochemistry, University of Iowa, Iowa City, IA 52242, USA
* Author for correspondence (e-mail: lori-wallrath{at}uiowa.edu)
Accepted 20 April 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Chromatin structure, Drosophila, Gene silencing, Heterochromatin Protein 1, HP1
| Introduction |
|---|
|
|
|---|
HP1 is a non-histone chromosomal protein enriched in heterochromatin
(Eissenberg and Elgin, 2000
).
On polytene chromosomes of Drosophila melanogaster, HP1 associates at
200 sites along the euchromatic arms, in a banded pattern along the
fourth chromosome, near centromeres and near telomeres
(Fanti et al., 2003
;
James et al., 1989
). HP1 is an
essential component of heterochromatic gene silencing, a phenomenon where
active genes repositioned near heterochromatin become silenced
(Weiler and Wakimoto, 1995
).
Heterochromatin-associated proteins are hypothesized to `spread' linearly
along the chromosome from the breakpoint and alter the chromatin structure of
the relocated sequences (Locke et al.,
1988
; Tartof et al.,
1984
; Zuckerkandl,
1974
). These sequences adopt a `closed' chromatin structure;
nucleosomes are packaged into regular nucleosome arrays that correlate with
gene silencing (Cryderman et al.,
1998
; Cryderman et al.,
1999
; Sun et al.,
2001
; Wallrath and Elgin,
1995
). There are estimated to be at least 25 genes in
Drosophila called Suppressors of variegation
[Su(var)s] that modify heterochromatic gene silencing
(Weiler and Wakimoto, 1995
).
Three Su(var) gene products, HP1, SU(VAR)3-7 and SU(VAR)3-9, are
haplo-insufficient suppressors and triploenhancers of heterochromatic gene
silencing and are likely to play a central role in the molecular mechanism
underlying heterochromatin formation and silencing
(Schotta et al., 2003
).
HP1 has two conserved protein-protein interaction domains, the chromo
domain (CD) at the N terminus and the chromo shadow domain (CSD) at the C
terminus (Aasland and Stewart,
1995
; Paro and Hogness,
1991
). The CD forms a hydrophobic groove that binds to the MeK9H3
modification (Bannister et al.,
2001
; Jacobs et al.,
2001
; Lachner et al.,
2001
). A point mutation within the groove disrupts heterochromatic
gene silencing (Jacobs et al.,
2001
; Platero et al.,
1995
). The CSD homodimerizes
(Cowieson et al., 2000
) and
mediates interactions with a variety of nuclear factors
(Li et al., 2002
).
Dimerization of the CSD is required for some interactions with nuclear factors
that contain a penta-peptide motif (Brasher
et al., 2000
; Smothers and
Henikoff, 2000
). The CD and CSD are separated by a hinge region
that has been implicated in heterochromatin localization, interactions with
histone H1 and non-specific DNA, and chromatin binding
(Meehan et al., 2003
;
Nielsen et al., 2001
;
Smothers and Henikoff, 2001
;
Zhao et al., 2000
). Together,
these observations suggest that HP1 functions as a bridging protein connecting
heterochromatic proteins to centric regions.
Of importance is the interaction between the HP1 CSD and SU(VAR)3-9
(Schotta et al., 2002
;
Schotta et al., 2003
;
Yamamoto and Sonoda, 2003
).
The C-terminal SET domain of SU(VAR)3-9 possesses histone methyltransferase
activity that generates the MeK9H3 epigenetic mark recognized by the HP1 CD
(Bannister et al., 2001
;
Jacobs et al., 2001
;
Lachner et al., 2001
;
Nakayama et al., 2001
;
Rea et al., 2000
). A model to
explain heterochromatin spreading has been proposed where HP1 binds to MeK9H3
and recruits SU(VAR)3-9 (Bannister et al.,
2001
). The methyltransferase activity of SU(VAR)3-9 acting on
adjacent histones would generate new binding sites, allowing HP1 to spread
linearly along the chromatin fiber.
To determine whether HP1 is sufficient to nucleate silent chromatin and
spread along the chromosome we used a tethering system to recruit HP1 to
euchromatic sites within the genome of Drosophila melanogaster
(Li et al., 2003
;
Robinett et al., 1996
). In
this system, sequences encoding the DNA-binding domain of the E. coli
lacI repressor were fused to sequences encoding HP1 and placed under control
of the heat shock inducible promoter, hsp70. HP1 tethering was
achieved by expressing the lacI-HP1 fusion protein in Drosophila
stocks carrying a single insertion of a transposon consisting of lac
operator repeats upstream of two heat shock reporter genes. The association of
lacI-HP1 with the lac repeats results in silent chromatin formation
that spreads bi-directionally from the lac repeats and silences
expression of reporter genes located 1.9 and 3.7 kb from the tethering site.
Silencing correlated with alterations in chromatin structure that were similar
to those observed in centric heterochromatin. In a Su(var)3-9 mutant
background, silencing was minimally affected at 1.9 kb, but eliminated at 3.7
kb, suggesting that HP1-mediated silencing operates in a
SU(VAR)3-9-independent and -dependent manner.
| Materials and methods |
|---|
|
|
|---|
GFP-lacI fusion
The GFP-lacI fusion gene was isolated from pUdCE (gift from A.
Belmont) and cloned into pCaSpeR-hs-act.
lac-hsp26-hsp70 reporter transposon
The 256 copy lac operator repeat array (10 kb) was excised from
pSV2-dhfr.8.32 (gift from A. Belmont) and inserted into A412-plant
(Wallrath and Elgin,
1995
).
Germline transformation and genetic manipulation
Germline transformation
Stocks containing the GFP-lacI expressor transgene on the second
chromosome and the lac-hsp26-hsp70 reporter transposon on the
X-chromosome were generated using standard P-element transformation
(Rubin and Spradling, 1982
).
Stocks containing the lacI-HP1 expressor transgene on the second
chromosome have been previously described
(Li et al., 2003
).
P-element mobilization
To isolate additional insertions of the lac-hsp26-hsp70 reporter
transposon at different genomic positions, the transposon in stock hsp26-4D5
was mobilized using
2-3 transposase
(Robertson et al., 1988
).
Homozygous hsp26-4D:lacI-HP1;Su(var)3-906 stock
To study the effects of Su(var)3-9 on tethered HP1-induced gene
silencing, fly stocks were generated through multiple crosses that resulted in
a stock homozygous for the lac-hsp26-hsp70 reporter transposon on the
X-chromosome, lacI-HP1 on the second chromosome and
Su(var)3-906 (a null allele) on the third chromosome.
Heat shock induction
Drosophila cultures were incubated at 37°C for 45 minutes once
a day throughout development.
Inverse PCR
Inverse PCR (Li et al.,
2003
) was used to determine the insertion site for each
lac-hsp26-hsp70 reporter transposon. Sequences obtained were compared
to the Drosophila Genome Database (Release 3.1) using Fly Blast at
the Berkeley Drosophila Genome Project
(http://www.fruitfly.org/blast/).
Northern analysis
Total RNA was isolated from 25 larvae or 15-20 adult flies using TRIzol
Reagent (BRL Life Sciences) as described by the manufacturer. Total RNA (30
µg) was used in northern analyses and hybridized with radiolabeled
fragments corresponding to the unique barley sequence tag fused to
hsp26 or sequences corresponding to the white transgene.
Hybridization with sequences corresponding to the ribosomal gene,
rp49, served as a loading control. Radioactive counts from each
hybridization signal were quantitated using an Instant Imager (Packard).
Chromatin structure analysis
Nuclei were isolated from 1 g of third instar larvae or 5 ml of adult flies
and digested with micrococcal nuclease or XbaI restriction
endonuclease as previously described
(Wallrath and Elgin, 1995
).
The digested DNA was assayed by Southern analysis and hybridized with
fragments corresponding to the unique barley sequence tag fused to
hsp26. Radioactive counts from each hybridization signal were
quantitated using an Instant Imager (Pakard).
Chromatin immunoprecipitation (ChIP)
Salivary glands were dissected from third instar larvae in Ringers solution
(8 g NaCl, 0.20 g KCl, 1 g NaHCO3, 0.04 g
NaH2PO42H2O, 0.20 g
CaCl22H2O, 0.05 g MgCl26H2O and
1.00 g glucose in 1 l H2O) and crosslinked with 10% formaldehyde
for 10 minutes. The tissue was rinsed three times in wash buffer [10 mM
Tris-HCl (pH 8), 1 mM EDTA, 0.5 mM EGTA and 0.5 mM PMSF], frozen in liquid
nitrogen and stored at -80°C. The frozen tissue was thawed on ice in 200
µl of SDS lysis buffer [1% SDS, 10 mM EDTA, 50 mM Tris-HCl (pH 8)].
One-third volume of glass beads (Sigma G-1277) was added to each sample and
the tissue was sonicated using a Sonifier® Cell Disruptor (Heat Systems -
Ultrasonics) four times for 25 seconds in an ethanol-ice bath using the micro
tip. The tissue was diluted sixfold with IP buffer (0.01% SDS, 1.1% Triton
X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl pH8, 16.7 mM NaCl, 1 mM PMSF and 1
µg/µl aprotinin) and divided into 600 µl aliquots. One aliquot was
set aside as the input sample and the rest of the aliquots were pre-cleared
using 50 µl of 50% Protein A SepharoseTM CL-4B beads (Amersham
Biosciences) resuspended in IP buffer. The samples were rotated at 4°C for
2 hours. The beads were removed by centrifugation and 4 µl of polyclonal
HP1 antibodies (PRB-291, Covance) or 4 µl of polyclonal GFP antibodies
(A-6455, Molecular Probes) or no antibody was added to the samples. The
samples were rotated overnight at 4°C.
Multiple attempts to perform ChIP with HP1 monoclonal antibody C1A9 were
unsuccessful. Three polyclonal HP1 antibodies are currently commercially
available (Covance); however, these antibodies recognized multiple bands on
westerns of nuclear extracts from whole larvae and are designated for use with
only salivary glands by the manufacturer. Staining with HP1 antibody PRB291C
(Covance) showed colocalization with HP1 on polytene chromosomes and gives a
predominant band corresponding to the correct molecular weight of HP1 on
westerns of nuclear extracts from third instar salivary glands. Therefore,
salivary gland tissue was used as a source of starting material for the ChIP
analyses. The heat-shock reporter genes are robustly expressed in salivary
glands upon heat shock (Cryderman et al.,
1998
). Furthermore, salivary glands allow for cytological analyses
that provide supporting data for ChIP results.
Thirty microlitres of 50% Protein A sepharose beads were added to each chromatin/antibody sample and rotated at 4°C for 2 hours. Supernatants were collected into fresh tubes; the beads were washed with low salt wash buffer [0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-Cl (pH 8), 150 mM NaCl]; high salt buffer [0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-Cl (pH 8), 500 mM NaCl]; LiCl wash buffer (0.25 M LiCl, 1% NP-40, 1% deoxycholic acid (disodium salt), 1 mM EDTA (pH 8), and twice with TE buffer [10 mM Tris-Cl (pH 8) and 1 mM EDTA (pH 8)]. The beads were resuspend in 100 µl of TE buffer (pH 8) and RNase A was added to all samples (beads, supernatants and input) to a final concentration of 50 µg/ml and incubated at 37°C for 30 minutes. Then, SDS was added to a final concentration of 0.5% and Proteinase K to a final concentration of 100 µg/ml and the samples were incubated at 37°C overnight. The samples were then incubated at 65°C for 6 hours. The DNA was extracted once with phenol:chloroform:isoamyl alcohol (24:24:1) and twice with chloroform and then ethanol precipitated. The DNA pellet was suspended in 25 µl of TE buffer and assayed using PCR. The unique primers sets used were hsp26-1.9 kb, forward (5' CGAGGAAGAGCGTGTTGTAGG 3') and reverse (5' ACAACACCGACATGCTCTACAG 3'); hsp70-3.7 kb, forward (5' GCAACCAAGTAAATCAACTGC 3') and reverse (5' GTTTTGGCACAGCACTTTGTG 3'); 4D5-10.6 kb, forward (5' GAGCCAAGAAGATAAACACAC 3') and reverse (5' GAATAACAAAACGTTGTACCG 3'); 4D5-0.5 kb, forward (5'GCAACGTGTGCAACAAGAAG 3') and reverse (5' GTCTTCATGTGCGTATGCAG 3'); 4D5-3.1 kb, forward (5' GGAAGCACTCTCTAATTCAC 3') and reverse (5' CGCCGACTGATGGAAGTTGG 3'). Triplicate PCR reactions were performed with 26, 27 and 28 extension cycles to ensure that the PCR amplification was in the linear range. A Student's t-test was performed to determine the statistical significance between samples.
| Results |
|---|
|
|
|---|
|
4 kb 3' from the predicted transcription start
site of CG30428, the most distal gene on chromosome 2R. No TAS
elements characteristic of sub-telomeric regions are present within the 700 bp
of sequences that are currently available in FlyBase distal to the insertion
site, suggesting the transposon is not within telomeric chromatin. Finally,
the hsp26-87C1 insertion is within an
40 kb region of repeated
ß elements located within the hsp70 heat shock locus.
These
ß elements are transcribed along with the four endogenous
heat shock genes at 87C1 during heat shock induction
(Lis et al., 1981
|
To determine whether continual production of the lacI-HP1 fusion protein (produced from daily heat shock) was required for silencing, experiments were performed in which a single heat shock was given during embryogenesis and reporter genes expression was assayed during the third instar larval stage. Northern analysis revealed that 20% and 57% expression was observed for the hsp26 and hsp70 reporters, respectively, relative to expression in the absence of lacI-HP1, set at 100% (data not shown). These values are between the 5% expression observed with daily heat shock treatments and 100% expression in the absence of lacI-HP1. Multiple explanations could account for these results. First, partial silencing might be due to semi-stability of the silent chromatin state through mitosis. Second, partial silencing could be achieved from leaky expression of the hsp70 promoter that produces lacI-HP1 during times of non-heat shock. Low levels of lacI-HP1 could maintain the silent chromatin established during the embryonic heat shock. Third, partial silencing might be due to expression of lacI-HP1 during the larval heat shock treatment required to assay for heat-shock-inducible expression of the reporter genes. Given these experimental caveats, it is unclear whether silencing induced by the lacI-HP1 tethering system is stable through mitosis.
HP1 tethering alters chromatin structure
Heterochromatin-mediated gene silencing correlates with changes in
chromatin structure (Wallrath and Elgin,
1995
). The chromatin structure of the hsp26 promoter has
been well characterized in both euchromatic and heterochromatic locations; the
accessibility of the chromatin correlates with heat-shock inducibility
(Lu et al., 1993
;
Wallrath and Elgin, 1995
). In
euchromatin, the hsp26 promoter is potentiated for transcription
under non-heat shock conditions. Two DNase I hypersensitive sites are located
over the heat shock elements, RNA Pol II is paused downstream of transcription
start, TFIID is bound to the TATA box, GAGA factor is bound to
GA(n) elements and the coding region of the gene is packaged with
irregularly spaced nucleosomes (Cryderman
et al., 1998
; Cryderman et
al., 1999
; Wallrath and Elgin,
1995
). In a heterochromatic context, however, the DNase I
hypersensitive sites, transcription factors and polymerase are not detectable
at the promoter (Cryderman et al.,
1999
; Wallrath and Elgin,
1995
). Furthermore, the coding region is packaged into a regular
nucleosome array (Sun et al.,
2001
; Wallrath and Elgin,
1995
).
To determine whether silencing by lacI-HP1 alters the chromatin structure of the hsp26 reporter transgene, a restriction enzyme accessibility assay was performed. Nuclei were isolated from the hsp26-4D5 reporter stock under non-tethering, GFP tethering or HP1 tethering conditions and treated with an excess amount of XbaI. The hsp26 promoter contains three XbaI restriction sites that reside within two DNase I hypersensitive regions (Fig. 2A). After XbaI digestion, genomic DNA was purified and digested with SalI, which cleaves on either side of hsp26 (Fig. 2A). The purified DNA was used for Southern analysis and hybridized with radiolabeled sequences corresponding to the unique hsp26-tag. The digestion products consisted of a 3.0 kb SalI-SalI fragment (generated by cleavage only at the SalI sites), a 1.2 kb XbaIdistal-SalI fragment (generated from cleavage at either or both XbaI sites and the SalI site 3' of the hsp26 transgene), and a 0.8 kb XbaI proximal-SalI fragment (generated by cleavage at the proximal XbaI site and the SalI site 3' of the hsp26 transgene) (Fig. 2A,B). The percent accessibility of the hsp26 promoter was determined by calculating the percent of signal detected in the XbaIproximal-SalI fragment compared with the total signal produced by all three fragments. The proximal XbaI site in stock hsp26-4D5 was 45.9±6.7% (n=3) accessible during non-tethering conditions and 44.4±3.6% (n=3) accessible during GFP tethering. By contrast, the XbaI site was only 4.2±2.0% (n=3) accessible under HP1 tethering conditions (Fig. 2B). Similar accessibility results were demonstrated for stocks hsp26-87C1 and hsp26-54F5 (Table 1). Together, these data support the hypothesis that association of lacI-HP1 alters chromatin structure by forming a less accessible configuration.
|
HP1 spreads bi-directionally and associates with silenced transgenes
Genes brought into juxtaposition with heterochromatin are thought to be
silenced by the spread of heterochromatin-associated factors
(Weiler and Wakimoto, 1995
).
To determine whether silencing of the hsp26 and hsp70
reporter genes by tethered HP1 correlated with the spread of HP1 from the
tethering site, chromatin immunoprecipitation (ChIP) experiments were
performed. A PCR primer set corresponding to unique barley sequences within
the hsp26-tag, positioned 1.9 kb in the 3' direction from the
lac repeats, was used to amplify immunoprecipitated material from
stock hsp26-4D5. Two negative controls were used for these experiments. First,
anti-GFP antibodies were used during the immunoprecipitation of material
isolated from stocks expressing the lacI-HP1 fusion protein. This antibody
does not recognize endogenous proteins and serves as a non-specific antibody
control (NS). As a second control, HP1 antibodies were used during
immunoprecipitation of material isolated from stocks that did not express the
lacI-HP1 fusion protein, i.e. non-tethering (NT). At the
hsp26-tag sequences, 0.22±0.08% and 0.28±0.01% of input
material was immunoprecipitated for the NS and NT controls, respectively
(Fig. 3). By contrast,
2.94±0.34% of the input material was immunoprecipitated with HP1
antibodies when lacI-HP1 was associated with the lac repeats
(Fig. 3). These results
indicate that HP1 associates with the silenced hsp26 promoter
region.
|
To demarcate the limits of HP1 spreading, additional primer sets were designed to amplify endogenous sequences 5' and 3' of the lac repeats in stock hsp26-4D5. At sequences 10.6 kb in the 3' direction, 0.01±0.01% and 0.06±0.03% of the input material was immunoprecipitated for the NS and NT controls, respectively. Using HP1 antibodies, 0.09±0.02% of input material was immunoprecipitated when lacI-HP1 was associated with the repeats (Fig. 3B,C). These values are statistically similar to the negative controls. Thus, HP1 associates with sequences at least 3.7 kb, but not 10.6 kb, from the lac repeats in the 3' direction.
To determine the extent of HP1 association in the 5' direction, two primer sets were designed to sequences 0.5 kb and 3.1 kb from the lac repeats. At 0.5 kb, 0.01±0.01% and 0.08±0.04% of the input material was immunoprecipitated for the NS and NT controls, respectively. By contrast, 1.04±0.04% of the input material was immunoprecipitated with HP1 antibodies when lacI-HP1 was associated with the lac repeats indicating HP1 association at 0.5 kb in the 5' direction. When examining sequences at 3.1 kb, 0.07±0.02% and 0.08±0.02% of the input material were immunoprecipitated for the NS and NT controls, respectively. When HP1 was associated with the lac repeats 0.24±0.14% of input material immunoprecipitated with HP1 antibodies under tethering conditions. This value is statistically similar to that obtained for the NS and NT controls. Thus, HP1 associates at 0.5 kb, but not at 3.1 kb in the 5' direction. Collectively, the ChIP results demonstrate that HP1 associates with sequences in both the 3' and 5' direction from the lac repeats, suggesting bi-directional spreading (Fig. 3B,C). Furthermore, the amount of HP1 association decreases as distance from the lac repeats increases (Fig. 3B,C).
Effects of SU(VAR)3-9 on silencing
One model to explain the heterochromatin spreading relies on an interaction
between HP1 and SU(VAR)3-9 (Bannister et
al., 2001
; Lachner et al.,
2001
). As HP1 interacts directly with SU(VAR)3-9, HP1 has been
proposed to recruit SU(VAR)3-9, thereby causing methylation of adjacent
nucleosomes and subsequent binding of HP1
(Bannister et al., 2001
;
Lachner et al., 2001
;
Schotta et al., 2002
). This
process allows HP1 to bind the newly modified nucleosomes and spread linearly
along the chromosome. According to this model, lacI-HP1 induced silencing is
predicted to be dependent upon SU(VAR)3-9 activity. To test for this, the
expression of the hsp26 reporter transgene was analyzed in flies
homozygous for Su(var)3-906 (a null allele)
(Schotta et al., 2002
). The
heat-shock-induced expression of the hsp26 reporter (positioned 1.9
kb from the lac repeats) increased from 2% in the wild-type
background to 17% in the Su(var)3-906 mutant background
when lacI-HP1 was associated with the lac repeats
(Fig. 4A,C). This indicates
that substantial silencing persists even in the absence of SU(VAR)3-9. By
contrast, heat-shock-induced expression of the hsp70 transgene
(positioned 3.7 kb from the lac repeats) under HP1 tethering
conditions increased from 11.5% to 100% in the
Su(var)3-906 mutant background, equalling expression
levels of the non-tethering conditions
(Fig. 4). These data suggest
that the mechanism of HP1-mediated silencing at the hsp26 promoter
positioned 1.9 kb from the lac repeats is largely independent of
SU(VAR)3-9, whereas the mechanism of HP1-mediated silencing at the
hsp70 promoter positioned 3.7 kb from the lac repeats is
completely dependent on SU(VAR)3-9.
|
| Discussion |
|---|
|
|
|---|
Upon daily production of the lacI-HP1 fusion protein, silencing of the
reporter genes is observed at ectopic locations, even within regions of robust
transcriptional activity. By contrast, a single pulse of lacI-HP1 in the
embryo results in at best, partial silencing at the larval stage. This lack of
mitotic stability is reminiscent of results obtained using tethered Polycomb
(Pc), a protein required for the stable silencing of homeotic loci
(Müller, 1995
).
Faithfully inherited silencing was observed with a single pulse of Gal4-Pc
only when the transgene included a PRE (Polycomb Response Element), thought to
stabilize the silencing complex. To date, HP1-mediated gene silencing has been
shown to be relatively independent of DNA sequences; therefore, the continued
presence of HP1 appears to be required for heritability of the silenced
state.
Upon association of HP1 at these ectopic locations, we observe changes in
gene expression and chromatin structure at least 3.7 kb from the lac
repeat array. Sequences adjacent to the tethering site are relatively
inaccessible to nuclease digestion and packaged into regular nucleosome
arrays, mimicking a heterochromatic state. Such chromatin features are similar
to those that form over euchromatic genes when placed into juxtaposition with
heterochromatin. HP1 might cause chromatin reorganization through the
recruitment of chromatin remodeling factors. An interaction between HP1 and
chromatin remodeling machines has been documented in mammalian systems
(Nielsen et al., 2002
).
Chromatin reorganization might also occur through the spread of HP1 along the
chromosome. Our data clearly demonstrate HP1 association within the promoter
regions of silenced reporter genes up to 3.7 kb from the tethering site.
In contrast to the silencing over several kb shown here, an HP1 tethering
system using a stably integrated reporter gene in mammalian cell culture
demonstrated only short range effects over a few hundred base pairs
(Ayyanathan et al., 2003
). In
this case, HP1Hs
was recruited to a reporter transgene
through an interaction with tethered KRAB/KAP1 interaction partners. Silencing
and a less accessible chromatin structure were apparent at 0.28 kb from the
tethering site, but not at 2.78 kb. One possible explanation for the
difference between these two tethering studies might be that human
HP1Hs
and Drosophila HP1 have distinctly different
silencing mechanisms. We think this is unlikely as human
HP1Hs
localizes appropriately and rescues the lethality of
Su(var)2-5 mutants when expressed in Drosophila
(Ma et al., 2001
)
(Norwood et al., 2004
). A
second possibility is that lacI-HP1 overexpression enhances spreading, whereas
the KRAB/KAP1 system operates under endogenous levels of HP1. A third
explanation to account for the different results might be the manner in which
the HP1 proteins are recruited to the reporter gene. Using the lacI-HP1
tethering system, recruitment occurs through a heterologous DNA-binding domain
fused to the N terminus of HP1, thus leaving the CSD available for
homodimerization and/or interaction with other partners. In the KRAB/KAP1
tethering system, recruitment occurs through an interaction between the
HP1Hs
CSD and the transcriptional co-repressor KAP1, which
may limit its availability for interactions with partners that are required
for long distance spreading.
A model for HP1 in silent chromatin spreading
Transcriptional repressors can regulate gene expression over both short and
long distances. Short-range repressors such as Giant and Krüppel operate
at distances of less than 100 bp (Arnosti,
2003
; Nibu and Levine,
2001
). These repressors frequently bind to sites within the
promoter region and recruit histone deacetylases that locally deacetylate
histone tails (Shi et al.,
2003
; Subramanian and
Chinnadurai, 2003
). By contrast, long-range silencing is
hypothesized to involve the spread of silencing factors along the chromatin
fiber, deacetylation of histone tails and generation of the MeH9K3
modification throughout the region (Litt
et al., 2001
; Noma et al.,
2001
). In experiments described here, silencing was observed 3.7
kb from the HP1 tethering site, implying that HP1 acts as a long-range
silencer. Evidence of HP1 spreading is demonstrated by chromatin
immunoprecipitation experiments that place HP1 near the promoter region of the
silenced reporter genes. As the distance from the tethering site increases,
the amount of HP1 association decreases, supporting a linear spreading model
(Fig. 3B;
Table 1). However, these data
do not exclude the possibility that HP1 association and silencing occur
through a looping mechanism that is mediated by the `stickiness' of silencing
proteins (Li et al., 2003
;
Seum et al., 2001
;
Talbert and Henikoff,
2000
).
One proposed linear spreading model involves the association of HP1,
subsequent recruitment of SU(VAR)3-9, and methylation of adjacent histones,
forming new HP1-binding sites (Bannister et
al., 2001
; Lachner et al.,
2001
). We tested this model by examining the effects of HP1
tethering in a Su(var)3-9 mutant background. In the absence of
SU(VAR)3-9, HP1 induced silencing of the hsp26 reporter persisted at
1.9 kb from the tethering site. Consistent with this finding,
Su(var)3-906 also had virtually no effect on silencing of
a mini-white transgene positioned 0.5 kb from the HP1 tethering site
(Li et al., 2003
). Taken
together, these data suggest that silencing up to 1.9 kb is not heavily
dependent upon SU(VAR)3-9 activity. We speculate that HP1 might self-propagate
for a limited distance along the chromosome, perhaps by multimerization
through the CSD (Cowieson et al.,
2000
; Yamada et al.,
1999
) or by MeK9H3-independent interactions with histones
(Meehan et al., 2003
;
Smothers and Henikoff, 2001
;
Zhao et al., 2000
). The
introduction of HP1 mutants that abolish homodimerization into the tethering
system will shed light on this issue.
In contrast to the persistence of silencing at 1.9 kb in the
Su(var)3-9 mutant, a substantial loss of silencing was observed at
3.7 kb. Heat shock-induced expression of hsp70 during HP1 tethering
in a Su(var)3-906 mutant background was equal to
expression levels observed in the non-tethering and GFP-tethering conditions.
Several explanations could account for the different SU(VAR)3-9 requirements
observed for silencing the hsp26 and hsp70 reporters. First,
the hsp70 transgene promoter might be stronger than the
hsp26 transgene promoter. We think this is unlikely as the
hsp26 transgene appears to show greater fold induction than
hsp70 at all five of the genomic insertion sites tested here under
non-tethering conditions (Fig.
1B,C; data not shown). Second, the two heat shock genes could have
different mechanisms of transcriptional activation. This idea is inconsistent
with years of research demonstrating that the regulatory elements and
trans-activators for these two genes are nearly identical
(Amin et al., 1994
;
Glaser et al., 1990
;
Leibovitch et al., 2002
;
Lu et al., 1993
;
Mason and Lis, 1997
;
O'Brien and Lis, 1991
;
Thomas and Elgin, 1988
).
Alternatively, the differences observed might be due to multiple mechanisms of
HP1-mediated silencing. Silencing at long distances (between 1.9 and 3.7 kb)
may require SU(VAR)3-9, as current models for HP1 spreading would predict
(Bannister et al., 2001
;
Lachner et al., 2001
). By
contrast, silencing at short distances (less than 1.9 kb) is relatively
independent of SU(VAR)3-9, and would suggest alternate mechanisms of HP1
spreading that might involve self-propagation
(Yamada et al., 1999
). We
favor this model as several recent reports demonstrate that HP1 can be found
independently of SU(VAR)3-9 and MeK9H3 on chromosomes
(Cowell et al., 2002
;
Greil et al., 2003
;
Li et al., 2003
). In
particular, others have demonstrated that several genes silenced in
Drosophila Kc cells were associated with HP1, but not SU(VAR)3-9
(Greil et al., 2003
). Thus,
our understanding of the role of HP1 in gene regulation will depend upon
knowledge about the method of localization and the interaction partners at a
given genomic site.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Aasland, R. and Stewart, A. F. (1995). The
chromo shadow domain, a second chromo domain in heterochromatin-binding
protein 1, HP1. Nucleic Acids Res.
23,3168
-3174.
Amin, J., Fernandez, M., Ananthan, J., Lis, J. T. and Voellmy,
R. (1994). Cooperative binding of heat shock transcription
factor to the Hsp70 promoter in vivo and in vitro.
J. Biol. Chem. 269,4804
-4811.
Arnosti, D. N. (2003). Analysis and function of transcriptional regulatory elements: insights from Drosophila. Annu. Rev. Entomol. 48,579 -602.[CrossRef][Medline]
Ayyanathan, K., Lechner, M. S., Bell, P., Maul, G. G., Schultz,
D. C., Yamada, Y., Tanaka, K., Torigoe, K. and Rauscher, F. J., 3rd
(2003). Regulated recruitment of HP1 to a euchromatic gene
induces mitotically heritable, epigenetic gene silencing: a mammalian cell
culture model of gene variegation. Genes Dev.
17,1855
-1869.
Bannister, A. J., Zegerman, P., Partridge, J. F., Miska, E. A., Thomas, J. O., Allshire, R. C. and Kouzarides, T. (2001). Selective recognition of methylated lysine 9 on histone H3 by the HP1 chromo domain. Nature 410,120 -124.[CrossRef][Medline]
Brasher, S. V., Smith, B. O., Fogh, R. H., Nietlispach, D., Thiru, A., Nielsen, P. R., Broadhurst, R. W., Ball, L. J., Murzina, N. V. and Laue, E. D. (2000). The structure of mouse HP1 suggests a unique mode of single peptide recognition by the shadow chromo domain dimer. EMBO J 19,1587 -1597.[CrossRef][Medline]
Cowell, I. G., Aucott, R., Mahadevaiah, S. K., Burgoyne, P. S., Huskisson, N., Bongiorni, S., Prantera, G., Fanti, L., Pimpinelli, S., Wu, R. et al. (2002). Heterochromatin, HP1 and methylation at lysine 9 of histone H3 in animals. Chromosoma 111, 22-36.[CrossRef][Medline]
Cowieson, N. P., Partridge, J. F., Allshire, R. C. and McLaughlin, P. J. (2000). Dimerisation of a chromo shadow domain and distinctions from the chromodomain as revealed by structural analysis. Curr. Biol. 10,517 -525.[CrossRef][Medline]
Cryderman, D. E., Cuaycong, M. H., Elgin, S. C. and Wallrath, L. L. (1998). Characterization of sequences associated with position-effect variegation at pericentric sites in Drosophila heterochromatin. Chromosoma 107,277 -285.[CrossRef][Medline]
Cryderman, D. E., Tang, H., Bell, C., Gilmour, D. S. and
Wallrath, L. L. (1999). Heterochromatic silencing of
Drosophila heat shock genes acts at the level of promoter potentiation.
Nucleic Acids Res. 27,3364
-3370.
Eissenberg, J. C. and Elgin, S. C. (2000). The HP1 protein family: getting a grip on chromatin. Curr. Opin. Genet. Dev. 10,204 -210.[CrossRef][Medline]
Eissenberg, J. C., James, T. C., Foster-Hartnett, D. M.,
Hartnett, T., Ngan, V. and Elgin, S. C. (1990). Mutation in a
heterochromatin-specific chromosomal protein is associated with suppression of
position-effect variegation in Drosophila melanogaster.
Proc. Natl. Acad. Sci. USA
87,9923
-9927.
Fanti, L., Berloco, M., Piacentini, L. and Pimpinelli, S. (2003). Chromosomal distribution of heterochromatin protein 1 (HP1) in Drosophila: a cytological map of euchromatic HP1 binding sites. Genetica 117,135 -147.[CrossRef][Medline]
Glaser, R. L., Thomas, G. H., Siegfried, E., Elgin, S. C. and Lis, J. T. (1990). Optimal heat-induced expression of the Drosophila hsp26 gene requires a promoter sequence containing (CT)n.(GA)n repeats. J. Mol. Biol. 211,751 -761.[CrossRef][Medline]
Greil, F., van der Kraan, I., Delrow, J., Smothers, J. F., de
Wit, E., Bussemaker, H. J., van Driel, R., Henikoff, S. and van Steensel,
B. (2003). Distinct HP1 and Su(var)3-9 complexes bind to sets
of developmentally coexpressed genes depending on chromosomal location.
Genes Dev. 17,2825
-2838.
Jacobs, S. A., Taverna, S. D., Zhang, Y., Briggs, S. D., Li, J., Eissenberg, J. C., Allis, C. D. and Khorasanizadeh, S. (2001). Specificity of the HP1 chromo domain for the methylated N-terminus of histone H3. EMBO J. 20,5232 -5241.[CrossRef][Medline]
James, T. C., Eissenberg, J. C., Craig, C., Dietrich, V., Hobson, A. and Elgin, S. C. (1989). Distribution patterns of HP1, a heterochromatin-associated nonhistone chromosomal protein of Drosophila. Eur. J. Cell Biol. 50,170 -180.[Medline]
Kurdistani, S. K. and Grunstein, M. (2003). Histone acetylation and deacetylation in yeast. Nat. Rev. Mol. Cell Biol. 4,276 -284.[CrossRef][Medline]
Lachner, M., O'Carroll, D., Rea, S., Mechtler, K. and Jenuwein, T. (2001). Methylation of histone H3 lysine 9 creates a binding site for HP1 proteins. Nature 410,116 -120.[CrossRef][Medline]
Lehming, N., le Saux, A., Schuller, J. and Ptashne, M.
(1998). Chromatin components as part of a putative
transcriptional repressing complex. Proc. Natl. Acad. Sci.
USA 95,7322
-7326.
Leibovitch, B. A., Lu, Q., Benjamin, L. R., Liu, Y., Gilmour, D.
S. and Elgin, S. C. (2002). GAGA factor and the TFIID complex
collaborate in generating an open chromatin structure at the Drosophila
melanogaster hsp26 promoter. Mol. Cell Biol.
22,6148
-6157.
Li, Y., Danzer, J. R., Alvarez, P., Belmont, A. S. and Wallrath,
L. L. (2003). Effects of tethering HP1 to euchromatic regions
of the Drosophila genome. Development
130,1817
-1824.
Li, Y., Kirschmann, D. A. and Wallrath, L. L.
(2002). Does heterochromatin protein 1 always follow code?
Proc. Natl. Acad. Sci. USA
99,16462
-16469.
Lis, J. T., Prestidge, L. and Hogness, D. S. (1978). A novel arrangement of tandemly repeated genes at a major heat shock site in D. melanogaster. Cell 14,901 -919.[CrossRef][Medline]
Lis, J. T., Ish-Horowicz, D. and Pinchin, S. M.
(1981). Genomic organization and transcription of the alpha
beta heat shock DNA in Drosophila melanogaster.
Nucleic Acids Res. 9,5297
-5310.
Litt, M. D., Simpson, M., Gaszner, M., Allis, C. D. and
Felsenfeld, G. (2001). Correlation between histone lysine
methylation and developmental changes at the chicken beta-globin locus.
Science 293,2453
-2455.
Locke, J., Kotarski, M. A. and Tartof, K. D.
(1988). Dosage-dependent modifiers of position effect variegation
in Drosophila and a mass action model that explains their effect.
Genetics 120,181
-198.
Lohe, A. R. and Brutlag, D. L. (1986).
Multiplicity of satellite DNA sequences in Drosophila melanogaster.
Proc. Natl. Acad. Sci. USA
83,696
-700.
Lu, Q., Wallrath, L. L., Granok, H. and Elgin, S. C.
(1993). (CT)n (GA)n repeats and heat shock elements have distinct
roles in chromatin structure and transcriptional activation of the Drosophila
hsp26 gene. Mol. Cell Biol.
13,2802
-2814.
Ma, J., Hwang, K. K., Worman, H. J., Courvalin, J. C. and Eissenberg, J. C. (2001). Expression and functional analysis of three isoforms of human heterochromatin-associated protein HP1 in Drosophila. Chromosoma 109,536 -544.[Medline]
Mason, P. B., Jr and Lis, J. T. (1997).
Cooperative and competitive protein interactions at the hsp70
promoter. J. Biol. Chem.
272,33227
-33233.
Meehan, R. R., Kao, C. F. and Pennings, S. (2003). HP1 binding to native chromatin in vitro is determined by the hinge region and not by the chromodomain. EMBO J. 22,3164 -3174.[CrossRef][Medline]
Müller, J. (1995). Transcriptional silencing by the Polycomb protein in Drosophila embryos. EMBO J. 14,1209 -1220.[Medline]
Nakayama, J., Rice, J. C., Strahl, B. D., Allis, C. D. and
Grewal, S. I. (2001). Role of histone H3 lysine 9 methylation
in epigenetic control of heterochromatin assembly.
Science 292,110
-113.
Nibu, Y. and Levine, M. S. (2001).
CtBP-dependent activities of the short-range Giant repressor in the
Drosophila embryo. Proc. Natl. Acad. Sci. USA
98,6204
-6208.
Nielsen, A. L., Oulad-Abdelghani, M., Ortiz, J. A., Remboutsika, E., Chambon, P. and Losson, R. (2001). Heterochromatin formation in mammalian cells: interaction between histones and HP1 proteins. Mol. Cell 7,729 -739.[CrossRef][Medline]
Nielsen, A. L., Sanchez, C., Ichinose, H., Cervino, M., Lerouge, T., Chambon, P. and Losson, R. (2002). Selective interaction between the chromatin-remodeling factor BRG1 and the heterochromatin-associated protein HP1alpha. EMBO J. 21,5797 -5806.[CrossRef][Medline]
Noma, K., Allis, C. D. and Grewal, S. I.
(2001). Transitions in distinct histone H3 methylation patterns
at the heterochromatin domain boundaries. Science
293,1150
-1155.
Norwood, E. L., Grade, S. K., Cryderman, D. E., Hines, K. A.,
Furiasse, N., Toro, R., Li, Y., Dhasarathy, A., Kladde, M. P., Hendrix, M. J.
C. et al. (2004). Conserved properties of
HP1Hs
. Gene (in press).
O'Brien, T. and Lis, J. T. (1991). RNA
polymerase II pauses at the 5' end of the transcriptionally induced
Drosophila hsp70 gene. Mol. Cell Biol.
11,5285
-5290.
Paro, R. and Hogness, D. S. (1991). The
Polycomb protein shares a homologous domain with a heterochromatin-associated
protein of Drosophila. Proc. Natl. Acad. Sci.
USA 88,263
-267.
Platero, J. S., Hartnett, T. and Eissenberg, J. C. (1995). Functional analysis of the chromo domain of HP1. EMBO J. 14,3977 -3986.[Medline]
Rea, S., Eisenhaber, F., O'Carroll, D., Strahl, B. D., Sun, Z. W., Schmid, M., Opravil, S., Mechtler, K., Ponting, C. P., Allis, C. D. et al. (2000). Regulation of chromatin structure by site-specific histone H3 methyltransferases. Nature 406,593 -599.[CrossRef][Medline]
Richards, E. J. and Elgin, S. C. (2002). Epigenetic codes for heterochromatin formation and silencing: rounding up the usual suspects. Cell 108,489 -500.[CrossRef][Medline]
Robertson, H. M., Preston, C. R., Phillis, R. W.,
Johnson-Schlitz, D. M., Benz, W. K. and Engels, W. R. (1988).
A stable genomic source of P element transposase in Drosophila
melanogaster. Genetics
118,461
-470.
Robinett, C. C., Straight, A., Li, G., Willhelm, C., Sudlow, G.,
Murray, A. and Belmont, A. S. (1996). In vivo
localization of DNA sequences and visualization of large-scale chromatin
organization using lac operator/repressor recognition. J. Cell
Biol. 135,1685
-1700.
Rubin, G. M. and Spradling, A. C. (1982).
Genetic transformation of Drosophila with transposable element
vectors. Science 218,348
-353.
Schotta, G., Ebert, A., Krauss, V., Fischer, A., Hoffmann, J., Rea, S., Jenuwein, T., Dorn, R. and Reuter, G. (2002). Central role of Drosophila SU(VAR)3-9 in histone H3-K9 methylation and heterochromatic gene silencing. EMBO J. 21,1121 -1131.[CrossRef][Medline]
Schotta, G., Ebert, A. and Reuter, G. (2003). SU(VAR)3-9 is a conserved key function in heterochromatic gene silencing. Genetica 117,149 -158.[CrossRef][Medline]
Seeler, J. S., Marchio, A., Sitterlin, D., Transy, C. and
Dejean, A. (1998). Interaction of SP100 with HP1 proteins: a
link between the promyelocytic leukemia-associated nuclear bodies and the
chromatin compartment. Proc. Natl. Acad. Sci. USA
95,7316
-7321.
Seum, C., Delattre, M., Spierer, A. and Spierer, P. (2001). Ectopic HP1 promotes chromosome loops and variegated silencing in Drosophila. EMBO J. 20,812 -818.[CrossRef][Medline]
Shi, Y., Sawada, J., Sui, G., Affar el, B., Whetstine, J. R., Lan, F., Ogawa, H., Luke, M. P. and Nakatani, Y. (2003). Coordinated histone modifications mediated by a CtBP co-repressor complex. Nature 422,735 -738.[CrossRef][Medline]
Smothers, J. F. and Henikoff, S. (2000). The HP1 chromo shadow domain binds a consensus peptide pentamer. Curr. Biol. 10,27 -30.[CrossRef][Medline]
Smothers, J. F. and Henikoff, S. (2001). The
hinge and chromo shadow domain impart distinct targeting of HP1-like proteins.
Mol. Cell Biol. 21,2555
-2569.
Subramanian, T. and Chinnadurai, G. (2003). Association of class I histone deacetylases with transcriptional corepressor CtBP. FEBS Lett. 540,255 -258.[CrossRef][Medline]
Sun, F. L., Cuaycong, M. H. and Elgin, S. C.
(2001). Long-range nucleosome ordering is associated with gene
silencing in Drosophila melanogaster pericentric heterochromatin.
Mol. Cell Biol. 21,2867
-2879.
Talbert, P. B. and Henikoff, S. (2000). A
reexamination of spreading of position-effect variegation in the
white-roughest region of Drosophila melanogaster.
Genetics 154,259
-272.
Tartof, K. D., Hobbs, C. and Jones, M. (1984). A structural basis for variegating position effects. Cell 37,869 -878.[CrossRef][Medline]
Thomas, G. H. and Elgin, S. C. (1988). Protein/DNA architecture of the DNase I hypersensitive region of the Drosophila hsp26 promoter. EMBO J. 7,2191 -2201.