|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 27 July 2004
doi: 10.1242/dev.01289
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 Cancer Research UK, Developmental Genetics Laboratory, PO Box 123, 44
Lincoln's Inn Fields, London WC2A 3PX, UK
2 Max-Planck-Institut für Biophysikalische Chemie, Abt. Molekulare
Entwicklungsbiologie, Am Fassberg 11, 37077 Göttingen, Germany
3 University of Chicago, Department of Organismal Biology and Anatomy, CLSC
921B, 920 East 58th Street, Chicago, IL 60615, USA
Author for correspondence (e-mail:
uschmid{at}uchicago.edu)
Accepted 7 June 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Pair-rule, Developmental evolution, mRNA localisation, Cytoarchitecture, Diptera
| Introduction |
|---|
|
|
|---|
In the syncytial blastoderm embryo of the fruit fly Drosophila
melanogaster, transcripts of the pair-rule gene class are localised
asymmetrically to the apical side of a layer of peripheral nuclei
(Hafen et al., 1984
;
Ingham et al., 1985
;
Kilchherr et al., 1986
;
Macdonald et al., 1986
).
Pair-rule transcripts encode transcription factors that are expressed in
partially overlapping sets of seven circumferential stripes, and act in
combination to establish segmental organisation
(Pankratz and Jäckle,
1993
). The segment polarity gene wingless (wg),
which encodes an extracellular signalling molecule of the WNT family, also has
its transcripts localised apically. Localisation of wg mRNA augments
Wg signalling activity, although it is not yet clear by what mechanism this is
achieved (Simmonds et al.,
2001
).
A shared machinery localises pair-rule and wg transcripts during
embryogenesis (Wilkie and Davis,
2001
; Bullock and Ish-Horowicz,
2001
), and also translocates maternal mRNAs from their sites of
synthesis in the nurse cells into the early oocyte
(Bullock and Ish-Horowicz,
2001
). The localisation machinery involves active transport
towards the minus-ends of microtubules by the dynein/dynactin motor complex
(Wilkie and Davis, 2001
).
Transport also depends on the proteins Egalitarian (Egl) and Bicaudal-D (BicD)
(Bullock and Ish-Horowicz,
2001
). The machinery may be used widely because BicD and dynein
components are highly conserved in metazoans and Egl homologues are found in
the nematode C. elegans.
All the transcript cargoes studied to date have been shown to contain
localisation signals in their 3'-untranslated regions (3'-UTRs),
which must direct interaction with the transport machinery. RNA recognition is
dependent on secondary structure - localisation signals in different
transcripts consist of double-stranded stem-loops that share no overt primary
sequence similarity - although higher-order RNA folding may also be
significant (Macdonald and Kerr,
1998
; Bullock et al.,
2003
).
Although the mechanisms of pair-rule mRNA transport in the blastoderm
embryo are emerging, the developmental and evolutionary significance of this
process remains unclear. Pair-rule patterning is used in many insects, but RNA
signals for the dynein machinery have only been studied within the genus
Drosophila, where signals in the pair-rule transcript hairy
(h) (Bullock et al.,
2003
), as well as those of wg
(Simmonds et al., 2001
) and
the maternal transcript bicoid
(Macdonald, 1990
), are
functionally conserved. The conservation of h localisation in
drosophilids is not surprising, however, because these flies share very
similar blastoderm types. By contrast, blastoderm morphologies can differ
drastically in less closely related dipteran taxa
(Anderson, 1972
).
In this study, we have analysed transcript localisation of a large number of newly identified homologues of the pair-rule genes even-skipped (eve) and h, and of wg in multiple families of the insect order Diptera (true flies) by in situ hybridisation to endogenous transcripts and by injection of fluorescently labelled transcripts into Drosophila embryos. We show that Egl-dependent localisation signals are conserved in eve and h transcripts over 145 million years of evolution in higher (cyclorrhaphan) flies, indicating that this process is functionally significant, but absent in some, but not all, branches of lower Diptera. By contrast, wg transcript localisation appears to be conserved throughout Diptera. The phylogenetic occurrence of pair-rule transcript localisation suggests a selective advantage of this trait in species with a thickened peripheral cytoplasm and apically residing blastoderm nuclei. Consistent with this, we find that, in Drosophila, localisation of pair-rule mRNAs targets their proteins apically, in close proximity to the nuclei, and that interfering with localisation lowers the activity of pair-rule genes. We provide evidence that RNA localisation augments levels of protein within the nucleus and propose that, by affecting perinuclear translation, this mechanism may be used in a wide variety of organisms to modulate the activity of nuclear factors.
| Materials and methods |
|---|
|
|
|---|
Wild-type Drosophila embryos were of the Oregon-R strain.
eglWU50, eve1.27,
ftz13, hi22, kni1,
Kr1 and wgCX4 are reported to be
strong loss-of-function or null alleles. egl3e is a
partial loss-of-function allele that compromises the interaction of the
protein with dynein light chain (Navarro
et al., 2004
). For Fig.
5B, larvae heterozygous for the pair-rule gene mutation were
distinguished from wild types using balancer chromosomes marked with green
fluorescent protein (GFP) driven from the actin promoter
(Reichhart and Ferrandon,
1998
). Embryos of similar zygotic genotype but different maternal
origin were generated from reciprocal crosses (i.e. heterozygous pair-rule
mutant males were mated to egl mutant females and vice versa). Larval
cuticle preparations were performed as described
(Wieschaus and Nüsslein-Volhard,
1986
).
|
In situ hybridisation, immunostaining and RNA injections
In situ hybridisation was carried out essentially as described
(Lehmann and Tautz, 1994
;
Stauber et al., 2002
) using
NBT/BCIP and Fast Red (Roche) for colourimetric and fluorescent detection of
transcripts, respectively. Nuclei were stained by a 2 hours room temperature
incubation in 5 µg/ml of Alexa 660-wheat germ agglutinin (WGA; Molecular
Probes) in PBS. For immunostaining, we used mouse anti-Hairy (S. M.
Pinchin, unpublished) and guinea pig anti-Run
(Kosman et al., 1998
)
polyclonal primary antibodies and Alexa-488 or Alexa 594-conjugated secondary
antibodies (Molecular Probes).
Fluorescent, capped mRNAs incorporating Alexa-488- (Molecular Probes), Cy3-
or Cy5-UTP (Perkin Elmer) were synthesised as described
(Bullock and Ish-Horowicz,
2001
). Briefly, for each transcript, 250 ng/µl solutions were
injected into nuclear cycle 14 blastoderm embryos which were fixed
8
minutes after injection of the last embryo (
11 minutes after injection of
the first). Anti-Egl antibody (Mach and
Lehmann, 1997
) was injected 10 minutes before the RNAs.
Expression of localising and non-localising h transcripts
To guard against potential dominant lethality arising from expression of
non-localising transcripts, we used a conditional expression system in which
an upstream FRT-stop-FRT cassette terminates transcription and prevents
transgene expression unless excised using FLP recombinase
(Struhl et al., 1993
). We
cloned the wild-type h cDNA, or one containing the
h
D deletion that removes 20 nucleotides required for
localisation (Bullock et al.,
2003
), appended to 3' h genomic sequences
containing the polyadenylation signal, into a unique PmeI site within
the Drosophila transformation vector P{w+mC (eve2)2
>hsp70 3'>}, a derivative of P{w+mC
(eve2)2 >hsp70 3'> eve3'}
(Wu et al., 2001
) with the
eve 3'UTR removed. h fragments were generated by PCR
(details available upon request) and the h-coding regions in the
final constructs were sequenced to ensure that no mutations were introduced.
The resultant constructs (P{w+mC (eve2)2 >hsp70
3'> hwt} and P{w+mC (eve2)2
>hsp70 3'> h
Dnloc}
contain two copies of a minimal eve stripe 2 enhancer that, following
excision of the stop signal, drive expression of h in parasegment 3
(Kosman and Small, 1997
). In
the event, removal of the transcriptional terminating sequence in the male
germ-line with the ß2-tubulin-FLP transgene
(Struhl and Basler, 1993
)
yielded viable transgenic lines which were used in all the experiments
described here. To quantitate levels of st2-h expression in different
lines, we generated cDNA from 150-300 blastoderm embryos 2.5-3.25 hours after
egg laying at 25°C from crosses of homozygous flies (nlocA, B and
C; wtA and B) or heterozygous flies when homozygous
lines were lethal (nlocD; wtD) or semi-lethal (wtC). The
data shown in Fig. 6E are
normalised for gene dosage. We used real-time PCR with TaqmanTM probes to
quantify amounts of activated st2-h cDNA relative to actin
5C cDNA using the comparative CT method described by the
manufacturers (PerkinElmer). The Taqman probes (used at 0.1 µM) and primers
(0.4 µM each) were as follows: st2-h 5' GTGACCGCCGCACAGTC;
st2-h 3' AACTTCAAGATCCCCATTCAAAGT; st2-h TaqmanTM
probe CAACTAACTGCCTTCGTTAATATCCTCTGAATAAGCC; Actin 5'
GGTTTATTCCAGTCATTCCTTTCAA; Actin 3' ACTGTAAACGCAAGTGGCGA; Actin
TaqmanTM probe CCGTGCGGTCGCTTAGCTCAGC.
|
| Results |
|---|
|
|
|---|
|
|
In Megaselia, eve and h transcripts are tightly localised
apically throughout blastoderm stages, much like their counterparts in
Drosophila (Fig.
2H,R). In these species blastoderm embryos have a thickened
blastoderm with nuclei that reside apically throughout the cellularisation
process (Fig. 2F-H). In
Episyrphus, transcripts are also enriched apically, but in contrast
to Drosophila and Megaselia, a substantial proportion of the
mRNA accumulates in the basal cytoplasm
(Fig. 2G,Q). Early
Episyrphus blastoderm embryos also have apical nuclei. However, in
this species the nuclei adopt a more central position during the
cellularisation process, at a time when pair-rule genes are active (see Fig.
S2 at
http://dev.biologists.org/supplemental).
In Clogmia and Coboldia, however, eve and
h transcripts are distributed evenly throughout the cytoplasm and
these species have a thin blastoderm with little cytoplasm surrounding the
nuclei (Fig. 2I,J,S,T). These
results suggest that localisation of pair-rule transcripts is not associated
with pair-rule patterning per se and that a requirement for the apical
localisation of pair-rule genes may be influenced by the cytoarchitecture of
the blastoderm. In addition, the apical localisation of eve and
h mRNAs in diverse cyclorrhaphan flies that evolved independently for
145 million years (Grimaldi and
Cumming, 1999
) indicates that pair-rule transcript localisation is
functionally significant.
Apical localisation of wg transcripts throughout Diptera suggests a conserved localisation machinery
To test whether the localisation machinery is active in transporting other
transcripts in Clogmia and Coboldia, we cloned homologues of
wg (Fig. 1,
Fig. 3A-C, Fig. S1 at
http://dev.biologists.org/supplemental),
which encodes an extracellular signalling protein, from these species. In
Drosophila, wg transcripts are localised apically in late blastoderm
(Fig. 3D) and cellularised
postgastrular embryos (Fig.
3G). We find that wg transcripts are also enriched
apically in Coboldia embryos at equivalent stages
(Fig. 3E,H). This suggests that
the Egl/BicD/dynein localisation machinery is active, and that the failure of
Coboldia-eve and -h transcripts to localise reflects a lack
of mRNA localisation signals.
|
Localisation signals in pair-rule genes are evolutionarily labile
We wanted to survey localisation of eve and h orthologues
in additional species in order to gain further insights into the phylogenetic
occurrence of pair-rule mRNA localisation. However, embryos from many
phylogenetically informative taxa are not available for in situ hybridisation.
We therefore used injection of fluorescently labelled transcripts into
Drosophila embryos (Bullock and
Ish-Horowicz, 2001
; Wilkie and
Davis, 2001
) to test for localisation signals in eve, h
and wg homologues cloned from other dipteran species. Each labelled
RNA included a region of coding sequence as well as the full-length
3'UTR (Table S1 at
http://dev.biologists.org/supplemental).
The distribution of all 11 injected Megaselia, Episyrphus, Clogmia
and Coboldia transcripts mirrors closely their endogenous
distributions observed by in situ hybridisation
(Fig. 2,
Fig. 3,
Fig. 4A,B). In all cases,
apical accumulation of localising transcripts is prevented by pre-injecting
Drosophila embryos with antibodies that specifically inhibit Egl
function (Bullock and Ish-Horowicz,
2001
) (not shown). Based on these data, we believe that RNA
injection into Drosophila blastoderm embryos provides a reliable tool
for detecting Egl/BicD/dynein-dependent localisation signals throughout
Diptera. The similarities between localisation of endogenous and injected
transcripts indicates that the specificity of the RNA recognition factors has
changed little during more than 210 million years of dipteran evolution,
presumably because it is constrained by the need to recognise multiple cargoes
in different cell types.
|
We detected localisation signals in wg and three out of four
tested pair-rule transcripts of the Malaria mosquito Anopheles
[odd skipped (odd), fushi tarazu (ftz)
(not shown) and h (Fig.
4A); a signal was not found in the full-length eve
transcript]. The presence of localisation signals in pair-rule genes of this
lower dipteran is interesting, because similar blastoderm types appear to have
evolved convergently in the cyclorrhaphan and the culicomorphan branch of
Diptera to which Anopheles belongs
(Ivanova-Kasas, 1949
;
Anderson, 1972
;
Monnerat et al., 2002
). Of
Empis-eve, Haematopota-h and Haematopota-eve - transcripts
from species that are more closely related to cyclorrhaphan flies than
Anopheles, Clogmia and Coboldia - only the last localises
upon injection into Drosophila. Although the injection assay does not
allow us to discern the developmental context in which localisation signals
are used, the results corroborate our conclusion from the analysis of mRNA
localisation in situ (Fig. 2,
Fig. 3), that, in Diptera,
localisation of wg transcripts is conserved, whereas localisation of
pair-rule transcripts is labile.
We could not detect any significant stretches of conserved primary sequence
in 3' UTRs of localising transcripts. This is not surprising, however,
because efficient signal recognition by the localisation machinery can be
mediated by multiple, partially redundant interactions in which the essential
features are contained within short stretches of base-paired RNA
(Macdonald and Kerr, 1998
;
Bullock et al., 2003
). Even
within the genus Drosophila, the primary sequence of the h
localisation signal has diverged significantly
(Bullock et al., 2003
).
Suppression of pair-rule transcript localisation in Drosophila alters pair-rule protein distribution and reduces pair-rule gene activity
The apparent correlation between apical pair-rule transcript localisation
and apical-residing nuclei led us to the hypothesis that apical transcript
localisation augments nuclear uptake of the transcription factor products of
the pair-rule genes by targeting translation apically, in close proximity to
the nuclei. We therefore assayed the consequences of disrupting pair-rule mRNA
localisation in embryos of Drosophila melanogaster. Because
components of the pair-rule mRNA localisation machinery are also required
maternally for differentiation of the oocyte
(Deng and Lin, 2001
), we used a
partial loss-of-function allele of egl
(Navarro et al., 2004
), which
provides sufficient Egl function to overcome the earlier block in oogenesis.
Females that have one copy of this allele (egl3e) and one
copy of a null allele (eglWU50) lay eggs,
40-60% of
which are fertilised and develop to blastoderm stages. Whereas embryos laid by
wild-type mothers have an almost exclusively apical distribution of pair-rule
mRNAs such as eve, ftz, h and runt (run), those
laid by egl3e/eglWU50 mothers accumulate a
large proportion of these transcripts in the basal cytoplasm
(Fig. 5A). A slight apical
enrichment of pair-rule mRNAs is still detectable in most stripes in these
mutants (Fig. 5A), consistent
with their retention of some Egl activity.
The defect in transcript localisation in egl mutant embryos also affects the subcellular distribution of pair-rule proteins (Fig. 5A). For example, in wild-type blastoderm embryos, Run protein is first detected predominantly in the apical cytoplasm (not shown); in slightly older blastoderms, the bulk of this protein has accumulated in the nuclei but a proportion of it is still detected in the apical cytoplasm (Fig. 5A). In egl-deficient embryos, more diffuse cytoplasmic Run protein staining is also detected basally, similar to the distribution of its transcripts (Fig. 5A). We also observed basal accumulation of other pair-rule proteins in egl mutants (not shown), but the width and intensity of protein stripes as well as protein levels are not altered noticeably (not shown). Together, these observations suggest that pair-rule transcript localisation targets protein to the apical cytoplasm prior to import into the nuclei.
In embryos from egl mutant mothers, the apical localisation of wg transcripts is very strongly reduced (Fig. 5A) but, despite the inefficient localisation of these and pair-rule mRNAs, segmentation is only slightly impaired. Some (7.4%; n=136) egl3e/eglWU50 blastoderm embryos show variable defects in the pattern of segmental engrailed expression (not shown), whereas only 1.3% of embryos from the reciprocal cross - i.e. wild-type mothers mated to egl3e/eglWU50 males - exhibit such defects (n=309; P<0.01; Fisher's exact test). The frequency of mild cuticular patterning defects in first instar larvae from egl mutant females is also increased (3.1%, n=349) compared with wild-type controls (0.7%, n=420; P<0.05; Fig. 5B).
However, egl mutant embryos are acutely sensitive to a reduction in pair-rule gene dose (Fig. 5B,C). For example, 32.4% of hi22/h+ first instar larvae from egl3e/eglWU50 mothers have pair-rule defects, compared with 3.2% from wild-type mothers (P<0.001). These genetic interactions do not reflect a general sensitivity of early patterning processes to a reduction in Egl function, however, because phenotypes caused by heterozygosity of gap genes such as Krüppel (Kr) and knirps (kni) - which function upstream of the pair-rule genes in segmentation, and whose transcripts are not localised asymmetrically - and wg are not enhanced significantly by the maternal egl mutant genotype (Fig. 5B).
These experiments suggest that apical localisation of pair-rule mRNAs and proteins enhance their activity, although they do not rule out entirely a role for Egl independent of its function in pair-rule transcript localisation. Nor do they address the consequences of completely blocking localisation of a pair-rule mRNA, because the egl mutants still retain some transport activity.
We therefore assayed the activity of a pair-rule protein encoded either by
localising transcripts or by transcripts distributed uniformly in the
cytoplasm. Wild-type h transcripts or transcripts lacking 20
nucleotides within the 3'UTR that are essential for RNA transport [the
h
D mutation
(Bullock et al., 2003
)] were
misexpressed in the eve stripe 2 domain, and assayed for their
ability to repress stripe 2 of the h target gene ftz, which
leads to deletions in the larval mesothorax (segment T2). As the effects in
this assay are dose dependent (Wu et al.,
2001
), it is well suited to probe for subtle differences in
activities. As expected, lines bearing transgenes that encode the wild-type
3'-UTR produce apically localised transcripts
(st2-hwt lines; Fig.
6B), whereas those expressing the mutant 3'UTR give rise to
transcripts distributed uniformly in the cytoplasm
(st2-hnloc lines; Fig.
6C). We did not observe significant differences in the width of
the stripe of localising or nonlocalising ectopic h transcripts using
a probe that distinguishes st2-h from endogenous h (not
shown).
Lines bearing localising or non-localising transcripts of st2-h can lead to defects in T2 (Fig. 6D), demonstrating that nonlocalising transcripts encode functional protein. To distinguish effects of expression level and mRNA localisation, we used real-time RT-PCR to quantitate levels of st2-h mRNA relative to those of endogenous actin mRNA levels in each transgenic line (Fig. 6E). Comparing lines expressing similar levels of st2-h transcript indicates that T2 defects are more severe and penetrant when transcripts localise apically (Fig. 6D). Consistent with this, localised st2-h RNA is more efficient at repressing ftz transcription than unlocalised transcripts (Fig. 6I,J; see Table S2 at http://dev.biologists.org/supplemental). Only in very strongly expressing lines (st2-hwtD and st2-hnlocD) do the ectopic transcripts cause equivalent phenotypes (disruption of T2 in over 90% of embryos), indicating that high expression levels can overcome the requirement for apical mRNA localisation. We estimate that in moderately expressing lines, localising st2-h transcripts have similar effects to two- to threefold more nonlocalising transcripts (Fig. 6D,E). Consistent with our analysis of egl mutant embryos, these data indicate that apical mRNA localisation augments pair-rule activity.
To investigate how localising mRNA enhances h activity, we compared the level of Hairy protein in the eve stripe 2 domain of transgenic lines encoding localising and non-localising st2-h transcripts. We found that levels of the protein in nuclei of the eve stripe 2 domain are clearly lower in st2-hnlocC than in st2-hwtB (Fig. 6K-N), even though the former expresses significantly more transcript. Although the anti-Hairy antibody is not sufficiently sensitive to detect cytoplasmic Hairy protein above background, we observe a diffuse distribution of several other pair-rule proteins in the basal cytoplasm when apical pair-rule RNA localisation is compromised in egl mutants (see above). In addition, when an excess of in vitro synthesised wild-type h RNA is injected, Hairy protein is detected in the apical cytoplasm, whereas when transcripts are injected that contain the same inactivating deletion in the localisation signal carried by the st2-hnloc lines Hairy protein is detected uniformly throughout the cytoplasm (not shown). Together, these data argue that apical h RNA localisation targets protein apically, in close proximity to the nuclei.
| Discussion |
|---|
|
|
|---|
Unlike wg transcripts, pair-rule mRNAs do not localise in some
branches of lower Diptera, and the phylogenetic occurrence of this process
provides interesting insights into its functional significance. Enrichment of
pair-rule transcripts in the apical cytoplasm correlates with the position of
blastoderm nuclei: efficient apical localisation of pair-rule gene transcripts
is found in species which retain an asymmetric apical position of nuclei
throughout the blastoderm stage (Drosophila, Megaselia); less
efficient localisation is seen when the nuclei move from an apical to a more
central position during blastoderm stages (Episyrphus); and no apical
enrichment of transcripts is seen in species where blastoderm nuclei are
surrounded uniformly by a thin layer of cytoplasm (Coboldia,
Clogmia). We also find localisation signals in several pair-rule
transcripts of the lower dipteran Anopheles. Like Cyclorrhapha, but
unlike many other lower Diptera and most other insects, this culicid species
has evolved a thickened blastoderm with apically positioned nuclei, probably
to allow rapid development as an adaptation to ephemeral larval habitats
(Anderson, 1972
;
Ferrar, 1987
): columnar cells
that emerge from thickened blastoderms can enter gastrulation directly,
whereas cuboidal cells that emerge from thin blastoderms still have to
elongate prior to undergoing the requisite cell shape changes.
In Drosophila, we find that pair-rule proteins are enriched in the
apical cytoplasm prior to import into the nuclei in wild-type blastoderms,
whereas they are detected basally in egl mutant embryos, in which
transcript localisation is inefficient. The apical accumulation of pair-rule
proteins under normal circumstances is consistent with the observation that
apical RNA targeting restricts diffusion of cytoplasmic ß-galactosidase
(Davis and Ish-Horowicz, 1991
).
Apically targeted protein is most likely confined by the cellularisation
process, in which the plasma membrane invaginates between the nuclei and
encloses the apical compartment first (Fig.
7).
|
By what mechanism does pair-rule mRNA localisation augment the activity of
their transcription factor products? We demonstrate for h that
suppression of transcript localisation reduces nuclear levels of its protein.
Pair-rule proteins could be specifically modified in the apical cytoplasm, or
localising transcripts could be translated more efficiently. However, given
the diffuse distribution of pair-rule proteins in the basal cytoplasm when RNA
localisation is disrupted in egl mutants and the correlation between
cytoarchitecture and pair-rule transcript localisation in Diptera, we favour a
third possibility, namely that apical mRNA localisation increases nuclear
uptake of their proteins by targeting translation in close proximity to the
nuclei (Fig. 7). Proteins from
non-localising mRNAs would not be available at high levels in the immediate
vicinity of the nuclei, which would result in a decreased nuclear uptake. Such
a role for apical pair-rule mRNA localisation would be redundant in lower
Diptera with only a thin layer of cytoplasm surrounding the nuclei, which
provides little room for diffusion of pair-rule proteins prior to nuclear
import. A mechanism for perinuclear protein targeting might be particularly
significant for nuclear proteins with short half-lives, such as those encoded
by pair-rule genes (Edgar et al.,
1987
). Interestingly, localisation of mRNA in the vicinity of the
nucleus to aid import of nuclear proteins has also been reported in cultured
mammalian cells (Levadoux et al.,
1999
) and may be a widespread mechanism to efficiently exploit a
limited pool of transcripts in cells that are polarised or have a high
cytoplasmic:nuclear ratio.
The relationship between cytoarchitecture and apical pair-rule transcript localisation does not appear to be absolute because we detected a signal in eve, but not h, from Haematopota, which has retained the ancestral, cuboidal blastoderm morphology (U.S.-O., unpublished) and because we did not detect a localisation signal in Anopheles-eve. Although we cannot yet discern the developmental context in which these signals are used (in situ hybridisation is currently not possible in these species because of egg shells that are difficult to remove and because of difficulties in obtaining embryos) these data raise the possibility that, within a single species, the differential ability of transcripts to be recognised by the localisation machinery is used to fine-tune transcriptional control of target genes in the blastoderm by modulating the nuclear concentration of pair-rule proteins.
The efficiency of transcript localisation is modified gradually in evolution
The ability of eve and h pair-rule transcripts to use the
localisation machinery varies in Diptera. We observe a range of localisation
efficiencies in situ that are mirrored in all 11 cases upon injection into
Drosophila embryos. Thus, differences in localisation efficiency
appear to reflect changes in the respective localisation signals, rather than
alterations in the specificity of the protein machinery. These findings are
consistent with previous studies with artificial variants of the
Drosophila-h localisation signal, which suggest that the character of
localisation signals modulates the efficiency of localisation by determining
the kinetics of both the initiation of transport and the transport process
itself (Bullock et al., 2003
).
Localisation efficiency appears to be determined by multiple RNA:protein
interactions, the sum of which affects the stability and/or activity of the
RNA:motor complex (Macdonald and Kerr,
1998
; Chartrand et al.,
2002
; Bullock et al.,
2003
). Therefore, the efficiency of the localisation process can
be modified gradually during evolution by the addition, loss or modification
of individual recognition sites within mRNAs.
It seems that localisation signals in pair-rule genes have emerged multiple times within Diptera. For example, although we cannot rule out the possibility that localisation signals in h have been lost in multiple different lineages of lower Diptera, the most parsimonious explanation for the phylogenetic distribution of signals in this transcript is that they evolved independently in response to changes in cytoarchitecture in the lineages leading to Cyclorrhapha and Culicomorpha. Injection of transcripts from additional species into Drosophila will determine whether eve localisation signals emerged independently in the lineages leading to Haematopota and Cyclorrhapha, or were lost in the lineage leading to Empis.
Work in mammalian cells has provided insights into how localisation signals
might initially appear (Fusco et al.,
2003
). These studies suggest that non-localising mRNAs can also
interact with a motor complex, albeit with a comparatively small probability,
and undergo short movements on microtubules. Localisation signals appear to
augment these interactions and lead to the net translocation of an RNA
population along a polarised cytoskeleton by increasing the frequency and
duration of directed transport (Fusco et
al., 2003
). The localisation machinery in Diptera may also have a
general, weak affinity for mRNAs because a small proportion of particles of
injected non-localising transcripts are transported over short distances in
Drosophila embryos (M. Wainwright and S.B., unpublished). Asymmetric
accumulation of a population of transcripts may therefore evolve gradually as
a result of selection for increased interaction between a specific transcript
and the localisation machinery.
Concluding remarks
Using a combination of functional and phylogenetic analyses, we have
provided evidence that the alteration of mRNA localisation signals is an
important mechanism by which the activity of pair-rule transcription factors
is regulated in flies. Apical localisation of these transcripts appears to
augment the nuclear concentration of their protein products and makes the
segmentation process less sensitive to perturbation of gene activity. It seems
that different species have made use of the localisation machinery to adapt
the deployment of specific pools of transcripts to evolutionary changes in
blastoderm cytoarchitecture. Thus, the mRNA localisation mechanism may permit
networks of patterning genes to tolerate changes in cell morphology, such as
those imposed by reproductive adaptations.
In Drosophila, transport of mRNAs by the Egl/BicD/dynein machinery
determines the distributions of several different kinds of proteins in diverse
cell types such as oocytes, epithelial cells and neuroblasts
(Bullock and Ish-Horowicz,
2001
) (J.H., unpublished). Our studies of pair-rule mRNAs imply
that the repertoire of other RNA cargoes for the machinery, and their
efficiency of transport, may also be modulated readily in evolution through
changes in localisation signals. Therefore, differential mRNA localisation is
potentially an important factor in facilitating morphological evolution.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
* These authors contributed equally to this work ![]()
| REFERENCES |
|---|
|
|
|---|
Anderson, D. T. (1972). The development of holometabolous insects. In Developmental systems: insects (ed. S. J. Counce and C. H. Waddington), pp.165 -242. London, UK: Academic Press.
Bullock, S. L. and Ish-Horowicz, D. (2001). Conserved signals and machinery for RNA transport in Drosophila oogenesis and embryogenesis. Nature 414,611 -616.[CrossRef][Medline]
Bullock, S. L., Zicha, D. and Ish-Horowicz, D. (2003). The Drosophila hairy RNA localization signal modulates the kinetics of cytoplasmic mRNA transport. EMBO J. 22,2484 -2494.[CrossRef][Medline]
Chartrand, P., Meng, X. H., Huttelmaier, S., Donato, D. and Singer, R. H. (2002). Asymmetric sorting of ash1p in yeast results from inhibition of translation by localization elements in the mRNA. Mol. Cell. 10,1319 -1330.[CrossRef][Medline]
Collins, K. P. and Wiegmann, B. M. (2002). Phylogenetic relationships of the lower Cyclorrhapha (Diptera: Brachycera) based on 28S rDNA sequences. Insect Syst. Evol. 33,445 -456.
Davis, I. and Ish-Horowicz, D. (1991). Apical localization of pair-rule transcripts requires 3' sequences and limits protein diffusion in the Drosophila blastoderm embryo. Cell 67,927 -940.[CrossRef][Medline]
Deng, W. and Lin, H. (2001). Asymmetric germ cell division and oocyte determination during Drosophila oogenesis. Int. Rev. Cytol. 203,93 -138.[Medline]
Edgar, B. A., Odell, G. M. and Schubinger, G.
(1987). Cytoarchitecture and the patterning of fushi
tarazu expression in the Drosophila blastoderm. Genes
Dev. 1,1226
-1237.
Ferrar, P. (1987). A guide to the breeding habits and immature stages of Diptera Cyclorrhapha. Entomonograph 8,907 .
Fusco, D., Accornero, N., Lavoie, B., Shenoy, S. M., Blanchard, J.-M., Singer, R. H. and Bertrand, E. (2003). Single mRNA molecules demonstrate probabilistic movement in living mammalian cells. Curr. Biol. 13,161 -167.[CrossRef][Medline]
Grimaldi, D. and Cumming, J. (1999). Brachyceran Diptera in cretacaceous ambers and mesozoic diversification of the Eremoneura. Bull. Am. Mus. Nat. Hist. 239, 1-124.
Hafen, E., Kuroiwa, A. and Gehring, W. J. (1984). Spatial distribution of transcripts from the segmentation gene fushi tarazu during Drosophila embryonic development. Cell 37,833 -841.[CrossRef][Medline]
Ingham, P. W., Howard, K. R. and Ish-Horowicz, D. (1985). Transcription pattern of the Drosophila segmentation gene hairy. Nature 321,493 -499.[CrossRef]
Ivanova-Kasas, O. M. (1949). Embryological development of Anopheles maculipennis Mg. Izv. Akad. Nauk. SSSR Ser. Biol. 2,140 -170.
Job, C. and Eberwine, J. (2001). Localization and translation of mRNA in dendrites and axons. Nat. Rev. Neurosci. 2,889 -898.[CrossRef][Medline]
Kilchherr, F., Baumgartner, S., Bopp, D., Frei, E. and Noll, M. (1986). Isolation of the paired gene of Drosophila and its spatial expression during early embryogenesis. Nature 321,493 -499.[CrossRef]
Kislauskis, E. H., Zhu, X. and Singer, R. H.
(1997). ß-Actin messenger RNA localization and
protein synthesis augment cell motility. J. Cell Biol.
136,1263
-1270.
Kloc, M., Zearfoss, N. R. and Etkin, L. D. (2002). Mechanisms of subcellular mRNA localization. Cell 108,533 -544.[CrossRef][Medline]
Kosman, D. and Small, S. (1997). Concentration-dependent patterning by an ectopic expression domain of the Drosophila gap gene knirps. Development 124,1343 -1354.[Abstract]
Kosman, D., Small, S. and Reinitz, J. (1998). Rapid preparation of a panel of polyclonal antibodies to Drosophila segmentation proteins. Dev. Genes Evol. 208,290 -294.[CrossRef][Medline]
Lehmann, R. and Tautz, D. (1994). In situ hybridization to RNA. In Drosophila melanogaster: Practical uses in cell and molecular biology (ed. L. S. B. Goldstein and E. A. Fyrberg), pp. 575-598. San Diego, CA: Academic Press.
Levadoux, M., Mahon, C., Beattie, J. H., Wallace, H. M. and
Hesketh, J. E. (1999). Nuclear import of metallothionein
requires its mRNA to be associated with the perinuclear cytoskeleton.
J. Biol. Chem. 274,34961
-34966.
Long, R. M., Singer, R. H., Meng, X., Gonzalez, I., Nasmyth, K.
and Jansen, R. P. (1997). Mating type switching in yeast
controlled by asymmetric localization of ASH1 mRNA.
Science 277,383
-387.
Macdonald, P. M. (1990). bicoid mRNA localization signal: phylogenetic conservation of function and RNA secondary structure. Development 110,161 -171.[Abstract]
Macdonald, P. M. and Kerr, K. (1998).
Mutational analysis of an RNA recognition element that mediates localization
of bicoid mRNA. Mol. Cell. Biol.
18,3788
-3795.
Macdonald, P. M., Ingham, P. W. and Struhl, G. (1986). Isolation, structure, and expression of even-skipped: a second pair-rule gene of Drosophila containing a homeobox. Cell 47,721 -734.[CrossRef][Medline]
Mach, J. M. and Lehmann, R. (1997). An
Egalitarian-BicaudalD complex is essential for oocyte specification and axis
determination in Drosophila. Genes Dev.
11,423
-435.
Monnerat, A. T., Machado, M. P., Vale, B. S., Soares, M. J., Lima, J. B. P., Lenzi, H. L. and Valle, D. (2002). Anopheles albitarsis embryogenesis: morphological identification of major events. Mem. Inst. Oswaldo Cruz 97,589 -596.[Medline]
Navarro, C., Puthalakath, H., Adams, J. M., Strasser, A. and Lehmann, R. (2004). Egalitarian binds dynein light chain to establish oocyte polarity and maintain oocyte fate. Nat. Cell Biol. 6,427 -435.[CrossRef][Medline]
Pankratz, M. J. and Jäckle, H. (1993). Blastoderm segmentation. In The development of Drosophila melanogaster (ed. M. Bate and A. Martinez-Arias), pp.467 -516. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Reichhart, J. M. and Ferrandon, D. (1998). Green balancers. D.I.S. 81,201 -202.
Rohr, K. B., Tautz, D. and Sander, K. (1999). Segmentation gene expression in the mothmidge Clogmia albipunctata (Diptera, Psychodidae) and other primitive dipterans. Dev. Genes Evol. 209,145 -154.[CrossRef][Medline]
Shestakova, E. A. and Singer, R. H. (2001). The
physiological significance of ß-actin mRNA localization in
determining cell polarity and directional motility. Proc. Natl.
Acad. Sci. USA 98,7045
-7050.
Simmonds, A. J., dosSantos, G., Livne-Bar, I. and Krause, H. M. (2001). Apical localization of wingless transcripts is required for Wingless signaling. Cell 105,197 -207.[CrossRef][Medline]
Stauber, M., Prell, A. and Schmidt-Ott, U.
(2002). A single Hox3 gene with composite
bicoid and zerknüllt expression characteristics in
non-Cyclorrhaphan flies. Proc. Natl. Acad. Sci. USA
99,274
-279.
Strimmer, K. and von Haeseler, A. (1996). Quartet puzzling: a quartet maximum likelihood method for reconstructing tree topologies. Mol. Biol. Evol. 13,964 -969.
Struhl, G. and Basler, K. (1993). Organizing activity of wingless protein in Drosophila. Cell 72,527 -540.[CrossRef][Medline]
Struhl, G., Fitzgerald, K. and Greenwald, I. (1993). Intrinsic activity of the Lin-12 and Notch intracellular domains in vivo. Cell 74,331 -345.[CrossRef][Medline]
Takizawa, P. A., Sil, A., Swedlow, J. R., Herskowitz, I. and Vale, R. D. (1997). Actin-dependent localization of an RNA encoding a cell-fate determinant in yeast. Nature 389, 90-93.[CrossRef][Medline]
Wieschaus, E. and Nüsslein-Volhard, C. (1986). Looking at embryos. In Drosophila, A Practical Approach (ed. D. B. Roberts), pp.199 -226. Oxford, UK: IRL Press.
Wilkie, G. S. and Davis, I. (2001). Drosophila wingless and pair rule transcripts localize apically by Dynein-mediated transport of RNA particles. Cell 105,209 -219.[CrossRef][Medline]
Wu, X., Vasisht, V., Kosman, D., Reinitz, J. and Small, S. (2001). Thoracic patterning by the Drosophila gap gene hunchback. Dev. Biol. 237, 79-92.[CrossRef][Medline]
Yeates, D. K. and Wiegmann, B. M. (1999). Congruence and controversy: toward a higher-level phylogeny of Diptera. Annu. Rev. Entomol. 44,397 -428.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
G. dos Santos, A. J. Simmonds, and H. M. Krause A stem-loop structure in the wingless transcript defines a consensus motif for apical RNA transport Development, January 1, 2008; 135(1): 133 - 143. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Vendra, R. S. Hamilton, and I. Davis Dynactin suppresses the retrograde movement of apically localized mRNA in Drosophila blastoderm embryos RNA, November 1, 2007; 13(11): 1860 - 1867. [Abstract] [Full Text] [PDF] |
||||