|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 11 August 2004
doi: 10.1242/dev.01317
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Brookdale Department of Molecular, Cell and Developmental Biology, Mount Sinai
School of Medicine, One Gustave L. Levy Place, New York, NY 10029, USA
2 Max Planck Institute of Molecular Cell Biology and Genetics, Pfotenhauer
Strasse 108, 01307 Dresden, Germany
* Author for correspondence (e-mail: marek.mlodzik{at}mssm.edu)
Accepted 17 June 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Drosophila, Eye, PCP, Vang, pk, Stbm
| Introduction |
|---|
|
|
|---|
In Drosophila, PCP manifests itself in many adult tissues, most
notably the eye, wing, notum (dorsal thorax) and abdomen
(Adler, 2002
;
Casal et al., 2002
;
Mlodzik, 2002
;
Uemura and Shimada, 2003
).
Frizzled (Fz), which is the founding member of the seven-pass transmembrane
Fz-receptor family of Wnt receptors (Bhanot
et al., 1996
; Vinson and
Adler, 1987
) requires Dishevelled (Dsh), a multi-domain
cytoplasmic protein, to transduce signals
(Boutros and Mlodzik, 1999
).
Downstream of Dsh, the Wnt/Fz signaling pathway bifurcates into two distinct
pathways: the canonical Wnt/ß-catenin pathway and the Fz/PCP pathway
(reviewed by Mlodzik, 2002
;
Veeman et al., 2003
). In
addition, a conserved group of genes is involved in PCP generation by
regulating Fz/PCP signaling. These genes include the atypical cadherin
flamingo [fmi; also known as stan FlyBase
(Chae et al., 1999
;
Usui et al., 1999
)], the
cytoplasmic LIM-domain protein prickle [pk
(Gubb et al., 1999
)], the
four-pass transmembrane protein Strabismus [stbm; also known as
Van Gogh (Vang FlyBase)
(Chae et al., 1999
;
Taylor et al., 1998
;
Usui et al., 1999
;
Wolff and Rubin, 1998
)] and
Diego [see below (Feiguin et al.,
2001
)].
In the Drosophila wing, PCP signaling leads to the emergence of an
actin hair at the distal vertex of each cell (with respect to the body).
Although the PCP proteins are initially distributed uniformly around the
apical cortex of each wing cell, as development and PCP establishment
progress, these proteins are sorted towards either the distal (e.g. Fz, Dsh),
the proximal (e.g. Stbm, Pk) or both (e.g. Fmi) cell margins
(Axelrod, 2001
;
Bastock et al., 2003
;
Strutt, 2001
;
Tree et al., 2002
;
Usui et al., 1999
). The actin
hair emerges distally as a final outcome of the PCP protein distribution
(Adler, 2002
).
In the fly eye, PCP is reflected in the precise arrangement of ommatidia
with respect to the anteroposterior (AP) and dorsoventral (DV) axes
(Fig. 1A). The AP orientation
follows the directed progression of a morphogenetic furrow (MF), leaving in
its wake a series of ommatidial preclusters
(Wolff and Ready, 1993
). The
precluster that emerges from the MF includes the precursors for the
photoreceptors R2, R3, R4, R5 and R8. Initially, the R3/R4 cells are
symmetrically positioned within the cluster
(Fig. 1A). At this stage,
Fz/PCP signaling breaks the initial symmetry within the R3/R4 pair and
specifies their individual fates as two distinct photoreceptors
(Adler, 2002
;
Mlodzik, 1999
;
Mlodzik, 2002
). Following R3
and R4 cell fate determination, preclusters begin a 90° rotation in
opposite directions in each half of the eye field
(Fig. 1A,B). At the end of
ommatidial rotation, the symmetric photoreceptor arrangement is broken and
ommatidial chirality is established by the specific arrangement of the R3 and
R4 photoreceptors (Fig.
1A).
|
The PCP gene diego (dgo) encodes a cytoplasmic protein
with six Ankyrin repeats at its N-terminal region
(Feiguin et al., 2001
). The
Ankyrin repeat motif has been implicated in membrane targeting of proteins
(Bennett and Chen, 2001
). Dgo
has been shown to colocalize with and depend on Fmi for membrane recruitment.
In addition, previous studies in the eye have shown that dgo mutants
dominantly enhance a fmi GOF phenotype
(Das et al., 2002
;
Feiguin et al., 2001
).
However, the role of Dgo in Fz/PCP signaling or its regulation has not yet
been established.
We provide evidence that dgo is required to maintain the apical localization of other PCP factors. We demonstrate that Dgo is redundant to Pk and Stbm in this context, maintaining the apical localization of Fmi, following its Fz-dependent membrane recruitment. This role of Dgo, Pk and Stbm is supported by physical interactions between Pk and Stbm with Dgo. These data suggest a positive feedback loop initiated by Fz that results in the apical maintenance of all the other PCP factors (Fmi, Stbm, Pk, Dgo and Dsh).
| Materials and methods |
|---|
|
|
|---|
Mutant alleles used were dgo308, dgo 380
(Feiguin et al., 2001
),
fmiE59, fmiE45
(Lu et al., 1999
),
pk-sple13, stbm 6cn, dsh1,
dshv26, fzR52 and fzK21
(http://flybase.bio.indiana.edu).
Immunohistochemistry and histology
Primary antibodies were: mouse anti-Fmi, rat anti-Dsh (generous gifts of T.
Uemura; (Usui et al., 1999
),
rabbit anti-Dgo (Feiguin et al.,
2001
), rabbit anti-Stbm (Rawls
and Wolff, 2003
), rabbit anti-Pk
(Tree et al., 2002
), rabbit
anti-Bar (gift from K. Saigo), rat anti-Sal (gift from R. Barrio) and
anti-ß-gal (Cappel, Promega). The ß-Gal lines used were
Dl-lacZ1282 (from Marc Haenlin) and svp-lacZ
(Baker et al., 1990
). Rhodamine
phalloidin (Molecular Probes) was used to visualize actin. Secondary
antibodies coupled to fluorochromes were from Jackson Laboratories. Imaginal
disc staining were performed as described
(Fanto et al., 2000
;
Feiguin et al., 2001
). Discs
were mounted in Mowiol and viewed with a Leica confocal microscope; images
were assembled in Adobe Photoshop. Confocal images shown are single optical
sections.
Tangential eye sections were prepared as described
(Tomlinson et al., 1987
). For
genetic interaction analysis, eyes were sectioned at the equatorial region and
ommatidia scored for polarity. Three to 12 sections from independent eyes were
scored for each genotype.
Molecular biology and biochemistry
To create pCRIITopo_Dgo and pCRIITopo_DgoAnk, Dgo cDNA was amplified with
primers Dgo_upper_Not (TATGCGGCC-GCGATGCAGCATGGATCCTCC) and Dgo_AnkStop_Sal
(ATAGTCGACTCATTTCTCCTTGCGATTCCG) or Dgo_lower_Sal
(ATAGTCGACTCAAACTAGACTCGAGACATT), respectively, and cloned into pCRIITopo
according to instructions of the manufacturer (Invitrogen). Inserts were then
cloned as NotI(blunt)/SalI fragments into the
NsiI(blunt)/XhoI sites of pßTH
(Jenny et al., 2003
) to give
pßTH_Dgo and pßTH_DgoAnk. pGex4TI_DgoAnk was made by cloning the
NotI(blunt)/SalI fragment of pCRIITopo_DgoAnk into the
BamHI(blunt)/XhoI sites of pGex4TI. All other constructs are
as described previously (Jenny et al.,
2003
). In vitro translations and GST pull-downs were carried out
as described previously (Jenny et al.,
2003
). pEGFP-Dgo was made by cloning the
NotI(blunt)/SalI fragment of pCRIITopo_Dgo into the
BglII(blunt)/SalI sites of pEGFP_C1 (Clontech). GFP-Dgo was
then transferred into SpeI/XbaI(blunt) sites of pUASP
(Rorth, 1998
) as
NheI/SalI(blunt) fragment. Sixtyto 80-hour-old larvae grown
at 25°C, were heat-shocked for 1 hour at 38°C to induce Gal4
expressing flip-out clones. After the heat shock, larvae were kept at 18°C
until dissection of the larval eye and pupal wing discs. Wing discs were
stained as described (Feiguin et al.,
2001
).
To create pCRIITopo_Dgo and pCRIITopo_DgoAnk, Dgo cDNA was amplified with
primers Dgo_upper_Not (TATGCGGCCGCGAT-GCAGCATGGATCCTCC) and Dgo_AnkStop_Sal
(ATAGTCGA-CTCATTTCTCCTTGCGATTCCG) or Dgo_lower_Sal
(ATAGTC-GACTCAAACTAGACTCGAGACATT), respectively, and cloned into pCRIITopo
according to instructions of the manufacturer (Invitrogen). Inserts were then
cloned as NotI(blunt)/SalI fragments into the
NsiI(blunt)/XhoI sites of pßTH
(Jenny et al., 2003
) to give
pßTH_Dgo and pßTH_DgoAnk. pGex4TI_DgoAnk was made by cloning the
NotI(blunt)/SalI fragment of pCRIITopo_DgoAnk into the
BamHI(blunt)/XhoI sites of pGex4TI. All other constructs are
described elsewhere (Jenny et al.,
2003
). In vitro translations and GST pull-downs were carried out
as described previously (Jenny et al.,
2003
).
| Results |
|---|
|
|
|---|
30% symmetrical
clusters in dgo compared with 10% in
fz). Similarly, overexpressed Dgo in the developing
3rd instar eye disc causes a typical gain-of-function PCP phenotype (not
shown). Furthermore, the analysis of the orientation of preclusters in
dgo clones in larval eye imaginal disc (with
antibodies to Spalt, marking R3/R4 cells, and Bar, marking R1/R6 cells)
revealed an abnormal orientation of the photoreceptor preclusters from early
developmental stages (Fig. 1E;
not shown). Taken together, these data and the wing analysis (Feguin et al.,
2001) indicate that dgo behaves like a primary PCP gene, revealing a
characteristic role in PCP establishment. To better define the role of Dgo in PCP establishment, we next analyzed Dgo localization in 3rd instar eye discs. Dgo is detected apically at the membrane in all cells ahead of and behind the MF (Fig. 2A; not shown). The initial uniform apical localization changes posterior to the MF in rows 2 to 3 in the 5 cell precluster (Fig. 2A). At this stage, Dgo is detected at higher levels in R3/R4 cells within the dorsoventral axis and, in particular, at the membranes between R3 and R4. Dgo is absent from membranes where the R3/R4 cells abut the R2/R5 pair. By row 5, Dgo is maintained at the border between the R3/R4 cells, whereas it is now detected at lower levels in other membrane regions of R3 and becomes enriched to higher levels in R4 (Fig. 2A). The asymmetric enrichment in the R4 cell becomes resolved by row 6 and persists through row 10. In addition, Dgo is detected at high levels at the posterior side of the R2/R5 and R8 cells from row 2 onwards (Fig. 2A). In summary, these data indicate that the localization of Dgo has a pattern characteristic of other PCP proteins in the eye disc.
|
Taken together, these data indicate that Dgo always localizes in a manner similar to Fz and Dsh both in the eye, on the R3 side of the R3/R4 cell boundary, and in the wing on the distal side of the pupal wing cell.
Dgo localization is promoted by Fz
A mutation in a PCP gene can affect the localization of other PCP proteins
in three distinct ways in the eye: (1) asymmetric R4-like enrichment occurs
but is random with respect to the R3/R4 precursor cell (reflecting chirality
flips); (2) no asymmetric pattern is observed, but apical localization is
maintained; and (3) apical localization is compromised.
As Dgo is predicted to be a cytoplasmic protein, a question of particular
interest is how it becomes recruited to the membrane. Previous studies in the
wing and eye have shown that Dgo localization is affected by fmi, but
Fmi itself was not sufficient to recruit Dgo to the membrane
(Das et al., 2002
;
Feiguin et al., 2001
).
In fz-null clones, Dgo completely loses its apical membrane
localization (Fig. 3A,B) and,
strikingly, this is evident not only posterior to the MF
(Fig. 3B), but also anterior to
the MF prior to a PCP requirement (Fig.
3A). This fz requirement is unique to Dgo, as fz
has no effect or a different effect on the localization of Pk, Fmi and Stbm:
the apical localization of Pk is not perturbed significantly, except for the
loss of the characteristic PCP protein localization pattern, as seen in the
case of Fmi in fz mutants (Fig.
3E; not shown) (Das et al.,
2002
). In addition, Dgo seems to be found at higher levels at the
clone borders (vertical arrowheads in Fig.
3B), suggesting that a difference in Fz signaling levels promotes
PCP complex formation, and this is also observed for Fmi localization
(Das et al., 2002
). Dgo is
much less affected in mutant clones for any other PCP gene: in
fmi clones, residual Dgo is still present at the
membrane, although it largely loses its membrane association
(Das et al., 2002
;
Feiguin et al., 2001
); in
pk and stbm tissue, Dgo
localization is only slightly affected
(Fig. 3G,H) with a short delay
(approximately one row) in the asymmetric R4-like enrichment. In tissue that
is dgo, none of the other PCP factors is affected
and they localize normally to the apical cortex, resulting in the typical
asymmetric, albeit randomized, R4-like enrichment
(Fig. 3C,D,F)
(Das et al., 2002
).
|
Dgo, Pk and Stbm promote the apical localization of Fmi and Fz
Previous studies have suggested that Fz and Fmi promote each other's
asymmetric distribution, but that Fmi remains apically localized in
fz tissue (Das
et al., 2002
; Strutt,
2001
). Fmi has also been shown to promote the apical and
asymmetric localization of the cytoplasmic PCP proteins Dgo, Dsh and Pk
(Das et al., 2002
;
Strutt et al., 2002
). In
addition, in the eye fz again affects the asymmetric localization of
Stbm, Fmi and Pk, but not their apical localization (not shown)
(Das et al., 2002
;
Strutt et al., 2002
).
Nevertheless, very little is known about how the apical localization of Fmi
and Fz themselves is established and, importantly, maintained prior to PCP
signaling in the eye or the wing.
In order to address this issue, we have analyzed the localization of Fz and
Fmi in all single and in several double mutant PCP gene combinations. Single
mutant pk and stbm clones show no significant defects in
apical or asymmetric Fz or Fmi localization
(Fig. 4A; not shown)
(Bastock et al., 2003
;
Das et al., 2002
;
Strutt et al., 2002
),
indicating that stbm and pk alone are not crucial for apical
Fmi or Fz localization. However, in dgo,
pk double mutant clones (in 3rd instar eye discs
anterior and posterior to the MF) the apical localization of Fmi and Fz is
strongly reduced (Fig. 4B,C;
not shown). A similar effect is observed in dgo,
stbm double mutant clones
(Fig. 4D,E; not shown),
suggesting that Dgo acts in a redundant manner with Pk and Stbm for this
function. In contrast to dgo, pk
and dgo, stbm double mutants,
pk, stbm double mutant tissue
shows a different effect. Whereas the apical localization of Fmi and Fz
anterior to the MF is reduced (Fig.
4F; not shown), similar to, for example,
dgo, pk double mutant clones,
apical Fmi and Fz localization is basically unaffected posterior to the MF
(Fig. 4F,G). Although, the
apical localization of Fmi was lost, Fmi protein was present in all single and
double mutant backgrounds at comparable levels to wild type (determined by
western blot analysis; not shown).
|
Dgo and Pk promote apical localization of Dsh and Stbm
To explore this observation of potential redundancy further, we analyzed
Stbm and Dsh localization in dgo,
pk double mutant tissue. The localization of Dsh and
Stbm is not significantly affected in dgo mutant
clones (Fig. 5A,C). In
pk mutants, Dsh and Stbm are localized apically,
although this localization appears to be slightly diffused
(Fig. 5D; not shown).
Similarly, apical Dsh localization is not affected in
stbm tissue in the eye [not shown; this is
different from the wing (Bastock et al.,
2003
; Strutt et al.,
2002
)]. By contrast, neither Dsh nor Stbm are detected at apical
membranes in dgo, pk double
mutant clones (Fig. 5B,E). As
localization of Fmi (which also affects Stbm and Dsh localization;
Fig. 5F) is similarly affected
in the dgo, pk double mutant
background, this effect could be indirectly mediated via Fmi (see above)
(Das et al., 2002
;
Strutt et al., 2002
). The
requirement of Fmi for the maintenance is further supported by the fact that
in fmi, the apical localization of Fz is
significantly compromised both posterior and anterior to the furrow
(Fig. 5G).
|
Dgo physically interacts with Pk and Stbm
To provide biochemical evidence for a PCP multiprotein complex, we tested
for physical interactions between these factors in a yeast two-hybrid matrix
with available PCP proteins (A.J. and M.M., unpublished). This initial test
suggested that Dgo interacts physically with Pk and Stbm (data not shown). GST
pull-down assays were used to confirm these interactions independently and map
the interacting domains (Fig.
6). Using in vitro translated constructs of full-length Dgo and
the Ankyrin repeat region of Dgo (Fig.
6A), we showed that Dgo-Ank is sufficient to interact with a
stretch of 131 amino acids close to, but not including, the very C terminus of
Pk (Fig. 6A). Similarly,
Dgo-Ank interacts with a Stbm domain of
80 amino acids in its cytoplasmic
tail (Fig. 6B). Interestingly,
the regions of Pk and Stbm required for the interaction with Dgo-Ank are the
same regions that mediate an interaction between Pk and Stbm themselves
(Jenny et al., 2003
).
|
| Discussion |
|---|
|
|
|---|
Diego and the formation of a multiprotein PCP signaling complex
A crucial region for PCP signaling in the eye is in rows 2-5 in the 3rd
instar larval disc behind the morphogenetic furrow (MF; see also
Introduction). Four lines of evidence support this assumption: (1) cells that
take part in PCP signaling (R3/R4) are specified as photoreceptor subtypes in
this region (Wolff and Ready,
1991
); (2) Frizzled-Notch signaling-dependent transcription in the
R4 cell is initiated in this region, as detected by the
m
0.5 reporter for the E(spl)m
gene
(Cooper and Bray, 1999
); (3)
the sev-enhancer, which is active in R3/R4 cells in this region, can
drive a PCP gene in order to fully rescue the respective mutant phenotype
(Boutros et al., 1998
;
Tomlinson and Struhl, 1999
);
and (4) in the region ahead of the MF to the first row behind it, the PCP
proteins are uniformly apically localized in all cells, before they begin at
row 2 to display the characteristic PCP protein localization pattern (e.g.
Fig. 2A)
(Das et al., 2002
;
Rawls and Wolff, 2003
;
Strutt et al., 2002
).
Following their initial symmetric apical localization, the PCP factors
become asymmetrically enriched across the respective cell boundaries in the
proximodistal axis in the wing or the dorsoventral axis in the eye. Although
several models have been proposed as to how these complexes might be formed
and maintained, the mechanism behind the early aspect of PCP establishment
remains largely unclear (Strutt,
2003
; Tree et al.,
2002
). Our data suggest a complex mechanism that involves
redundancy among several PCP genes (see model,
Fig. 7).
|
In addition to these initial requirements for apical localization and
maintenance, the subsequent asymmetric resolution of the respective PCP
proteins to the R4 cell is affected and often delayed in mutant backgrounds
(this work) (Strutt et al.,
2002
; Tree et al.,
2002
).
How is the initial apical localization of all these factors maintained? As
outlined above, none of the single mutant PCP genes, except fz and
fmi, has a significant effect on the whole complex. However, in
double mutant clones for either dgo and pk, or dgo
and stbm, localization of the PCP proteins is severely affected. Most
strikingly, the apical localization of Fmi and Fz is affected in these double
mutant combinations (Fig.
4B-E). In addition, the localization of Stbm and Dsh are also
affected (Fig. 5B,E). This
could be either a direct effect of Dgo and Pk or could be mediated through
their effect on Fmi [as in fmi tissue, Stbm and Dsh
as well as Fz are reduced apically; Fig.
5F,G (Das et al.,
2002
)]. These data suggest that the cytoplasmic PCP proteins,
which are initially recruited to the membrane by Fz (i.e. Dgo and Dsh) and
Stbm (i.e. Pk), form a protein complex that is required to maintain Fmi
apically (Fig. 7A). This
interpretation is supported by our observation that Dgo physically interacts
with Stbm and Pk, and thus possibly stabilizes the initial complex
(Fig. 6). Thus, our studies
reveal that Dgo, Stbm and Pk are required to maintain apical Fmi localization,
possibly through the physical interactions among themselves and possibly other
PCP factors, during the early stages preceding PCP signaling (i.e. anterior to
MF in eye). In turn, apical Fmi promotes the maintenance of an initial PCP
complex at adjacent cell membranes to facilitate their signaling specific
interactions.
We can speculate on further implications of these data. During later stages
of PCP signaling, the localization of the PCP factors is resolved into two
types of complexes on adjacent cell membranes. The differential localization
of either Fz/Dgo or the Stbm/Pk complex in the neighboring cells (R3 versus
R4) suggests that asymmetric localization of PCP factors is maintained across
the border of the R3 and R4 cells in the eye and across proximodistal cell
borders in the wing (Tree et al.,
2002
). In the eye, the PCP proteins analyzed in this manner indeed
localize to specific sides of the R3/R4 cell border
(Fig. 2)
(Strutt et al., 2002
).
Similarly, proximodistal localization in the wing correlates with the
respective R3/R4-specific localization. For example, the localization of Fz
and Diego in the distal side of a wing cell correlates with the localization
on the R3 side of the R3/R4 border; conversely, Stbm localization to the
proximal side of a wing cell correlates with its localization on the R4 side
of the R3/R4 border (Jenny et al.,
2003
; Tree et al.,
2002
). The localization to either the R3 or R4 side also
corresponds to the genetic requirements in either cell, as established in
mosaic analyses (Fanto and Mlodzik,
1999
; Tomlinson and Struhl,
1999
; Wolff and Rubin,
1998
; Zheng et al.,
1995
). Thus, as Dgo, which is initially recruited by Fz, localizes
to R3 and the pk/stbm complex localizes to R4, it is likely that at later
stages during PCP signaling (posterior to MF) Fmi localization is maintained
and stabilized through feedback loops on both sides of the R3/R4 boundary (see
model in Fig. 7B).
A prediction from such a scenario is that Fz/Dgo are performing this
function in R3 and the Stbm/Pk complex
(Jenny et al., 2003
) in R4. As
Fmi is known to function as a homophilic cell-adhesion molecule
(Usui et al., 1999
), the
removal of the feedback loop on one side could be overcome through the
homophilic recruitment of Fmi from the other side. Only when both feedback
loops are weakened on either side, can Fmi localization become affected
(Fig. 7B). This is supported by
the different effects of the respective double mutants posterior to the MF;
those that affect both sides of the R3/R4 boundary, e.g. dgo and
stbm (R3side/R4side) or dgo and pk (R3side/R4side)
can cause Fmi delocalization, whereas double mutants affecting only one cell,
e.g. pk and stbm (both R4side), have no significant
effect.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Adler, P. N. (2002). Planar signaling and morphogenesis in Drosophila. Dev. Cell 2, 525-535.[CrossRef][Medline]
Axelrod, J. D. (2001). Unipolar membrane
association of Dishevelled mediates Frizzled planar cell polarity signaling.
Genes Dev. 15,1182
-1187.
Baker, N. E., Mlodzik, M. and Rubin, G. M.
(1990). Spacing differentiation in the developing Drosophila eye:
a fibrinogen-related lateral inhibitor encoded by scabrous.Science 250,1370
-1377.
Bastock, R., Strutt, H. and Strutt, D. (2003).
Strabismus is asymmetrically localised and binds to Prickle and Dishevelled
during Drosophila planar polarity patterning.
Development 130,3007
-3014.
Bennett, V. and Chen, L. (2001). Ankyrins and cellular targeting of diverse membrane proteins to physiological sites. Curr. Opin. Cell Biol. 13, 61-67.[CrossRef][Medline]
Bhanot, P., Brink, M., Samos, C. H., Hsieh, J.-C., Wang, Y., Macke, J. P., Andrew, D., Nathans, J. and Nusse, R. (1996). A new member of the frizzled family from Drosophila functions as a Wingless receptor. Nature 382,225 -230.[CrossRef][Medline]
Boutros, M. and Mlodzik, M. (1999). Dishevelled: at the crossroads of divergent intracellular signaling pathways. Mech. Dev. 83,27 -37.[CrossRef][Medline]
Boutros, M., Paricio, N., Strutt, D. I. and Mlodzik, M. (1998). Dishevelled activates JNK and discriminates between JNK pathways in planar polarity and wingless signaling. Cell 94,109 -118.[CrossRef][Medline]
Brand, A. H. and Perrimon, N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118,401 -415.[Abstract]
Casal, J., Struhl, G. and Lawrence, P. A. (2002). Developmental compartments and planar polarity in Drosophila. Curr. Biol. 12,1189 -1198.[CrossRef][Medline]
Chae, J., Kim, M. J., Goo, J. H., Collier, S., Gubb, D., Charlton, J., Adler, P. N. and Park, W. J. (1999). The Drosophila tissue polarity gene starry night encodes a member of the protocadherin family. Development 126,5421 -5429.[Abstract]
Cooper, M. T. D. and Bray, S. J. (1999). Frizzled regulation of Notch signalling polarizes cell fate in the Drosophila eye. Nature 397,526 -529.[CrossRef][Medline]
Das, G., Reynolds-Kenneally, J. and Mlodzik, M. (2002). The atypical cadherin Flamingo links Frizzled and Notch signaling in planar polarity establishment in the Drosophila eye. Dev. Cell 2,656 -666.
Djiane, A., Riou, J., Umbhauer, M., Boucaut, J. and Shi, D. (2000). Role of frizzled 7 in the regulation of convergent extension movements during gastrulation in Xenopus laevis. Development 127,3091 -3100.[Abstract]
Fanto, M. and Mlodzik, M. (1999). Asymmetric Notch activation specifies photoreceptors R3 and R4 and planar polarity in the Drosophila eye. Nature 397,523 -526.[CrossRef][Medline]
Fanto, M., Weber, U., Strutt, D. I. and Mlodzik, M. (2000). Nuclear signaling by Rac abd Rho GTPases is required in the establishment of epithelial planar polarity in the Drosophila eye. Curr. Biol. 10,979 -988.[CrossRef][Medline]
Feiguin, F., Hannus, M., Mlodzik, M. and Eaton, S. (2001). The Ankyrin repeat protein Diego mediates Frizzled-dependent planar polarization. Dev. Cell 1, 93-101.[CrossRef][Medline]
Gubb, D., Green, C., Huen, D., Coulson, D., Johnson, G., Tree,
D., Collier, S. and Roote, J. (1999). The balance
between isoforms of the prickle LIM domain protein is critical for planar
polarity in Drosophila imaginal discs. Genes Dev.
13,2315
-2327.
Jenny, A., Darken, R. S., Wilson, P. A. and Mlodzik, M. (2003). Prickle and Strabismus form a functional complex to generate a correct axis during planar cell polarity signaling. EMBO J. 22,4409 -4420.[CrossRef][Medline]
Keller, R. (2002). Shaping the vertebrate body
plan by polarized embryonic cell movements. Science
298,1950
-1954.
Lu, B., Usui, T., Uemura, T., Jan, L. and Jan, Y. N. (1999). Flamingo controls the planar polarity of sensory bristles and asymmetric division of sensory organ precursors in Drosophila.Curr. Biol. 9,1247 -1250.[CrossRef][Medline]
Ma, D., Yang, C. H., McNeill, H., Simon, M. A. and Axelrod, J. D. (2003). Fidelity in planar cell polarity signalling. Nature 421,543 -547.[CrossRef][Medline]
Mlodzik, M. (1999). Planar polarity in the Drosophila eye: a multifaceted view of signaling specificity and cross-talk. EMBO J. 18,6873 -6879.[CrossRef][Medline]
Mlodzik, M. (2002). Planar cell polarization: do the same mechanisms regulate Drosophila tissue polarity and vertebrate gastrulation? Trends Genet. 18,564 -571.[CrossRef][Medline]
Pignoni, F. and Zipursky, S. L. (1997). Induction of Drosophila eye development by decapentaplegic. Development 124,271 -278.[Abstract]
Rawls, A. S. and Wolff, T. (2002). The cadherins fat and dachsous regulate dorsal/ventral signaling in the Drosophila eye. Curr. Biol. 12,1021 -1026.[CrossRef][Medline]
Rawls, A. S. and Wolff, T. (2003). Strabismus
requires Flamingo and Prickle function to regulate tissue polarity in the
Drosophila eye. Development
130,1877
-1887.
Rorth, P. (1998). Gal4 in the Drosophila female germline. Mech. Dev. 78,113 -118.[CrossRef][Medline]
Spradling, A. C. and Rubin, G. M. (1982).
Transposition of cloned P-elements into Drosophila germ line chromosomes.
Science 218,341
-347.
Strutt, D. I. (2001). Asymmetric localization of frizzled and the establishment of cell polarity in the Drosophila wing. Mol. Cell 7,367 -375.[CrossRef][Medline]
Strutt, D. (2003). Frizzled signalling and cell
polarisation in Drosophila and vertebrates.
Development 130,4501
-4513.
Strutt, D., Johnson, R., Cooper, K. and Bray, S. (2002). Asymmetric localization of frizzled and the determination of notch-dependent cell fate in the Drosophila eye. Curr. Biol. 12,813 -824.[CrossRef][Medline]
Taylor, J., Abramova, N., Charlton, J. and Adler, P. N.
(1998). Van Gogh: a new Drosophila tissue polarity gene.
Genetics 150,199
-210.
Tomlinson, A. and Struhl, G. (1999). Decoding vectorial information from a gradient: sequential roles of the receptors Frizzled and Notch in establishing planar polarity in the Drosophila eye. Development 126,5725 -5738.[Abstract]
Tomlinson, A., Bowtell, D. D. L., Hafen, E. and Rubin, G. M. (1987). Localization of the sevenless protein, a putative receptor for positional information, in the eye imaginal disc of Drosophila. Cell 51,143 -150.[CrossRef][Medline]
Tree, D. R. P., Shulman, J. M., Rousset, R., Scott, M. P., Gubb, D. and Axelrod, J. D. (2002). Prickle mediates feedback amplification to generate asymmetric planar cell polarity signaling. Cell 109,371 -381.[CrossRef][Medline]
Uemura, T. and Shimada, Y. (2003). Breaking
cellular symmetry along planar axes in Drosophila and vertebrates.
J. Biochem. 134,625
-630.
Usui, T., Shima, Y., Shimada, Y., Hirano, S., Burgess, R. W., Schwarz, T. L., Takeichi, M. and Uemura, T. (1999). Flamingo, a seven-pass transmembrane cadherin, regulates planar cell polarity under the control of Frizzled. Cell 98,585 -595.[CrossRef][Medline]
Veeman, M. T., Axelrod, J. D. and Moon, R. T. (2003). A second canon. Functions and mechanisms of beta-catenin-independent Wnt signaling. Dev. Cell 5, 367-377.[CrossRef][Medline]
Vinson, C. R. and Adler, P. N. (1987). Directional non-cell autonomy and the transmission of polarity information by the frizzled gene of Drosophila. Nature 329,549 -551.[CrossRef][Medline]
Wallingford, J. B., Rowning, B. A., Vogeli, K. M., Rothbacher, U., Fraser, S. E. and Harland, R. M. (2000). Dishevelled controls cell polarity during Xenopus gastrulation. Nature 405,81 -85.[CrossRef][Medline]
Wallingford, J. B., Fraser, S. E. and Harland, R. M. (2002). Convergent extension: the molecular control of polarized cell movement during embryonic development. Dev. Cell 2, 695-706.[CrossRef][Medline]
Wolff, T. and Ready, D. F. (1991). The beginning of pattern formation in the Drosophila compound eye: the morphogenetic furrow and the second mitotic wave. Development 113,841 -850.[Abstract]
Wolff, T. and Ready, D. F. (1993). Pattern formation in the Drosophila retina. In The development of Drosophila melanogaster (ed. M. B. A. Martinez-Arias), pp.1277 -1326. Cold Spring Harbor, NY: Cold Spring Harbor Press.
Wolff, T. and Rubin, G. M. (1998). strabismus, a novel gene that regulates tissue polarity and cell fate decisions in Drosophila. Development 125,1149 -1159.[Abstract]
Yang, C., Axelrod, J. D. and Simon, M. A. (2002). Regulation of Frizzled by fat-like cadherins during planar polarity signaling in the Drosophila compound eye. Cell 108,675 -688.[CrossRef][Medline]
Zeidler, M. P., Perrimon, N. and Strutt, D. I. (1999). The four-jointed gene is required in the Drosophila eye for ommatidial polarity specification. Curr. Biol. 9,1363 -1372.[CrossRef][Medline]
Zheng, L., Zhang, J. and Carthew, R. W. (1995). frizzled regulates mirrorsymmetric pattern formation in the Drosophila eye. Development 121,3045 -3055.[Abstract]
Related articles in Development:
This article has been cited by other articles:
![]() |
D. Strutt and S. J. Warrington Planar polarity genes in the Drosophila wing regulate the localisation of the FH3-domain protein Multiple Wing Hairs to control the site of hair production Development, September 15, 2008; 135(18): 3103 - 3111. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Rawls, S. A. Schultz, R. D. Mitra, and T. Wolff Bedraggled, a Putative Transporter, Influences the Tissue Polarity Complex During the R3/R4 Fate Decision in the Drosophila Eye Genetics, September 1, 2007; 177(1): 313 - 328. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Moeller, A. Jenny, H.-J. Schaeffer, T. Schwarz-Romond, M. Mlodzik, M. Hammerschmidt, and W. Birchmeier Diversin regulates heart formation and gastrulation movements in development PNAS, October 24, 2006; 103(43): 15900 - 15905. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Wallingford Planar cell polarity, ciliogenesis and neural tube defects Hum. Mol. Genet., October 15, 2006; 15(suppl_2): R227 - R234. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Mirkovic and M. Mlodzik Cooperative activities of Drosophila DE-Cadherin and DN-Cadherin regulate the cell motility process of ommatidial rotation Development, September 1, 2006; 133(17): 3283 - 3293. [Abstract] [Full Text] [PDF] |
||||