|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 21 January 2004
doi: 10.1242/dev.00975
Cardiovascular Division, Department of Medicine, University of Pennsylvania, Philadelphia, PA, USA
* Author for correspondence (e-mail: epsteinj{at}mail.med.upenn.edu)
Accepted 4 November 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Pax3, Neural crest, Tead2, Myogenesis, Neurogenesis
| Introduction |
|---|
|
|
|---|
Pax3 plays a distinct role during development in myogenic precursors where
it is thought to function upstream of MyoD
(Maroto et al., 1997
;
Tajbakhsh et al., 1997
). Pax3
is expressed in the presomitic mesoderm and becomes restricted to the
ventrolateral region of the somites that gives rise to hypaxial derivatives
(limb muscle, tongue, diaphragm and ventral body wall muscle). Pax3-deficient
embryos lack limb musculature (Bober et
al., 1994
; Franz et al.,
1993
), and embryos lacking both Pax3 and Myf5 have no musculature
whatsoever below the neck (Tajbakhsh et
al., 1997
).
Humans with heterozygous PAX3 mutations suffer from Waardenburg
syndrome which is characterized by pigmentation defects, including a
characteristic white forelock, and deafness due to defective melanocyte
contribution to the inner ear (Baldwin et
al., 1992
; Tassabehji et al.,
1992
). Some Waardenburg patients with PAX3 mutations also
suffer from limb muscle defects (Hoth et
al., 1993
).
Pax3 is one of the earliest markers of neural crest induction.
Tissue-tissue interactions between neural ectoderm and epidermal tissues
result in expression of early neural crest markers including Slug, Snail,
Pax3 and Wnt1 (Garcia-Castro
and Bronner-Fraser, 1999
;
LaBonne and Bronner-Fraser,
1999
). However, specific signaling pathways necessary and
sufficient to result in neural crest induction and Pax3 expression
have not been elucidated in detail. One approach for the identification of
molecular cascades resulting in Pax3 expression by neural crest
precursors is to identify cis-acting regulatory sequences that are capable of
mediating Pax3 expression, and subsequently using this information to
identify upstream trans-acting regulatory factors. Therefore, we and others
have attempted to identify crucial regulatory elements mediating Pax3
expression (Li et al., 2000
;
Li et al., 1999
;
Natoli et al., 1997
).
Previous studies have identified a region of the proximal upstream genomic
Pax3 locus that is capable of mediating expression of reporter genes
in appropriate developmental locations (Li
et al., 2000
; Li et al.,
1999
; Natoli et al.,
1997
). The 1.6 kb proximal Pax3 upstream region is
sufficient to mediate lacZ expression in the dorsal neural tube.
Moreover, we have described mice expressing Cre-recombinase in this domain,
and we have utilized these mice to fate-map Pax3-expressing
precursors during development (Epstein et
al., 2000
; Li et al.,
2000
). By crossing P3proCre mice with R26R Cre reporter mice, we
have demonstrated that Pax3-expressing neural precursors become the enteric
ganglia, the peripheral nervous system, and form significant portions of the
aortopulmonary septation complex. Moreover, Pax3-expressing neural crest
precursors become the smooth muscle cells of the aortic arch artery and major
cranial vessels.
We have also utilized the proximal 1.6 kb Pax3 genomic region to
direct expression of Pax3 itself in neural crest
(Li et al., 1999
).
Over-expression of Pax3 in this region is well tolerated, without overt
abnormalities. Transgenic expression of Pax3 in this region is sufficient to
rescue all of the neural crest defects, including lethal cardiac defects,
normally found in Pax3-deficient Splotch embryos. Rescued pups
succumb at birth because of defective musculature, which requires Pax3 and is
not rescued by transgenic neural crest expression. Hence, these results made
it clear that myogenic and neural crest expression of Pax3 were
separable, and that the proximal 1.6 kb upstream Pax3 genomic region
contained sequences sufficient to mediate functional expression of Pax3 in
neural crest.
We have identified enhancer elements sufficient to mediate neural crest expression of Pax3, and have utilized these discrete sequences to identify an upstream trans-acting regulator of Pax3 in neural tissues.
| Materials and methods |
|---|
|
|
|---|
|
Construct 2: 21447 bp - 19591 bp, 19430 bp - 18253 bp
Construct 3: 21447 bp -19591 bp
Construct 4: 21231 bp -19591 bp
Construct 5: 20853 bp -19591 bp
Construct 6: 21447 bp -20853 bp, 19930 bp - 19591 bp
Construct 7: 21231 bp -19591 bp, 19930 bp - 19591 bp
Construct 8: 21231 bp -20621 bp, 19930 bp - 19591 bp
Construct 9: 21231 bp -21009 bp, 20853 bp - 20621 bp, 19930 bp - 19591 bp
Construct 10: 21231 bp - 21009 bp, 20853 bp - 20703 bp, 19930 bp - 19591 bp
For the production of transgenic mice, constructs were restriction digested with AscI and BglII to remove vector sequences and gel purified. To evaluate the requirement of the Tead site in the Pax3 neural crest enhancer region 2 (NCE2) we mutated the Tead site (TGAATGT to TCCATGG) in construct 9 (Fig. 1). We also created transgenic mice in which 15 kb of Pax3 upstream genomic sequence was cloned upstream of lacZ, and an additional construct in which a distinct Pax3 somite-specific enhancer, located within this 15 kb region (C.B.B. and J.A.E., unpublished), was subcloned upstream of NCE1 and the mutated NCE2. The somite enhancer acted as an internal control for lacZ expression. Constructs were injected into the male pronucleus of B6SJLF1/J zygotes. Embryos were fixed in 2% paraformaldehyde for 2 hours and incubated in 0.1% X-gal solution at 37°C to assess expression of ß-galactosidase activity.
To create the Tead2-Engrailed transgenic construct, the Wnt1
promoter-enhancer construct (Lee et al.,
1997
) in pWEXPZ (kindly provided by D. Epstein) was modified to
drive expression of a Tead2-Engrailed fusion protein that was encoded by bp
1-453 of GenBank D50563 (Tead2) and bp 169-1071 of GenBank M10017
(Drosophila Engrailed). This construct was digested with
AatII to remove vector sequences prior to oocyte injection.
P19 cell culture and differentiation
P19 embryonal carcinoma cells were cultured on glass coverslips coated with
0.1% gelatin in DMEM with 10% fetal bovine serum and co-transfected at 50%
confluency with 2.5 µg pCMV-GFP and either 25 µg pcDNA3 or 25 µg
pcDNA3-Tead2-Engrailed with 75 µl Fugene (Roche). Twelve hours
post-transfection, 1 µM retinoic acid was added to induce Pax3 expression
(Natoli et al., 1997
). After 5
days, cells were fixed in 4% paraformaldehyde for 10 minutes and then
dehydrated to 100% methanol. The cells were then rehydrated and incubated in
5% goat serum blocking agent for 1 hour and incubated overnight with a rabbit
polyclonal anti-Pax3 antibody at a 1:1000 dilution at 4°C. The cells were
then incubated in goat anti-rabbit secondary antibody (GAR-Alexa 594 IgG,
Molecular Probes) for 1 hour and examined by dual fluorescent microscopy for
GFP and Pax3 expression.
Yeast one-hybrid assay
Yeast one-hybrid assay was performed using the MATCHMAKER One Hybrid system
(Clontech) according to manufacturer's instructions. The target-reporter
construct ('bait') included the 232 bp NCE2 (corresponding to GenBank AC084043
bp 20621-20853). Yeast colonies with integrated target-pHISi-1
(pHISi-1P3proNCE2) were tested for background expression and showed no growth
on synthetic defined agar plates lacking histidine (SD/-HIS) at <7.0 mM
3-amino-1,2,4-triazole (3AT). A dual reporter yeast strain was made containing
integrated pHISi-1P3proNCE2 and pLacZ P3proNCE2. An E10.5 mouse AD fusion
library was screened using 10 mM 3AT on Ura/His/Leu-deficient plates.
Initially, 1.4 million clones were screened and 120 positive clones were
picked by nutrient growth selection. Twenty of these clones stained positive
with X-gal. Plasmid was isolated from these clones and sequenced.
In situ hybridization and immunohistochemistry
Radioactive in situ hybridization was performed as described previously
(Wawersik and Epstein, 2000
).
cDNAs for Tead1, 3 and 4 (provided by Iain Farrance,
University of Maryland) were subcloned into the pcDNA3 expression vector
(Invitrogen) and used as template for riboprobe synthesis. Tead2
(GenBank D50563 bp 1-2115) was obtained from the yeast one-hybrid screen.
YAP65 cDNA (GenBank NM_00934 bp 1-4125) was subcloned into pCMVSport6
(Invitrogen) prior to linearization and riboprobe synthesis.
Immunohistochemistry was performed using polyclonal rabbit Pax3 antibodies
prepared in our laboratory (Li et al.,
1999
) or monoclonal anti-neurofilament antibodies (2H3, Hybridoma
Study Bank) using standard techniques. Details are available at
www.uphs.upenn.edu/mcrc/histology.
Electrophoretic mobility shift assay (EMSA)
Tead2 cDNA (GenBank D50563 bp 1-2115) was cloned into pcDNA3 and
YAP65 (GenBank NM_009534 bp 1-4125) was cloned into pCMVSport-6 for
in vitro transcription and translation (TNT, Promega). Production and size of
the protein products were confirmed by SDS-PAGE. Radioactive DNA probes were
generated by annealing complimentary oligonucleotides and filling in remaining
overhangs with Klenow DNA polymerase or by end labeling of oligonucleotides.
EMSA reactions were performed as described previously
(Epstein et al., 1994
). Probe
sequences are summarized below.
Tead site, forward GCGGATCGGGGATGAATGTGTACGTGGAGA
Tead site, reverse GCGGTCTCCACGTACACATTCATCCCCGAT
Tead site mutation, forward GCGGATCGGGGATCCATGGGTACGTGGAGA
Tead site mutation, reverse GCGGTCTCCACGTACCCATG-GATCCCCGAT
Luciferase co-transfection assays
The pGL2P3proNCE2 construct was generated by cloning NCE2 into pGL2-basic
(Promega). Derivative constructs contained the identical mutations in the Tead
binding site as described above for transgenic constructs and EMSA
experiments. NIH-3T3 cells were transfected using FuGENE 6 (Roche). All
transfections included equal amounts of total DNA and results were corrected
for transfection efficiency.
| Results |
|---|
|
|
|---|
|
Tead2 binds to a Pax3 neural crest enhancer
Having identified discrete enhancer sequences, NCE1 and NCE2, that are
sufficient to mediate neural tube and neural crest expression of
Pax3, we sought to utilize these elements to identify trans-acting
factors that regulate Pax3. We performed a yeast one-hybrid assay
using a mouse E10.5 cDNA library and either NCE1 or NCE2 as bait. We were
unable to obtain informative results from experiments using NCE1 as bait owing
to high background, presumably because endogenous yeast activators of
transcription were able to bind to this reporter construct. However, utilizing
NCE2 as a bait, a total of
1.4 million clones were screened and 20
positive clones were identified by dual selection criteria. Of these, 10
positive clones encoded portions of the transcription factor protein, Tead2.
These non-identical clones all contained the coding region for the DNA binding
domain of Tead2, the Tead-box. We expressed the full length Tead2 protein and
confirmed the specific interaction with NCE2 in yeast (data not shown).
Analysis of the sequence of NCE2 reveals a consensus Tead binding motif (Davidson, 1988; Jacquemin, 1996; Xiao, 1991) within this enhancer (Fig. 1). Interestingly, this potential Tead binding site is located within a region of NCE2 that is required for enhancer activity in transgenic mice, since deletion of this region abolished reporter activity (compare constructs 9 and 10, Fig. 1). We tested whether Tead2 could bind to the putative binding site present in NCE2 by performing electrophoretic mobility shift assays (EMSA). As shown in Fig. 3, Tead2 is able to bind to the NCE2 binding site (Fig. 3, lane 1) and specific binding is dramatically reduced when a mutation is introduced into the putative Tead site (Fig. 3, lane 2). An antibody specific for Tead2 was not available for supershift experiments. However, Tead2 is known to bind directly to a transcriptional co-activator, Yes-associated protein (YAP65/Yap) (Vassilev, 2001). Addition of in vitro-translated/transcribed YAP65 to the binding reaction resulted in a supershift of the Tead2/DNA complex (Fig. 3, lane 3) consistent with the ability of Tead2, and a Tead2/YAP65 complex, to bind to the Tead binding site in NCE2. YAP65 alone was unable to bind to NCE2 (data not shown).
|
|
|
|
|
|
In order to verify that the Tead2-Engrailed fusion protein was capable of inhibiting Tead2 and YAP65-mediated activation of NCE2, we performed co-transfection assays in NIH-3T3 cells with pGL2Pax3proNCE2, Tead2 and YAP65, with or without increasing amounts of a Tead2-Engrailed expression vector. Tead2 and YAP65 were able to modestly activate reporter gene expression (Fig. 7G), and this activation was inhibited in a dose-dependent fashion by Tead2-Engrailed.
We also tested the ability of Tead2-Engrailed to inhibit endogenous Pax3
expression in cultured cells. P19 embryocarcinoma cells can be induced to
adopt neuronal features, and to express Pax3, by addition of retinoic acid
(Pruitt, 1992
). Retinoic acid
also induces activation of reporter gene activity in P19 cells when genomic
fragments containing our Tead2 binding site are included in the reporter
construct (Natoli et al.,
1997
). Hence, we investigated whether Tead2-Engrailed could
prevent retinoic acid-induced Pax3 expression in P19 cells. We co-transfected
a GFP expression vector with control vector, or with a Tead2-Engrailed
expression vector, and subsequently added retinoic acid. More than half of the
GFP-expressing transfected P19 cells also expressed Pax3 in control
experiments (92 of 167 cells counted, 55%)
(Fig. 7H). However, fewer than
10% of cells co-transfected with GFP and Tead2-Engrailed expressed Pax3 (15 of
158, 9.5%) (Fig. 7I). Hence,
Tead2-Engrailed significantly inhibited Pax3 expression both in vitro and in
vivo.
| Discussion |
|---|
|
|
|---|
Previous studies from our laboratory have demonstrated that sequences within the proximal 1.6 kb Pax3 promoter are sufficient to recapitulate Pax3 expression in the dorsal neural tube, and we have shown that transgenic expression of Pax3 in this tissue is sufficient to rescue neural crest defects in Pax3-deficient Splotch mice. In the work reported here we identified crucial enhancer regions located within the proximal 1.6 kb upstream region. We identified two conserved regions, each approximately 200 bp in length, that are separated by a dispensable 156 bp linker region. Previous studies, using cell culture-based assays, have implicated similar genomic regions as being important for Pax3 expression.
Although the minimal neural crest enhancers are sufficient to direct reporter gene expression to the dorsal neural tube, this expression does not entirely recapitulate endogenous Pax3 neural expression. Notably, in all the transgenic embryos that we examined, reporter gene expression was diminished in the cervical regions and was absent from the majority of domains within the CNS in which endogenous Pax3 is expressed. In addition, we noted variable ectopic expression in the most caudal regions of the embryo, lateral to the neural tube. Also, expression within the neural tube was more dorsally restricted than that of endogenous Pax3, and the border between dorsal expressing cells and ventral non-expressing cells was less sharp. These results indicate that regulatory sequences outside of the regions examined contribute to the regulation of Pax3 neural expression. Transgenic analysis of sequences within the proximal 15 kb of upstream sequence, and including the first intron, do not suggest the presence of additional neural regulatory elements within these regions.
Pax3 is an early marker of the neural crest lineage
(Goulding et al., 1991
). It is
expressed prior to Wnt1 and is thought to function upstream of
Foxd3 during neural crest induction
(Dottori et al., 2001
). Neural
crest induction requires tissue-tissue interaction between neural and
epidermal ectoderm. Secreted growth factors of the BMP, Wnt and FGF families
have been implicated in neural crest induction
(Garcia-Castro and Bronner-Fraser,
1999
; LaBonne and
Bronner-Fraser, 1998
), but how they integrate to result in
gene-specific induction, including activation of Pax3, remains
unknown. The identification of specific enhancer regions capable of mediating
neural crest expression of Pax3 should aid in the identification of
these signaling pathways. The observation that Tead2 can bind to one of the
Pax3 neural crest enhancers and mediate activation suggests that
Tead2 may function as an intermediary in a signaling cascade required for
neural crest induction.
The Tead (TEA Domain) family of proteins contain a highly conserved 72 amino acid DNA binding domain, which is evolutionarily conserved between yeast, Drosophila, rat, chick, mouse and human (Jacquemin, 1996; Kaneko, 1997; Kaneko, 1998). There is at least one Tead protein family member expressed in all tissue in the developing embryo as well as in most adult tissues (Kaneko, 1997; Vassilev, 2001). The Tead proteins were initially identified as transcription factors that activated the divergent GT-IIC (TGGAATG), SphI (AAGCATG), and SphII (AAGTATG) enhansons of the SV40 enhancer (Davidson, 1988; Xiao, 1987; Xiao, 1991) and the polyoma virus enhanson (TAGAATG) and its mutated form (TGGAATG) (Davidson, 1988; Xiao, 1987), as well as a muscle-specific M-CAT (CATTCCT) enhanson (Farrance, 1992; Larkin, 1996). The Tead family of proteins (Tead 1-4, Table 1) are known to all bind these divergent sequences with varying affinities (Davidson, 1988; Kaneko, 1998; Xiao, 1991). The binding site identified in the Pax3 NCE2 enhancer, TGAATG, most closely resembles the GT-IIC binding site. Tead2 is able to bind to the NCE2 DNA binding site with high affinity. The other Tead family members are also able to bind the Tead site in NCE2, although with lower affinity (data not shown). Sequences flanking the core binding site are known to modulate the affinity of Tead proteins for Tead binding motifs (Larkin, 1996), which may be an important factor for determining isoform specificity (Farrance, 1996).
Each of the four Tead protein family members, Tead 1-4, displays an overlapping, yet distinct spatiotemporal expression pattern (Jacquemin, 1996; Jacquemin, 1998; Kaneko, 1998; Vassilev, 2001; Yasunami, 1996; Yockey, 1996). Tead2 is the earliest Tead family member to be expressed in the murine embryo with initial appearance at the two cell stage (Kaneko, 1997; Kaneko, 1998). Tead2 was first isolated from neural precursor cells (Yasunami, 1995). By mid-gestation the Tead2 expression pattern includes the ventricular layer of the neuroepithelium in the developing brain and spinal cord and by late gestation persists in the ventricular zone of the CNS, as well as facial and gut mesenchyme, cortical layer of kidney and lung (Jacquemin, 1996). Tead1 and Tead2 have overlapping patterns of expression in early gestation with patterns diverging at midgestation. However, both Tead1 and Tead2 continue to be co-expressed in neuroepithelium. The expression data suggests that Tead2, amongst the Tead family of proteins, is most strongly expressed in regions of neural Pax3 expression. However, other Tead members, specifically Tead1, are co-expressed although less intensely in the dorsal neural tube, suggesting possible functional redundancy (Jacquemin, 1996; Jacquemin, 1998). The dominant negative Tead2-Engrailed construct that we employed in transgenic mice is likely to antagonize transcriptional activation mediated by various members of the Tead family because of their overlapping DNA binding characteristics.
In summary, our studies identify enhancer elements located in the proximal Pax3 upstream genomic region that together are sufficient to recapitulate neural expression of Pax3. One of these enhancer regions is capable of binding Tead2, and Tead2, together with the co-activator YAP65, is able to activate this enhancer. Molecular pathways involved in neural crest induction are likely to converge upon these Pax3 neural enhancers, suggesting that identification and analysis of additional trans-acting regulators will provide further insights into crucial developmental processes required for specification and maturation of the neural crest.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Auerbach, R. (1954). Analysis of the developmental effects of a lethal mutation in the house mouse. J. Exper. Zool. 127,305 -329.[CrossRef]
Baldwin, C. T., Hoth, C. F., Amos, J. A., da Silva, E. O. and Milunsky, A. (1992). An exonic mutation in the HuP2 paired domain gene causes Waardenburg's syndrome. Nature 355,637 -638.[CrossRef][Medline]
Bober, E., Franz, T., Arnold, H., Gruss, P. and Tremblay, P. (1994). Pax-3 is required for the development of limb muscles: a possible role for the migration of dermomyotomal muscle progenitor cells. Development 120,603 -612.[Abstract]
Brown, C. B., Feiner, L., Lu, M. M., Li, J., Ma, X., Webber, A. L., Jia, L., Raper, J. A. and Epstein, J. A. (2001). PlexinA2 and semaphorin signaling during cardiac neural crest development. Development 128,3071 -3080.
Davidson, I., Xiao, J. H., Rosales, R., Staub, A. and Chambon, P. (1988). The HeLa cell protein TEF-1 binds specifically and cooperatively to two SV40 enhancer motifs of unrelated sequence. Cell 54,931 -942.[CrossRef][Medline]
Dottori, M., Gross, M. K., Labosky, P. and Goulding, M.
(2001). The winged-helix transcription factor Foxd3 suppresses
interneuron differentiation and promotes neural crest cell fate.
Development 128,4127
-4138.
Epstein, J., Cai, J., Glaser, T., Jepeal, L. and Maas, R.
(1994). Identification of a Pax paired domain recognition
sequence and evidence for DNA-dependent conformational changes. J.
Biol. Chem. 269,8355
-8361.
Epstein, J. A., Li, J., Lang, D., Chen, F., Brown, C. B., Jin, F., Lu, M. M., Thomas, M., Liu, E., Wessels, A. et al. (2000). Migration of cardiac neural crest cells in Splotch embryos. Development 127,1869 -1878.[Abstract]
Farrance, I. K., Mar, J. H. and Ordahl, C. P.
(1992). M-CAT binding factor is related to SV40 enhancer binding
factor TEF-1. J. Biol. Chem.
267,17234
-17240.
Farrance, I. K. and Ordahl, C. P. (1996). The
role of transcription enhancer factor-1 (TEF-1) related proteins in the
formation of M-CAT binding complexes in muscle and non-muscle tissues.
J. Biol. Chem. 271,8266
-8274.
Franz, T., Kothary, R., Surani, M. A., Halata, Z. and Grim, M. (1993). The Splotch mutation interferes with muscle development in the limbs. Anat. Embryol. 187,153 -160.[Medline]
Garcia-Castro, M. and Bronner-Fraser, M. (1999). Induction and differentiation of the neural crest. Curr. Opin. Cell Biol. 11,695 -698.[CrossRef][Medline]
Goulding, M. D., Chalepakis, G., Deutsch, U., Erselius, J. R. and Gruss, P. (1991). Pax-3, a novel murine DNA binding protein expressed during early neurogenesis. EMBO J. 10,1135 -1147.[Medline]
Goulding, M. D., Lumsden, A. and Gruss, P. (1993). Signals from the notochord and floor plate regulate the region-specific expression of two Pax genes in the developing spinal cord. Development 117,1001 -1016.[Abstract]
Hoth, C. F., Milunsky, A., Lipsky, N., Sheffer, R., Clarren, S. K. and Baldwin, C. T. (1993). Mutations in the paired domain of the human PAX3 gene cause Klein-Waardenburg syndrome (WS-III) as well as Waardenburg syndrome type I (WS-I). Am. J. Hum. Genet. 52,455 -462.[Medline]
Jacquemin, P., Hwang, J., Martial, J. A., Dolle, P. and
Davidson, I. (1996). A novel family of developmentally
regulated mammalian transcription factors containing the TEA/ATTS DNA binding
domain. J. Biol. Chem.
271,21775
-21785.
Jacquemin, P., Sapin, V., Alsat, E., Evain-Brion, D., Dolle, P. and Davidson, I. (1998). Differential expression of the TEF family of transcription factors in the murine placenta and during differentiation of primary human trophoblasts in vitro. Dev. Dynam. 212,423 -436.[CrossRef][Medline]
Jiang, X., Rowitch, D. H., Soriano, P., McMahon, A. P. and Sucov, H. M. (2000). Fate of the mammalian cardiac neural crest. Development 127,1607 -1616.[Abstract]
Kaneko, K. J., Cullinan, E. B., Latham, K. E. and DePamphilis, M. L. (1997). Transcription factor mTEAD-2 is selectively expressed at the beginning of zygotic gene expression in the mouse. Development 124,1963 -1973.[Abstract]
Kaneko, K. J. and DePamphilis, M. L. (1998). Regulation of gene expression at the beginning of mammalian development and the TEAD family of transcription factors. Dev. Genet. 22, 43-55.[CrossRef][Medline]
LaBonne, C. and Bronner-Fraser, M. (1998). Neural crest induction in Xenopus: evidence for a two-signal model. Development 125,2403 -2414.[Abstract]
LaBonne, C. and Bronner-Fraser, M. (1999). Molecular mechanisms of neural crest formation. Annu. Rev. Cell Dev. Biol. 15,81 -112.[CrossRef][Medline]
Larkin, S. B., Farrance, I. K. G. and Ordahl, C. (1996). Flanking sequences modulate the cell specificity of M-CAT elements. Mol. Cell. Biol. 16,3742 -3755.[Abstract]
Lee, S. M., Danielian, P. S., Fritzsch, B. and McMahon, A. P. (1997). Evidence that FGF8 signalling from the midbrain-hindbrain junction regulates growth and polarity in the developing midbrain. Development 124,959 -969.[Abstract]
Li, J., Chen, F. and Epstein, J. A. (2000). Neural crest expression of Cre recombinase directed by the proximal Pax3 promoter in transgenic mice. Genesis 26,162 -164.[CrossRef][Medline]
Li, J., Liu, K. C., Jin, F., Lu, M. M. and Epstein, J. A. (1999). Transgenic rescue of congenital heart disease and spina bifida in Splotch mice. Development 126,2495 -2503.[Abstract]
Maroto, M., Reshef, R., Munsterberg, A. E., Koester, S., Goulding, M. and Lassar, A. (1997). Ectopic Pax-3 activates myoD and myf-5 expression in embryonic mesoderm and neural tissue. Cell 89,139 -148.[CrossRef][Medline]
Natoli, T. A., Ellsworth, M. K., Wu, C., Gross, K. W. and Pruitt, S. C. (1997). Positive and negative DNA sequence elements are required to establish the pattern of Pax3 expression. Development 124,617 -626.[Abstract]
Pruitt, S. C. (1992). Expression of Pax-3- and neuroectoderm-inducing activities during differentiation of P19 embryonal carcinoma cells. Development 116,573 -583.[Abstract]
Serbedzija, G. N. and McMahon, A. P. (1997). Analysis of neural crest cell migration in Splotch mice using a neural crest-specific lacZ reporter. Dev. Biol. 185,139 -147.[CrossRef][Medline]
Stewart, A. F., Suzow, J., Kubota, T., Ueyama, T. and Chen, H.
H. (1998). Transcription factor RTEF-1 mediates
alpha1-adrenergic reactivation of the fetal gene program in cardiac myocytes.
Circ. Res. 83,43
-49.
Tajbakhsh, S., Rocancourt, D., Cossu, G. and Buckingham, M. (1997). Redefining the genetic hierarchies controlling skeletal myogenesis: Pax-3 and myf-5 act upstream of myoD. Cell 89,127 -138.[CrossRef][Medline]
Tassabehji, M., Read, A. P., Newton, V. E., Harris, R., Balling, R., Gruss, P. and Strachan, T. (1992). Waardenburg's syndrome patients have mutations in the human homologue of the Pax-3 paired box gene. Nature 355,635 -636.[CrossRef][Medline]
Vassilev, A., Kaneko, J. K., Shu, H., Zhao, Y. and DePamphilis,
M. L. (2001). TEAD/TEF transcription factors utilize the
activation domain of YAP65, a Src/Yes-associated protein localized in the
cytoplasm. Genes Dev.
15,1229
-1241.
Wawersik, S. and Epstein, J. A. (2000). Gene expression analysis by in situ hybridization. Radioactive probes. Methods Mol. Biol. 137,87 -96.[Medline]
Xiao, J. H., Davidson, I., Ferrandon, D., Rosalesk R., Vigneron, M., Macchi, M., Ruffenach, F. and Chambon, P. (1987). One cell-specific and three ubiquitous nuclear proteins bind in vitro to overlapping motifs in the domain B1 of the SV40 enhancer. EMBO J. 6,3005 -3013.[Medline]
Xiao, J. H., Davidson, I., Matthes, H., Garnier, J. and Chambon, P. (1991). Cloning, expression, and transcriptional properties of the human enhancer factor TEF-1. Cell 65,551 -568.[CrossRef][Medline]
Yasunami, M., Suzuki, K. and Ohkubo H. (1996). A novel family of TEA domain-containing transcription factors with distinct spatiotemporal expression patterns. Biochem. Biophys. Res. Commun. 228,365 -370.[CrossRef][Medline]
Yasunami, M., Suzuki, K., Houtani, T., Sugimoto, T. and Ohkubo,
H. (1995). Molecular characterization of cDNA encoding a
novel protein related to transcriptional enhancer factor-1 from neural
precursor cells. J. Biol. Chem.
270,18649
-18654.
Yockey, C. E., Smith, G., Izumo, S. and Shimizu, N.
(1996). cDNA cloning and characterization of murine
transcriiptional enhancer factor-1-related protein 1, a transcription factor
that binds to the M-CAT motif. J. Biol. Chem.
271,3727
-3736.
Related articles in Development:
This article has been cited by other articles:
![]() |
M. Ota and H. Sasaki Mammalian Tead proteins regulate cell proliferation and contact inhibition as transcriptional mediators of Hippo signaling Development, December 15, 2008; 135(24): 4059 - 4069. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Cao, S. L. Pfaff, and F. H. Gage YAP regulates neural progenitor cell number via the TEA domain transcription factor Genes & Dev., December 1, 2008; 22(23): 3320 - 3334. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sawada, H. Kiyonari, K. Ukita, N. Nishioka, Y. Imuta, and H. Sasaki Redundant Roles of Tead1 and Tead2 in Notochord Development and the Regulation of Cell Proliferation and Survival Mol. Cell. Biol., May 15, 2008; 28(10): 3177 - 3189. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yoshida MCAT Elements and the TEF-1 Family of Transcription Factors in Muscle Development and Disease Arterioscler. Thromb. Vasc. Biol., January 1, 2008; 28(1): 8 - 17. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. G. Engstrom, S. J. Ho Sui, O. Drivenes, T. S. Becker, and B. Lenhard Genomic regulatory blocks underlie extensive microsynteny conservation in insects Genome Res., December 1, 2007; 17(12): 1898 - 1908. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Kulman, J. E. Harris, L. Xie, and E. W. Davie Proline-rich Gla protein 2 is a cell-surface vitamin K-dependent protein that binds to the transcriptional coactivator Yes-associated protein PNAS, May 22, 2007; 104(21): 8767 - 8772. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E. Creemers, L. B. Sutherland, J. McAnally, J. A. Richardson, and E. N. Olson Myocardin is a direct transcriptional target of Mef2, Tead and Foxo proteins during cardiovascular development Development, November 1, 2006; 133(21): 4245 - 4256. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Zhao, G. Caretti, S. Mitchell, W. L. McKeehan, A. L. Boskey, L. M. Pachman, V. Sartorelli, and E. P. Hoffman Fgfr4 Is Required for Effective Muscle Regeneration in Vivo: DELINEATION OF A MyoD-Tead2-Fgfr4 TRANSCRIPTIONAL PATHWAY J. Biol. Chem., January 6, 2006; 281(1): 429 - 438. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Morin-Kensicki, B. N. Boone, M. Howell, J. R. Stonebraker, J. Teed, J. G. Alb, T. R. Magnuson, W. O'Neal, and S. L. Milgram Defects in Yolk Sac Vasculogenesis, Chorioallantoic Fusion, and Embryonic Axis Elongation in Mice with Targeted Disruption of Yap65 Mol. Cell. Biol., January 1, 2006; 26(1): 77 - 87. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sawada, Y. Nishizaki, H. Sato, Y. Yada, R. Nakayama, S. Yamamoto, N. Nishioka, H. Kondoh, and H. Sasaki Tead proteins activate the Foxa2 enhancer in the node in cooperation with a second factor Development, November 1, 2005; 132(21): 4719 - 4729. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||