|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 25 February 2004
doi: 10.1242/dev.01033
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

,
1 GSF, Institute for Mammalian Genetics, Ingolstaedter Landstrasse 1, D-85764
Neuherberg, Germany
2 Developmental Biology, Institute Biology 1, University of Freiburg,
Hauptstrasse 1, D-79104 Freiburg, Germany
Author for correspondence (e-mail:
ela.knapik{at}biologie.uni-freiburg.de)
Accepted 12 December 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Neural crest, Apoptosis, Zebrafish, tfap2a, mont blanc, Craniofacial development, Pigment, Cranial ganglia, Muscle development
| Introduction |
|---|
|
|
|---|
Wnt, Bmp2/4 and TGFß 1, 2 and 3 signaling pathways regulate the
induction of multipotent neural crest progenitor cells and the newly specified
premigratory neural crest progenitors express a unique set of transcription
factors that includes Foxd3, Slug, Id2, Sox10 and Tcfap2a
(Knecht and Bronner-Fraser,
2002
). Subsequently, the neural crest cells turn off early markers
like Foxd3, upregulate a new set of genes (e.g. cadherins 7 and 11, Rho
proteins) and begin migration (Nieto,
2001
). At this stage of development, neural crest cells
originating in the midbrain migrate as a wave in a caudal direction. The first
to migrate are the cells populating the pharyngeal arches and neuronal
progenitors of the peripheral nervous system in the trunk. This first group of
cells is followed by a second wave of migration supplying cells to cranial
ganglia in the head and pigment cells in the trunk
(Kelsh and Raible, 2002
).
During migration, cells continue to proliferate and begin to express genes
defining the cell lineage they are destined to form. The craniofacial neural
crest expresses genes associated with formation and differentiation of
mesenchymal condensations (e.g. sox9a, wnt5a, dlx2, dlx6, dlx8)
(Chiang et al., 2001
;
Blader et. al., 1996
;
Richman and Lee, 2003
), while
the pigment cell lineages are marked by mitfa, fms, kit and
dct (Kelsh and Raible,
2002
; Rawls et al.,
2001
; Parichy et al.,
2000
; Goding,
2000
). The neural crest cells are guided to their final
destinations, change morphology and differentiate to mature derivatives. These
processes have been well described by embryologists, but genetic and molecular
data on genes and their function in neural crest induction, specification and
differentiation has only recently begun to emerge. However, the genetic
circuits that coordinate such complex developmental processes still remain
unclear.
To gain further insight in the genetic control of neural crest differentiation, we have characterized the phenotype of zebrafish mont blanc (mobm610) mutant embryos. Our results show that in mont blanc (mobm610) mutant embryos, neural crest induction, specification and the initial stages of cranial neural crest migration appear undisturbed, while later in development, the craniofacial primordia in pharyngeal arches two to seven fail to form and trunk neural crest derivatives are severely reduced. Further analysis revealed that the mobm610 mutant neural crest cells, with the exception of those in the first pharyngeal arch, are unable to undergo proper differentiation, abort migration and die by apoptosis. Using linkage analysis and genetic mapping, we have identified the transcription factor ap-2 alpha (tfap2a) as the gene altered by the mobm610 mutation. Consistent with a role during neural crest cell migration, we found that tfap2a is expressed in early neural crest progenitors and in migratory neural crest cells. Our findings indicate that tfap2a/mob is essential for neural crest cell differentiation and survival and that it is specifically required for normal development of arches 2-7 and trunk neural crest.
| Materials and methods |
|---|
|
|
|---|
Cartilage staining
The Alcian Blue staining protocol was modified from Neuhauss et al.
(Neuhauss et al., 1996
).
Embryos at 3 to 5 dpf were anesthetized in 0.02% buffered tricaine (Sigma) and
fixed overnight in 4% phosphate-buffered paraformaldehyde (PFA) at 4°C.
After washing in phosphate-buffered saline (PBS), embryos were bleached in 1
ml 10% hydrogen peroxide (H2O2) supplemented with 50
µl of 2 M KOH for 1 hour. They were then stained overnight in 0.1% Alcian
Blue dissolved in acidic ethanol (70% ethanol, 5% concentrated hydrochloric
acid), washed extensively in acidic ethanol, dehydrated and stored in 80%
glycerol. For better exposure of cartilage elements embryos were digested with
proteinase K.
Genetic mapping and cloning
mobm610 was mapped in a F2 intercross using bulked
segregant analysis (Michelmore et al.,
1991
). mobm610 heterozygous fish and wild-type
TL fish were crossed to obtain the F1 generation. In sibling crosses we
identified mutation-carrying F1 heterozygotes and F2 embryos were scored for
the mobm610 phenotype at 3 dpf. The F2
mobm610 embryos were frozen and DNA was extracted by
proteinase K digestion (buffer: 10 mM Tris, 50 mM KCl, 1% Tween 20, proteinase
K 1 mg/ml) overnight at 55°C followed by heat inactivation at 98°C for
10 minutes. DNA from a single embryo was diluted in 500 µl TE buffer and 5
µl were used per PCR reaction. We then pooled in equal proportions DNA of
10 mobm610 and 10 wild-type sibling embryos. The two pools
were PCR-genotyped with a set of SSLP (simple sequence length polymorphism)
markers evenly spaced across the zebrafish genome [on average every 20
centiMorgans (Knapik et al.,
1998
)] and resolved by electrophoresis on 2% agarose gels.
Potential linkages were tested on individual embryos in order to define the
critical interval containing the mobm610 mutation.
SSCP (single strand confirmation polymorphism)
(Foernzler et al., 1998
)
analysis of the 3'UTR region of tfap2a was performed by PCR
with the addition of
32P-dCTP, and products were resolved in
MDE (BioWhittaker) or 6% acrylamide denaturing gels run at constant voltage
for 12-14 hours. After electrophoresis, gels were transferred to Whatman paper
and exposed to X-OMAT film (Kodak) at 80°C without drying.
Three isoforms of tfap2a varying by an alternatively spliced first
exon were found in public databases: tfap2a1, tfap2a2 (Gene Bank
Accession Numbers AF457191 and AF457192, respectively) and tfap2a3
(zebrafish EST fc31a07). mRNA was isolated from 4 dpf embryos with the Trizol
reagent (Invitrogen). Full-length cDNA cloning of tfap2a isoforms was
performed with primers ap2a1F1 (CTCGAGCCTTGTATGCACTG), ap2a2F1
(GAGGGACACAAGACCCAATG), ap2a3F1 (GCATCTAAAGGGCAGACGAA) and ap2aR
(TAAATGCCAAGATCGGAAGG). The PCR products were sequenced with the same primer
set plus ap2aF2 CGGGTTACCGCATCAACTAT. RT-PCR was carried out using the
Platinum Taq system (Invitrogen). Genomic DNA including the tfap2a
exon 7 full coding region was amplified with primers ap2a-ex7F
ACGGAATACGTGTGTCATCG and ap2a-ex7R GGTGGTGGGTTCAGTGTTTC yielding a product of
504 bp that was sequenced with the same primers. The XbaI restriction
digest of the amplification product yielded two fragments of 378 bp and 126 bp
for wild-type embryos but owing to obliteration of the XbaI site, the
504 bp fragment for mobm610 mutant embryos. A second
mont blanc allele (mobm819) was cloned that
introduces a stop codon at the end of exon 5 leading to deletion of the
dimerization and DNA-binding domains encoded by exons 6 and 7
(Holzschuh et al., 2003
).
The full-length sequence of the tfap2a gene was assembled based on the genomic sequences obtained from the Sanger Institute (The Danio rerio Sequencing Project; http://www.sanger.ac.uk/Projects/D_rerio/).
In situ hybridization and immunohistochemistry
Whole-mount in situ hybridization was performed as described by Thisse et
al. (Thisse et al., 1993
). The
following probes were used: crestin
(Rubinstein et al., 2000
),
dlx2 (Akimenko et al.,
1994
), dbh (Holzschuh
et al., 2003
), dct
(Kelsh et al., 2000b
),
foxd3 (Kelsh et al.,
2000a
), hoxb2a (Prince, 1998), kit
(Parichy et al., 1999
),
snail2 (Thisse et al.,
1995
), sox9a (Chiang
et al., 2001
), sox10
(Dutton et al., 2001
),
wnt5a (Rauch et al.,
1997
) and xdh
(Parichy et al., 2000
).
Embryos were staged and fixed overnight in 4% PFA in PBS at 4°C, then
washed in PBS/0.1% Tween 20 (PBT), dehydrated stepwise to methanol, and stored
at 20°C.
For antibody staining, embryos were anesthetized and fixed overnight in 4% PFA in PBS at 4°C. After washing, they were dehydrated to methanol and stored at 20°C. After rehydration, embryos were permeabilized with proteinase K, re-fixed and washed in PTD [1% dimethylsulfoxide (DMSO), 0.3% Triton X-100 in PBS]. They were then incubated in blocking solution (PBT, 2% heat-inactivated normal goat serum, 2 mg/ml BSA). Anti-Hu antibody (Molecular Probes) was prepared in blocking solution at 1:100 dilution and anti-myosin antibody (kindly provided by Dr E. Kremmer, GSF) at 1:10 dilution of the hybridoma supernatant, and incubated overnight at 4°C. After extensive washes in PTD, embryos were incubated with biotinylated secondary antibodies (Vector) at 1:200 dilution in blocking solution for 1 hour at room temperature. The color reaction was developed using the Vectastain ABC kit with horseradish peroxidase and DAB as chromogen (Vector). After staining embryos were cleared and stored in 80% glycerol. For flat-mount preparations, yolk was removed with fine needles and embryos were mounted between cover slips. Preparations were photographed using a Zeiss Axioscope microscope and composite images were prepared with Adobe Photoshop.
Fate mapping of cranial neural crest cells
Embryos were injected at the one to two-cell stage with a 5% solution of
DMNB-caged fluorescein 10,000 Mr (Molecular Probes) in 0.2
M KCl. At the 6- to 8-somite stage, the most dorsal region of the hindbrain
was exposed to a 10 second light pulse from a 354 nm laser mounted on a Zeiss
LSM510 inverted confocal microscope. Embryos were photographed immediately to
document the extent of uncaging, allowed to develop until 24 hpf and
re-photographed.
Cell death assays
TUNEL (terminal transferase mediated dUTP nick end-labeling) and Acridine
Orange labeling were used to assess apoptosis in mobm610
mutants. For TUNEL analysis, embryos were staged and fixed as for in situ
hybridization and stored in methanol. After rehydration, embryos were
permeabilized by proteinase K digestion, re-fixed in buffered 4% PFA, washed
in PBT and subsequently placed in terminal transferase buffer (Roche). Embryos
were incubated on ice for 1 hour with terminal transferase (Roche) and
biotin-labeled ddUTP (Roche) followed by 1 hour incubation at 37°C. Next,
embryos were extensively washed in PBT and the biotin incorporation was
detected with the peroxidase ABC kit (Vector) using DAB as chromogen. Embryos
were stained at 10 timepoints (experiment 1: 18, 19, 20, 22, 23, 24 hpf;
experiment 2: 24, 26, 28, 30, 32 hpf) to determine at which stage the cells
are eliminated. In each batch, 40 embryos were obtained by mating of carrier
fish, thus expecting 10 mutant and 30 wild-type embryos (n=440).
Live embryos were stained for apoptotic cells with the vital dye Acridine Orange that permeates inside acidic lysosomal vesicles and becomes fluorescent, thus marking cells dying by apoptosis. The stock solution (5 mg/ml in egg water, 300x) was diluted to 1x concentration and dechorionated embryos were bathed in this solution for 20 minutes in the dark. Embryos were washed in egg water and analyzed under a fluorescence microscope. After initial optimization of the protocol, we stained embryos obtained from mating of carrier fish at 24 to 25 hpf (n=72 from mobm610 and n=40 from mobm819). We exposed embryos only once to UV light during photography and allowed them to develop in the dark until the visible phenotype of the mont blanc embryos could be scored. We detected normal apoptosis levels in the lens of both wild-type embryos and mob mutants that served as an internal control.
| Results |
|---|
|
|
|---|
|
We did not observe any defects in mesodermally derived neurocranium
cartilages in the mobm610 mutant embryos. By contrast, the
trabeculae originating from neural crest and mesoderm had a normal rostral
extent but failed to fuse and build the ethmoid plate. The lack of ethmoid
plate shows variable penetrance (in
40% of mobm610
mutant embryos) and expressivity (varying from complete separation of the two
trabeculae to small discontinuations in the ethmoid plate of two to three
cells length). This phenotype is reminiscent of clefting of the palate in
higher vertebrates. The pectoral fins develop normally. These results indicate
that the mobm610 mutation specifically affects the neural
crest-derived craniofacial skeleton of pharyngeal arches two to seven and the
neural crest derived ethmoid plate, while the first pharyngeal arch as well as
the mesodermally derived neurocranium and the pectoral fins are not
affected.
Dorsal pharyngeal arch muscles are absent in mobm610 mutants
As neural crest derived craniofacial cartilage is known to pattern
associated head musculature (Noden,
1983
; Schilling and Kimmel,
1997
), we examined how the mobm610 mutation
affects development of craniofacial muscles using an antibody against myosin
(Fig. 1E). Our analysis
revealed that the adductor mandibulae (am), a dorsal muscle originating from
the first arch territory, is always present as are all ventral muscles of the
first arch, the intermandibularis anterior (ima) and intermandibularis
posterior (imp) (Fig. 1F). The
latter muscle is displaying a varying degree of deformity ranging from slight
elongation to shorter and defasciculated fibers joining caudally with second
arch muscles. By contrast, the two dorsal muscle pairs of the mandibular arch,
levator arcus palatini (lap) and dilator operculi (do) are absent in
mob mutants (Fig.
1G,H). Similarly, the dorsal hyoid arch muscles, the adductor
opercule (ao), the levator operculae (lo) and the adductor hyomandibulae (ah)
are also absent in mobm610 mutant embryos
(Fig. 1G,H). The ventral
muscles of the second pharyngeal arch, interhyals (ih) and hyohyals (hh) are
hard to distinguish as individual muscles, but all mutants have a bundle of
muscle fibers in the approximate location of the ih and hh.
The individual posterior pharyngeal arches 3 to 7 have their own set of small muscles for each of the paired ceratobranchial cartilages, i.e. the transversi ventrales, rectus ventralis, dorsal pharyngeal wall muscles and rectus communis. We were not able to identify symmetric sets of muscles in mobm610 mutants as found in wild-type embryos, although small clusters of myosin positive cells were occasionally seen in the last posterior arch in some of the mutant embryos. The most superficially located muscle, sternohyoideus (sh), stretching from the pectoral girdle cartilages to the ceratohyal cartilage, is always present in mobm610 mutants but is shorter and thicker conserving its caudal attachment, while rostrally extending only to the anterior edge of the heart. It is interesting to note that all eye movement muscles are well formed and positioned in mobm610 (not shown). Our findings indicate that loss of craniofacial cartilage elements is accompanied by loss of the corresponding muscle sets in the mobm610 mutant embryos.
Molecular nature of the mobm610 mutation
To identify the affected gene, we genetically mapped the
mobm610 mutation and used a positional candidate cloning
strategy. Genotyping of wild-type and mobm610 mutant pools
of DNA from F2 animals with SSLP markers
(Knapik et al., 1998
) linked
mobm610 to LG24. Linkage was confirmed by genotyping of
individual F2 mutant embryos with the flanking markers Z59948 and Z15002.
Using over 3400 meioses we established a fine map of the region and were able
to restrict the critical genetic interval harboring the
mobm610 mutation between markers Z23011 (1.3 cM, 39
recombinants out of 2930 meioses) and Z65547 (1.1 cM, 39 recombinants out of
3356 meioses; Fig. 2A).
Considering the relatively large genetic interval of 2.3 cM (approximately 1.5
Mb), we examined available human and mouse synteny maps, as well as zebrafish
ESTs mapped on the radiation hybrid panels
(www.zfin.org),
to search for positional candidate genes. The most plausible candidate
appeared to be the transcription factor ap-2
. Tcfap2a is expressed in
neural crest progenitor cells (Mitchell et
al., 1991
) and mice lacking functional Tcfap2a exhibit
craniofacial defects, hypoplastic heart and kidneys, and have strong reduction
of neural crest derived peripheral neurons
(Zhang et al., 1996
;
Schorle et al., 1996
). To test
whether tfap2a is disrupted in mobm610, we
developed a set of PCR primers revealing a polymorphism in the 3'UTR of
the gene. Using SSCP analysis we genotyped all 78 meiotic recombinants
flanking the mutation and did not find a single recombination event between
the mob locus and the tfap2a gene. The very close linkage of
less than 0.03 cM (<20 kb) provided the first indication that the
mob locus corresponds to the tfap2a gene.
|
G transition between mobm610 and
wild-type animals, a change often seen in ENU-induced mutations
(Knapik, 2000
tfap2a is expressed in neural crest progenitors, pronephric ducts and brain
The tfap2a gene is broadly expressed as early as 50% epiboly
(Fig. 3A) and as development
progresses, it becomes restricted to the neural plate border. At the 2-somite
stage tfap2a is found in the neural crest progenitor cells
(Fig. 3B,C). This expression
domain is maintained as the cranial neural crest cells begin to migrate by the
10-somite stage (Fig. 3D,E). At
14-somite stage, expression commences in the intermediate mesoderm in the
caudal part of the embryo (Fig.
3F,G). At this time, expression continues in migrating cranial
neural crest cells and premigratory trunk neural crest cells
(Fig. 3F,G). In parallel, the
tfap2a transcript appears in the midbrain, hindbrain and spinal cord
(Fig. 3F,G). About 2 hours
later, the number of cells expressing tfap2a has increased and now it
can be also seen in the epidermis and developing pronephric ducts
(Fig. 3H,I). At 24 hpf, the
craniofacial primordia continue to express tfap2a. In addition, the
lateral line primordium, several sites in the hindbrain, the cerebellum, the
tectum and the epiphysis stain positive for tfap2a
(Fig. 3J,K). The expression in
pronephric ducts is downregulated at this stage. At 36 hpf, tfap2a
expression is observed in the segmented hindbrain rhombomeres, in the
pharyngeal arches and in a group of cells positioned between the otic vesicle
and the pharyngeal arches that will give rise to the epibranchial ganglia
(Fig. 3L). Expression analysis
in embryos obtained from mating of mobm610 carrier fish
did not reveal any differences in the levels of the tfap2a message
between wild-type and mutant animals, indicating that this gene is not
autoregulated.
|
|
To investigate at what stage of pigment cell development tfap2a functions,
we analyzed mRNA expression of dct (dopachrome tautomerase),
a marker of unpigmented melanoblasts and pigmented melanophores
(Kelsh et al., 2000b
). In
wild-type embryos at 22 hpf, dct-labeled melanoblasts in the head are
concentrated in a cluster posterior to the eye, while the trunk melanoblasts
are mostly located at the post-otic region and begin to disperse over the yolk
sac moving in ventroposterior directions
(Fig. 4G). In
mobm610 mutants, there are very few melanoblasts posterior
to the eye and a small cluster of cells in the region posterior to the ear
with only sporadic cells migrating over the yolk sac
(Fig. 4H). Expression of the
mitfa transcription factor, a key gene in melanoblasts specification,
is only slightly delayed in mutant embryos (data not shown) but the tyrosine
kinase receptor kit that labels the differentiating pigment cell
lineage is dramatically reduced in melanoblast
(Fig. 4I,J).
The development of xanthophores, the third pigment cell type in zebrafish, is also affected by the mobm610 mutation. Xanthophore migratory progenitors can be identified by xanthine dehydrogenase (xdh) expression, one of the enzymes in the xanthopterin synthesis pathway. We found that xdh expression is markedly diminished in the anterior trunk of 25 hpf mobm610 mutant embryos, but a sizable population of migrating cells is present in the posterior trunk (Fig. 4K,L). Xanthophores appear normal at 48 hpf (Fig. 4C,D) giving embryos the characteristic golden hue that intensifies as development progresses.
Taken together, our results suggest that normal development of pigment cells depends on tfap2a function, as shown by deficits in the melanization and the diminished expression of early markers defining neural crest derived pigment cells.
Satellite cell glia, dorsolateral placodes and epibranchial ganglia require tfap2a/mob for normal development
In zebrafish, progenitor cells that will differentiate into satellite cells
associated with cranial ganglia neurons express foxd3
(Kelsh et al., 2000a
). We
analyzed foxd3 expression in 24 hpf embryos to determine if
tfap2a is necessary for patterning and differentiation of the neural
crest derived glial lineage (Fig.
5A). At this stage, we found a severe reduction but not absence of
foxd3 expression in cells surrounding cranial ganglia. This effect
was most pronounced in the trigeminal ganglion and the ganglia that occupy the
preotic region (Fig. 5B). The
reduction of expression was least evident in ganglia located posterior to the
otic vesicle.
|
To compare requirements for tfap2a function between lower and higher vertebrates, we analyzed the expression of a panneuronal marker to visualize the arrangement of cranial ganglia around the otic capsule at 4 dpf mobm610 embryos (anti-Hu, antibody staining, Fig. 5E-H). The most anterior cluster of cells belonging to the group of the trigeminal (tg), facial and anterior lateral line (all) ganglia appears to be reduced in size, although we have noticed variability in the severity of this phenotype ranging from slight reduction in size to a small, scattered pool of cells (Fig. 5E,G). The posterior lateral line ganglion (pll) at the caudal edge of the otic capsule appears to be unaffected, while the middle lateral line ganglion (mll) is reduced and in some cases absent. Curving around the otic capsule are clusters of cells belonging to nuclei of the vagal ganglion. It appears that the most posterior nucleus is not affected or only slightly reduced, while the middle one is in most cases absent and the anterior thickening of the vagal ganglion is significantly smaller. The glossopharyngeal ganglion positioned below the junction of anterior and ventral walls of the otic capsule as well as the octaval ganglion directly above it are practically absent with only a few cells present in some of the mutant animals (Fig. 5F,H). We obtained similar results analyzing the ret expression pattern by whole-mount in situ hybridization (data not shown). In summary, development of the cranial neuronal and glial lineages that are derived from neural crest and ectodermal placodes depends on tfap2a activity. In its absence, these cells fail to express foxd3 and neurod and ultimately do not form the majority of the mechanosensory and visceral sensory cranial ganglia.
Reduction of the neural crest derived enteric nervous system and trunk sensory neurons in mobm610 mutants
Aside from pigment cells, the trunk neural crest gives rise to the
peripheral nervous system. We have used the anti-Hu panneuronal antibody to
examine the pattern of trunk dorsal root ganglia and enteric neurons in
mobm610 mutant embryos. In wild-type larvae the sensory
neurons of dorsal root ganglia (DRG) are distributed bilaterally along the
anteroposterior (AP) axis and are positioned at the level of the ventral
spinal cord with one pair of DRGs in each somitic segment
(Fig. 5I). In
mobm610 mutants the number of DRGs is greatly reduced. To
quantify the extent of missing ganglia, we have unilaterally counted the DRGs
in wild-type embryos at 4 dpf between the otic capsule and the anus. We
distinguished 17 DRGs in wild-type embryos while in the
mobm610 mutants there were only 5±2 (n=72)
ganglia in the corresponding region (Fig.
5J) representing a
70% reduction of normal numbers. We did
not observe any region of preferential loss of ganglia along the AP axis or in
the left versus right side. At 4.5 dpf, wild-type DRGs consist of
approximately three to five cells per ganglion, and the number increases with
progressing development. We found that most ganglia in
mobm610 mutants had the number of cells reduced by half,
and many contained only one or two cells. Additionally, we observed in each
embryo one or two neurons that were ectopically located at the level of
notochord or dorsal neural tube.
Enteric neurons populate the gut of the larvae and at 4 dpf there are
200 single cells distributed along the entire length of the gut
(Kelsh and Eisen, 2000
).
Staining with anti-Hu antibody visualizes enteric neurons in wild-type embryos
while most of the mobm610 mutants were devoid of enteric
neurons in the distal part of the gut tube
(Fig. 5I,J). In few
mobm610 mutants (
32%), we observed sporadic enteric
neurons in the proximal gut. Sympathetic ganglia that are of neural crest
origin and will differentiate to produce noradrenergic neurotransmitters begin
to express dopamine beta hydroxylase (dbh), one of the
enzymes in the neurotransmitter synthesis pathway. We labeled sympathetic
neurons at 48 hpf and found that there is no expression of dbh in
mobm610 mutant embryos
(Fig. 5K,L). These findings
indicate that tfap2a is necessary for normal patterning and cell
numbers of the trunk DRGs, sympathetic ganglia and enteric neurons.
tfap2a is not required for neural crest progenitors specification but is essential for activation of genetic programs that define chondrogenic neural crest
Neural crest progenitors are induced during gastrulation at the neural
plate border and begin to separate from other neuronal cell types in this
territory by expressing neural crest specific genes. Among the earliest genes
expressed during initial stages of neural crest specification are snail2,
foxd3, sox10 and tfap2a. We studied expression patterns of these
genes to assay neural crest specification in mobm610
mutants when compared with wild-type embryos. In mobm610
mutant embryos, we did not observe reduced expression of these genes at 1- to
10-somite stages (9 hpf through 14 hpf), the time before the onset of
migration (Fig. 6A-C).
Additionally, we followed the expression of sox10, a transcription
factor characteristic for all non-ectomesenchymal neural crest progenitor
cells (Dutton et al., 2001
),
which appears normal through the 20-somite stage in
mobm610 mutants (Fig.
6D). Surprisingly, in mobm610 mutants we
observed a complete loss of crestin expression in cranial neural
crest cells at 10- and 20-somite stages and a reduction in the trunk crest
(Fig. 6F,H). crestin
is a multiple copy retroelement expressed in premigratory and migratory neural
crest cells (Rubinstein et al.,
2000
) (Fig.
6E,H).
|
The neural crest cells begin migration at
15 hpf in a wave originating
at the midbrain and progressing along in caudal direction. At 18 hpf, the
majority of chondrogenic neural crest cells begin descending towards the
pharyngeal arches, while the trunk neural crest is just starting to enter the
medial migratory pathway. The neural crest migration continues through 24 hpf.
Considering that mobm610 mutants are deprived of
chondrogenic derivatives, while initially neural crest cells appear to be
specified normally, we tried to identify the time when chondrogenic precursors
are eliminated. As mentioned above, analysis of migratory neural crest showed
that expression of hoxa2, hoxb2 and hoxb3 at 18 hpf is
normal in the rhombomeres and migrating neural crest in
mobm610 embryos. By contrast, at 24 hpf Hox genes were not
expressed in the second and postotic neural crest streams, while their
hindbrain expression was unaffected (Fig.
7C,D and data not shown). Similarly, the expression of dlx2,
sox9a and wnt5a was only slightly reduced in
mobm610 embryos at 18 hpf, and at 24 hpf we found normally
demarcated first stream of neural crest carrying cells to the mandibular arch.
However at this stage, in mobm610 embryos we could not
detect the second neural crest stream entering the hyoid arch and the postotic
crest supplying posterior pharyngeal arches
(Fig. 7A,B,E-H). In some mutant
embryos, we found a few cells expressing neural crest specific genes in the
migratory paths of the posterior pharyngeal arches. Taken together, our data
suggest that tfap2a is not acting during the neural crest
specification phase, but rather is needed later to maintain neural crest
proliferation, identity, and/or differentiation.
|
To address this issue, we traced the fate of neural crest progenitors in live embryos. We labeled embryos from a cross of heterozygous mobm610 parents by injecting caged fluorescein into one- or two-cell stage embryos. These animals were allowed to develop until the 6- to 8-somite stage when the dorsal edge of the hindbrain was exposed to UV-laser light to uncage the fluorescein in the territory from which neural crest progenitors will begin to migrate (Fig. 8A,C). Every embryo (n=20 in each of two independent experiments) was photographed and individually tracked until 24 to 25.5 hpf when we analyzed the migration of craniofacial primordia. We found that in 29 animals migrating neural crest was separated into individual streams (Fig. 8B). In the remaining nine animals (two embryos died) we observed migrating cells of the first pharyngeal arch, while the pre-otic and post-otic streams never left the level of the ventral margin of the neural tube. There the cells clustered together as an amorphic mass (Fig. 8D). In some of these animals, we noted individual or very small groups of cells leaving the neural tube and migrating in ventral direction. All experimental animals were allowed to develop up to 3 dpf when they were scored for the morphological mobm610 phenotype. All embryos in which preotic and postotic neural crest streams failed to migrate developed the characteristic mobm610 phenotype.
|
Migrating mobm610 neural crest cells undergo apoptosis before they reach their final destination
Our results imply that cranial neural crest cells initially form in
mob mutants but are unable to turn on their terminal differentiation
program. Thus, these ill-fated neural crest cells might enter alternative
pathways that lead to apoptosis, which may explain the lack of neural crest
derivatives. To test this hypothesis, we have used the TUNEL assay and in vivo
labeling with Acridine Orange to visualize apoptotic cells. In TUNEL assays we
have detected increased chromatin fragmentation in dying cells at a time when
neural crest cells disappear (Fig.
9A,B). In mobm610 mutants, we observed
increased cell death in neural folds at 24 hpf that specifically affects the
cranial crest of the second and posterior arches. We have independently
confirmed these results in live embryos stained with Acridine Orange
(Fig. 9C,D) where we observed a
very specific accumulation of dying cells in the preotic and postotic streams
of cranial neural crest at 24 hpf (Fig.
9D). These embryos were individually tracked and scored for the
mob craniofacial phenotype at 3 dpf. These findings demonstrate that
in the absence of tfap2a function, neural crest progenitors are
specified and begin to migrate, but they are unable to maintain the
differentiation process and undergo apoptosis.
|
| Discussion |
|---|
|
|
|---|
Tcfap2a belongs to a small family of nuclear proteins that bind as
hetero- or homodimers to the palindromic core sequence
5'-GCCN3GGC-3'
(Mohibullah et al., 1999
).
Other members include Tcfap2b (Moser et
al., 1995
), Tcfap2g (Bosher et
al., 1996
) and Tcfap2d (Zhao
et al., 2001
). Binding sites for these proteins were found in
numerous developmentally regulated genes, e.g. Erbb2
(Bosher et al., 1996
),
KIT (Huang et al.,
1998
) and Hoxa2
(Maconochie et al., 1999
). The
TFAP2A protein contains a transactivation domain (P/Q rich region) and a basic
and helix-span-helix region at the C terminus that constitutes the
dimerization and DNA binding domains. Williams and Tjian
(Williams and Tjian, 1991a
;
Williams and Tjian, 1991b
)
have shown that the C-terminal half of the protein is crucial for its function
and that deletion of the last exon leads to loss of protein dimerization, DNA
binding and transcriptional activity. Results of these DNA-binding studies
were later exploited in designing DNA constructs for inactivation of the
Tcfap2a gene by homologous recombination in the mouse
(Zhang et al., 1996
;
Schorle et al., 1996
).
We have cloned the zebrafish mont blanc locus and demonstrated
that mobm610 mutation destroys the 3' splice
junction preceding the last exon (exon 7) of the zebrafish tfap2a
gene. As a result, the splicing machinery is forced to use a cryptic splice
site 14 bp into exon 7 that leads to a frame-shift and premature truncation of
the protein. RT-PCR analysis specific for the deleted part of the gene did not
reveal normally spliced message in the mutant embryos, which indicates that
this mutation effectively abolishes the transcriptional activity of the Tfap2a
protein. However, the question remains whether the variable phenotype of the
mobm610 allele, as expressed by sporadic remnants of head
cartilages, enteric neurons or DRGs, reflects residual Tfap2a activity due to
an alternatively spliced allele, or whether some neural crest cells can
develop normally in the complete absence of functional Tfap2a. To address this
issue we have characterized the key phenotypes of the second zebrafish
mobm819 allele that creates a premature stop codon
deleting the last 2 exons (Holzschuh et
al., 2003
). We have carefully compared the phenotype of
mobm610 and mobm819 mutant embryos and
found that the craniofacial cartilage, neuronal (enteric, sympathetic, DRG,
cranial ganglia) and all pigment cell phenotypes are identical between the two
alleles (data not shown). Additionally, the apoptosis in the cranial neural
crest streams showed the same severity in mobm819 mutants
(data not shown). Therefore, we conclude that the two mutations show the same
level of tfap2a loss-of-function. The phenotype of the zebrafish
mutations resembles the two mouse knockout lines where exon 5
(Schorle et al., 1996
) and
exon 6 (Zhang et al., 1996
)
were deleted. All four mutant lines obliterate transcriptional activity of the
Tfap2a/Tcfap2a protein, and they can be considered as amorphic
loss-of-function alleles. Because in zebrafish loss of Tfap2a activity does
not affect either neurulation or body wall closure, we were able to study the
specific function of Tfap2a in neural crest development.
tfap2a/mob is required for terminal differentiation of chondrogenic neural crest in pharyngeal arches 2 to 7, but not in the mandibular arch
The first pharyngeal arch forms normally in mob mutants and thus
appears to be under a separate differentiation program that is not controlled
by tfap2a. Crest of the first pharyngeal arch does not express Hox
genes while the migratory cranial neural crest cells contributing to arches 2
to 7 are under the control of Hox genes, specifically hoxa2, hoxb2
and hoxa3 (Schilling et al.,
2001
). Expression of Hox genes (hoxa2, hoxb2, hoxa3) in
mob mutant arches 2 to 7 is progressively diminishing, starting from
18 hpf when the facial primordia begin migration, and is almost completely
absent by 24 hpf. In the mouse, Hoxa2 confers second arch identity
and its promoter contains a cranial neural crest enhancer built of three
consecutive Tcfap2a-binding sites
(Maconochie et al., 1999
).
This promoter structure is conserved in zebrafish where we also found multiple
tfap2a-binding sites (A.B.-G. and E.W.K., unpublished). Similarly, it
has been shown in zebrafish that the Hox paralogue group 2 (Hox PG2) specifies
hyoid arch identity (Hunter and Prince,
2002
). Results presented here are consistent with the hypothesis
that in zebrafish tfap2a is acting upstream of Hox genes during the
migration of the craniofacial primordia.
Furthermore, we have found that genes defining the chondrogenic neural
crest, e.g. wnt5a, sox9a and dlx2, are greatly reduced in
pharyngeal arches 2 to 7 in tfap2a/mobm610 mutant embryos,
whereas they are normally expressed in the first arch. The expression of
wnt5a commences in migrating chondrogenic crest around 18 hpf and
persists in cartilage until beginning of chondroblast differentiation (
48
hpf), but it is absent in mature chondrocytes
(Blader et al., 1996
).
Chondrocyte maturation defects were observed in all neural crest derived
cartilages in the zebrafish mutation pipetail/wnt5a and also in
jellyfish/sox9a, where final steps of cartilage terminal
differentiation fail to proceed (Rauch et
al., 1997
; Piotrowski et al.,
1996
; Yan et al.,
2002
). Our data suggest that wnt5a and sox9a are
regulated by tfap2a in Hox-positive pharyngeal arches but are under
control of different regulatory pathways in the first pharyngeal arch.
Craniofacial cartilage patterns head paraxial mesoderm
Similar to other vertebrates, zebrafish head muscles are derived from
paraxial mesoderm (Kimmel et al.,
1990
; Noden,
1983
). The craniofacial cartilages and their corresponding muscles
develop concurrently following the segmental pattern of pharyngeal arches
(Schilling and Kimmel, 1997
).
Muscles originating from the paraxial mesoderm of the first and the second
pharyngeal arch form the ventral set of muscles ima, imp (first arch), and ih,
and hh (second arch; for abbreviations, see Results). In
mobm610 mutant embryos we found that the orderly pattern
of the striated cranial muscles was severely disrupted. Interestingly, lost or
malformed muscles match the missing craniofacial cartilages on which the
specific muscle inserts, but not the pharyngeal arch segment of paraxial
mesoderm from which they originate. Specifically, the ventral muscle ima
inserts on the Meckel's cartilage of first arch origin and it is always
correctly formed and attached. By contrast, the imp muscles that connect
Meckel's cartilage with ceratohyals (of second arch that are absent in
mobm610 mutants) maintain correct rostral attachments to
Meckel's cartilage. Caudally, however, the muscle fibers are loosely arranged
and in some cases fused with ih or hh muscles that originate from the second
arch. The ih and hh attach to hyoid arch cartilages and are present in most
mutant embryos, although their morphology is distorted, preventing individual
muscles from bundling correctly, and leaving scattered muscle fibers in the
area anterior to the heart.
An interesting insight into muscle patterning comes from the analysis of
dorsal muscles of the first two arches: do, lap, am (first arch) and ah, ao,
lo (second arch). The am muscles, which originate from the first arch and
connecting Meckel's cartilage with the palatoquadrate, which are both derived
from the first pharyngeal arch, are always present in
mobm610 mutants. However, the muscles lap and do, which
are also of first arch origin but power skeletal elements of second pharyngeal
arch origin, are consistently absent in mobm610 mutant
embryos, as are the muscles ah, ao and lo, originating from the second arch
segment and attaching to cartilages of second arch origin. Thus, it appears
that the craniofacial mesenchymal condensations act as a source of inducing
signals independently of the segmental origin of the paraxial mesoderm.
Therefore, the lack of inducing centers for lap and do muscles leads to their
loss but spares the am muscles. Alternatively (or additionally),
tfap2a may cooperate with unknown factors that are necessary for
specification of dorsal muscles but not ventral ones. These results reinforce
the hypothesis originally put forward by Noden that neural crest derived
chondrogenic condensations could be a source of patterning signals for
paraxial mesoderm (Noden,
1983
; Schilling and Kimmel,
1997
).
Neural crest derivatives are depleted in mobm610/tfap2a mutant embryos
The cranial ganglia receive contributions from ectodermal placodes and from
neural crest as it was shown in avian systems
(Le Douarin, 1982
). In
zebrafish detailed fate map studies of the cranial ganglia were not conducted,
although it has been shown that the trigeminal ganglion contains cells of
neural crest and placodal origin
(Schilling and Kimmel, 1994
).
In mobm610 mutant embryos we found a reduction of cell
numbers in the trigeminal (V), geniculate (VII) and nodose (X) ganglia, and a
complete loss of the petrosal (IX) ganglion. The loss of cells in these
ganglia is possibly due to requirement of tfap2a in the neurogenic
placodes and/or contributing neural crest cells where the gene is expressed in
mouse and in zebrafish. These results are in concordance with neurofilament
immunohistochemistry findings in mouse knockout animals. Therefore,
tfap2a may have similar functions in cranial ganglia development in
lower and higher vertebrates.
In mobm610, trunk PNS neurons in the gut and the dorsal root ganglia are greatly reduced in numbers. Enteric neurons were not studied in the mouse knockout animals, but we would expect a similar phenotype to the zebrafish mutant. The zebrafish DRGs appear to be very sensitive to the depletion of functional tfap2a. The most striking and consistent phenotype is reduction of the number of cells per DRG to about half of its normal count. This might stem from an inadequate number of surviving progenitor cells to build individual ganglia and in some cases lack of ganglia when all cells have died. Interestingly, general inspection of mouse DRGs in the Tcfap2a knockouts did not show any deficits. It is possible that surviving zebrafish DRGs in mobm610 would eventually reach normal size by proliferation of existing progenitor cells. This cannot be ascertained in mobm610/tfap2a mutants because they die before ganglia complete their development.
The function of tfap2a in melanocyte morphogenesis was not
addressed in mice, because in the knockout animals the early phenotype of
neural tube closure results in embryonic death before the onset of hair
follicle development. In zebrafish, specification of pigment cells from neural
crest precursors occurs before cells start to migrate, and by 18 hpf the first
pigment lineage fated cells accumulate behind the eye (head melanoblasts) and
behind the ear (trunk melanoblasts). An hour later, these cells begin
expressing dct (dopachrome tautomerase) a gene that defines
terminally differentiating melanoblasts and is also maintained in mature
melanophores (cells equivalent to melanocytes in amniotes). During migration,
the melanoblasts continue proliferating and are susceptible to patterning cues
and trophic factors. We hypothesize that the reduced number and distribution
of melanoblasts reflects a requirement for mob/tfap2a either for
specification, migration, proliferation and/or survival. The fact that the
number of differentiated melanophores and their dispersal improves with
advanced development would argue that migration and proliferation do not
depend on mob/tfap2a function and the initial loss of melanoblasts is
due to either inadequate specification of progenitor cells or shortage of
trophic factors required for survival. The first option can be excluded,
because mitfa expression is only slightly delayed but maintained in
pigment cell progenitors. Moreover, the tyrosine kinase receptor,
KIT, has been shown to be a direct target of TFAP2A
(Huang et al., 1998
) and the
zebrafish kit/sparse mutant exhibits a melanophore survival defect
(Parichy et al., 1999
). In
mobm610 mutant embryos, kit expression is
dramatically reduced but not completely absent. It is possible that other
transcription factors maintain low levels of kit expression and allow
later recovery of the melanophore pattern in mobm610
mutant embryos. Taken together, our data indicate that mob/tfap2a is
required for regulation of target genes critical for survival of melanoblasts.
Xanthophores appear to be similarly affected as the melanophores, but
iridophores are more sensitive to loss of functional Tfap2a and they never
recover.
tf