spacer gif spacer gif spacer gif spacer gif ARCHIVE ANNOUNCEMENT! spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 1 June 2005
doi: 10.1242/dev.01864


Development 132, 2943-2954 (2005)
Published by The Company of Biologists 2005


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.01864v1
132/13/2943    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tschopp, O.
Right arrow Articles by Hemmings, B. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tschopp, O.
Right arrow Articles by Hemmings, B. A.

Essential role of protein kinase B{gamma} (PKB{gamma}/Akt3) in postnatal brain development but not in glucose homeostasis

Oliver Tschopp1, Zhong-Zhou Yang1, Daniela Brodbeck1, Bettina A. Dummler1, Maja Hemmings-Mieszczak2, Takashi Watanabe3, Thomas Michaelis3, Jens Frahm3 and Brian A. Hemmings1,*

1 Friedrich Miescher Institute for Biomedical Research, Maulbeerstrasse 66, CH-4058 Basel, Switzerland
2 Novartis Pharma AG, Lichtstrasse 35, CH-4056, Basel, Switzerland
3 Biomedizinische NMR Forschungs GmbH am Max-Planck-Institut für biophysikalische Chemie, 37070 Göttingen, Germany

* Author for correspondence (e-mail: brian.hemmings{at}fmi.ch)

Accepted 14 April 2005


    SUMMARY
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Protein kinase B is implicated in many crucial cellular processes, such as metabolism, apoptosis and cell proliferation. In contrast to Pkb{alpha} and Pkbß-deficient mice, Pkb{gamma}-/- mice are viable, show no growth retardation and display normal glucose metabolism. However, in adult Pkb{gamma} mutant mice, brain size and weight are dramatically reduced by about 25%. In vivo magnetic resonance imaging confirmed the reduction of Pkb{gamma}-/- brain volumes with a proportionally smaller ventricular system. Examination of the major brain structures revealed no anatomical malformations except for a pronounced thinning of white matter fibre connections in the corpus callosum. The reduction in brain weight of Pkb{gamma}-/- mice is caused, at least partially, by a significant reduction in both cell size and cell number. Our results provide novel insights into the physiological role of PKB{gamma} and suggest a crucial role in postnatal brain development.

Key words: Pkb{gamma}/Akt3 knockout, Brain development, Apoptosis


    Introduction
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Protein kinase B (PKB/Akt) is a second messenger-regulated kinase that has been implicated in many crucial cellular processes, such as glucose metabolism, transcription, cell proliferation, apoptosis, migration and growth (Brazil and Hemmings, 2001Go; Chan et al., 1999Go; Datta et al., 1999Go; Kandel and Hay, 1999Go; Scheid and Woodgett, 2001Go). Deregulation of PKB activity contributes to cell transformation and diabetes (Brazil and Hemmings, 2001Go; Nicholson and Anderson, 2002Go). In mammalian cells, three closely related isoforms of the PKB family have been identified and termed PKB{alpha}/Akt1, PKBß/Akt2 and PKB{gamma}/Akt3 (Brodbeck et al., 1999Go; Cheng et al., 1992Go; Jones et al., 1991aGo; Jones et al., 1991bGo; Masure et al., 1999Go; Nakatani et al., 1999Go). These proteins are products of three separate genes located on distinct chromosomes and are widely expressed with a few isoform-specific features (Altomare et al., 1998Go; Yang et al., 2003Go). All three members of the PKB family contain a highly conserved N-terminal pleckstrin homology (PH) domain, a central catalytic domain and a short C-terminal regulatory domain (Hanada et al., 2004Go).

PKB is activated by numerous stimuli, including growth factors, hormones and cytokines (Brazil and Hemmings, 2001Go; Chan et al., 1999Go; Datta et al., 1999Go). Activation of PKB occurs in response to signalling via phosphoinositide 3 kinase (PI3K) and requires the membrane-bound second messenger phosphatidylinositol-3,4,5-triphosphate [PtdIns(3,4,5)P3 or PIP3] (Burgering and Coffer, 1995Go; Cross et al., 1995Go; Franke et al., 1995Go). The current model for PKB regulation proposes that PtdIns(3,4,5)P3, generated following PI3K activation, interacts with the PH domain of PKB, recruiting the inactive kinase from the cytoplasm to the plasma membrane and promoting a conformational change that allows phosphorylation on two regulatory sites by upstream kinases at the plasma membrane. One of these critical phosphorylation sites resides in the activation loop of the kinase domain (Thr308 in PKB{alpha}) and the other is located in the C-terminal regulatory domain (Ser-473 in PKB{alpha}), termed the hydrophobic motif (Alessi et al., 1996Go; Brodbeck et al., 1999Go; Meier et al., 1997Go). The upstream kinase that phosphorylates Thr308 in the activation loop of the kinase domain of PKB{alpha} in a PIP3-dependent-manner has been identified and termed 3-phosphoinositide-dependent kinase 1 (PDK1) (Alessi et al., 1997Go; Stokoe et al., 1997Go). Thr308 phosphorylation is necessary and sufficient for PKB activation; however, maximal activation requires additional phosphorylation at Ser473 (Alessi et al., 1996Go; Yang et al., 2002aGo; Yang et al., 2002bGo). Several different protein kinases and mechanisms have been proposed for the phosphorylation of the hydrophobic motif (Brazil and Hemmings, 2001Go; Yang et al., 2002bGo).

Mice with targeted disruption of Pkb{alpha} and/or Pkbß have been obtained recently with Pkb{alpha} mutant mice displaying an increased neonatal lethality and a reduction in body weight of ~30% (Chen et al., 2001Go; Cho et al., 2001bGo; Yang et al., 2003Go). Moreover, loss of Pkb{alpha} leads to placental hypotrophy with impaired vascularisation (Yang et al., 2003Go). By contrast, Pkbß-deficient mice are born with the expected Mendelian ratio and exhibit a diabetes-like syndrome with elevated fasting plasma glucose, hepatic glucose output, peripheral insulin resistance and an compensatory increase of islet mass (Cho et al., 2001aGo). Compared with Pkb{alpha} mutant mice, Pkbß-deficient mice are only mildly growth retarded (Cho et al., 2001aGo; Garofalo et al., 2003Go). However, mice lacking both isoforms die after birth, probably owing to respiratory failure (Peng et al., 2003Go). Pkb{alpha}ß double mutant newborns display a severe reduction in body weight ({approx}50%), prominent atrophy of the skin and skeletal muscle, as well as impaired adipogenesis and delayed ossification.

Here, we report the generation and characterisation of mice with targeted disruption of the Pkb{gamma} gene. Compared with Pkb{alpha}-/- and Pkbß-/- mice, Pkb{gamma} mutant mice display a distinct phenotype without increased perinatal mortality, growth retardation or altered glucose metabolism. However, loss of PKB{gamma} profoundly affects postnatal brain growth. Brains from adult Pkb{gamma} mutant mice show a dramatic reduction in size and weight. Taken together, our results reveal a novel and important physiological role for PKB{gamma} in postnatal brain development.


    Materials and methods
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Targeted disruption of the Pkb{gamma} gene by homologous recombination
An ~11-kb HindIII fragment was subcloned containing exons 4 and 5 of Pkb{gamma}. A NcoI site was generated in exon 4 for insertion of a ~5-kb IRES-lacZ-Neo cassette. The targeting vector was linearised with SalI and electroporated into 129/Ola ES cells. An external probe was used for ES cell screening following XbaI digestion. An internal probe and a lacZ-Neo probe were used to characterize ES clones positive for homologous recombination (data not shown). Correctly targeted ES cells were used to generate chimeras. Male chimeras were mated with wild-type C57BL/6 females to obtain Pkb{gamma} +/- mice. Pkb{gamma} +/- mice have been backcrossed twice with pure C57BL/6 mice and the progeny of Pkb{gamma} +/- intercrosses have ~75% C57BL/6 genetic background. Progeny were genotyped by multiplex PCR with the following three primers: (1) P35, GGTTCTGTGGGAGGTAGTTCTC; (2) Neo-2, GCAATCCATCTTGTTCAATGGCCG; and (3) E4{gamma}, CCATCGGTCGGCTACGGCTTGG.

Quantitative real time PCR
The levels of PKB isoforms in wild-type and mutant mice were determined by quantitative Q-RT-PCR. The experiment was performed as described previously (Yang et al., 2003Go). Briefly, total RNA was purified using Trizol Reagent (Invitrogen). For the Q-PCR reaction, 50 ng total RNA was mixed with 5' and 3' primers, Taqman probe, MuLV reverse transcriptase, RNase inhibitor and the components of the TaqMan PCR reagent kit (Eurogentec) in a total volume of 25 µl following the TaqMan PCR reagent kit protocol.

Western blot analysis
For Western blot analysis, protein lysates were processed as previously described (Yang et al., 2003Go). PKB isoform-specific antibodies were obtained by immunizing rabbits with isoform-specific peptides as previously described (Yang et al., 2003Go). Antibodies against phospho-PKB (Ser473), phospho-GSK3{alpha}/ß (Ser21/9), phospho-TSC2 (Thr1462) and phospho-p70S6K were purchased from Cell Signalling Technologies. Antibodies against p27 and ERK were purchased from Santa Cruz Biotechnology. The antibody against phospho-ERK (Thr202/Tyr204) was purchased from Promega and the Pan-Actin antibody was obtained from NeoMarkers. Western blots were scanned using a GS-800 BioRad densitometer with a resolution of 63.5 µm x 63.5 µm and bands were quantified using Proteomweaver 3.0.0.6 (Definiens).

Histological examination
For histological analysis, animals were perfused with phosphate-buffered saline and 4% paraformaldehyde in phosphate-buffered saline. Organs were dissected and kept in the same fixation solution overnight at 4°C. Samples were embedded in paraffin following dehydration in ethanol. Tissues were cut into 6 µm sections and stored for staining. For Haematoxylin-Eosin and Cresyl-Violet (Sigma) staining, sections were freed of paraffin and stained.

Cell number determination
To determine the number of cells in a whole brain, the DNA content was determined as described by Labarca and Paigen (Labarca and Paigen, 1980Go). This method is based on the enhancement of fluorescence after binding of bisbenzimid (Riedel-de Haen) to DNA. A linear standard curve (1-10 µg/ml) was prepared to calculate the DNA concentration. The relative cell size in posterior cortex was measured on plane-matched, parasagittal brain sections stained with DAPI (Biotium). Image-Pro® Plus (Media Cybernetics) was used to count the cell number and to calculate the mean area occupied by one cell. The relative cell size is expressed as percent of wild type.

In vivo magnetic resonance imaging (MRI)
MRI studies of 4-month-old female Pkb{gamma} wild-type (n=5) and mutant mice (n=5) were performed at 2.35 T using a MRBR 4.7/400 mm magnet (Magnex Scientific, Abingdon, England) equipped with BGA20 gradients (100 mT m-1) and a DBX system (Bruker Biospin, Ettlingen, Germany). For in vivo examinations, animals were anaesthetized (1.0-1.5% halothane in 70:30 N2O:O2) and treated as previously described (Natt et al., 2002Go). Briefly, radiofrequency (rf) excitation and signal reception were accomplished with use of a Helmholtz coil ({emptyset} 100 mm) and a surface coil ({emptyset} 20 x12 mm), respectively. Three-dimensional T1-weighted (rf-spoiled 3D FLASH, repetition time TR=17 mseconds, echo time TE=7.6 mseconds, flip angle 25°, measuring time 84 minutes) and T2-weighted MRI data sets (3D fast spin-echo, TR/TE=3000/98 mseconds, measuring time 58 minutes) were acquired with an isotropic resolution of 117 µm. Volumetric assessments were obtained by analysing T1-weighted images using software provided by the manufacturer (Paravision, Bruker Biospin, Ettlingen, Germany). After manually outlining the whole brain and the ventricular spaces in individual sections, respective areas were calculated (in mm2), summed and multiplied by the section thickness.

Neuronal cell culture
E16.5 murine hippocampal neurons were isolated from timed matings. Cells were kept in culture for 7 days on polylysine coverslips coated with B27/Neurobasal (GIBCO Life Technologies). At day 7, cultures were treated with glutamate (15 mM/24 hours), staurosporine (50 nM/12 hours) or were left untreated. For the detection of apoptotic cells, five fixed cultures per genotype were stained using a TUNEL-assay (Roche) according to the manufacturer's instructions and counterstained with DAPI (Biotium). At least 200 cells per culture were counted and the percentage of apoptotic cells was calculated.

Glucose and insulin tolerance test
Mice were housed according to the Swiss Animal Protection Laws in groups with 12 hours dark/light cycles and with free access to food and water. All procedures were conducted with the approval of the appropriate authorities.

Random-fed and fasting blood glucose levels were determined in 5- to 6-month-old mice. Blood samples were collected from tail veins and glucose levels were determined using Glucometer Elite (Bayer). Mice (aged 5-6 months) were fasted overnight before the start of the glucose and insulin tolerance tests. Glucose (2 g/kg) was given orally to conscious mice. Insulin (1 U/kg) was administered by intraperitoneal injection to conscious mice. Blood samples were collected at indicated times from tail veins and glucose levels were determined using Glucometer Elite (Bayer). Blood glucose levels were expressed as percentage of initial value. Blood insulin levels were measured with a Mouse ultra-sensitive insulin ELISA (Immunodiagnostic Systems).

Microarray analysis
Microarray analysis was performed using murine MOE430A GeneChipsTM (Affymetrix). Total RNA (10 µg) was reverse transcribed using the SuperScript Choice system for cDNA synthesis (Life Technologies) and biotin-labelled cRNA generated using the Enzo BioArray High Yield RNA transcript labelling kit (Enzo Diagnostics) following the manufacturer's protocol. cRNA fragmentation and hybridisation were performed as recommended by Affymetrix. Expression data were calculated using the RMA algorithm from BioConductor (Irizarry et al., 2003Go). A gene was considered to be significantly altered in its expression if it had an Affymetrix change P-value of less than 0.003 for either increase or decrease in at least two-thirds of replicate comparisons and it had a minimum expression value of 100 in at least one condition. A fold-change threshold of 1.5 was then applied and the resulting genes were subjected to a one-way ANOVA with a P-value cut-off of 0.05. A Benjamini and Hochberg multiple testing correction and a Tukey post-hoc test were applied.

Statistical analysis
To compare body weight, brain weight and volume, brain/body weight ratio, DNA content, cell number and percentage of apoptotic cells between Pkb{gamma}+/+ and Pkb{gamma} -/-, an unpaired Students t-test was performed. P values under 0.05 were considered as significant and values below 0.01 as highly significant.


    Results
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Targeting strategy and confirmation of genotype
Pkb{gamma} -/- mice were generated by targeted disruption of exon 4 as shown in (Fig. 1A). The ablation of Pkb{gamma} was confirmed by PCR, Q-RT-PCR and Western blot analysis using brain tissue samples from Pkb{gamma} wild-type (Pkb{gamma}+/+), heterozygous (Pkb{gamma}+/-) and mutant (Pkb{gamma}-/-) mice (Fig. 1B). Quantitative RT-PCR displayed complete ablation of the PKB{gamma} mRNA in brain samples of Pkb{gamma} mutant mice (n=3, data not shown). To confirm the absence of PKB{gamma} at the protein level, Western blot analysis was performed with an isoform-specific anti-PKB{gamma} antibody. In contrast to Pkb{gamma}+/+ brain tissue samples, PKB{gamma} was not detectable in samples derived from mutant mice (Fig. 1C). In addition, Western blot analysis with antibodies specific for PKB{alpha} and PKBß, respectively, showed no compensatory upregulation of PKB{alpha} and/or PKBß, respectively, in the brain of Pkb{gamma}-/- mice (Fig. 1D).

Distribution of PKB{gamma} in wild-type tissues
It has been reported that the PKB{alpha} and ß isoform are widely expressed in all organs, but with some isoform-specific features (Altomare et al., 1998Go; Yang et al., 2003Go). Less is known about the tissue distribution of the PKB{gamma} isoform. Previous reports suggest that PKB{gamma} has a more restricted distribution with high levels in the adult brain and foetal heart and low levels in liver and skeletal muscle (Brodbeck et al., 1999Go; Masure et al., 1999Go; Yang et al., 2003Go). We assessed the distribution of PKB{gamma} mRNA in 15 major tissues of adult mice by quantitative RT-PCR and normalised to the level of PKB{gamma} in the brain (Fig. 2A). PKB{gamma} mRNA was found at the highest level in brain and testis, and at lower levels in lung, mammary gland, fat and spleen.

To investigate whether PKB{gamma} ablation leads to compensatory increase in PKB{alpha} and/or PKBß, total RNA isolated from brain, testis, lung, mammary gland, fat and spleen of three Pkb{gamma} wild-type and three mutant mice was subjected to quantitative RT-PCR. The levels of PKB{alpha} and ß were normalised to the level of PKB{alpha} in wild-type brain and set as 100%. Overall, no marked upregulation of PKB{alpha} and/or PKBß was observed, including the brain (Fig. 2B,C). These results are consistent with Western blot analysis of protein extracts of brains from Pkb{gamma} wild-type and mutant mice (Fig. 1D). To investigate the distribution and levels of individual PKB isoforms within the brain, protein lysates were prepared from ten anatomically and functionally different regions. In general, all three isoforms were expressed in all examined regions but with certain isoform-specific features (Fig. 2D). PKB{alpha} is expressed in all regions at similar levels, whereas PKBß is expressed at moderate levels in cortex, cerebellum, hippocampus and olfactory bulb, and at lower levels in the hypothalamus, midbrain, brain stem and spinal cord. PKB{gamma} is expressed in all examined regions but at higher levels in the cortex and in the cerebellum.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 1. Targeting strategy and confirmation of genotype. (A) The genomic organization of the Pkb{gamma} wild-type allele (top) was disrupted using a targeting vector with an IRES-lacZ-Neo-cassette (middle). Targeting of the wild-type allele leads to disruption of exon 4 of the Pkb{gamma} gene (bottom). Arrowheads indicate the localization of the primers for the PCR reaction. (B) The genotype of mice was determined by PCR. Representative results from Pkb{gamma}+/+, Pkb{gamma}+/- and Pkb{gamma}-/- mice are shown. (C) The levels of PKB{gamma} in the brains of Pkb{gamma}+/+, Pkb{gamma}+/- and Pkb{gamma}-/- mice were determined by western blot analysis using a PKB{gamma}-specific antibody. (D) The levels of PKB{alpha} and PKBß, respectively, were determined in brain lysates from Pkb{gamma}+/+, Pkb{gamma}+/- and Pkb{gamma}-/- mice using PKB{alpha}- and PKBß-specific antibodies.

 
Signalling in Pkb{gamma} mutant mice
The phosphorylation/activation state of PKB in protein extracts from brains of 3-month-old Pkb{gamma}+/+ and Pkb{gamma}-/- mice was analysed using an antibody specific for the phosphorylation site (anti-phospho-Ser-473) in the hydrophobic motif of the regulatory domain of all three isoforms (Fig. 3A). As expected, levels of activated PKB (quantification was done using actin as loading control) in Pkb{gamma}-/- mice was significantly lower than in Pkb{gamma}+/+ littermate controls (100% versus 38%), but was not completely abolished (Fig. 3B). The phosphorylation levels of glycogen synthase kinase 3 (GSK3), tuberous sclerosis complex 2 (TSC2), p70S6K, ERK and p27 in Pkb{gamma}-/- mice were not significantly changed when compared with wild-type littermate controls (levels of phosphorylated protein were normalised with the level of unphosphorylated protein). We repeated this experiment using brain samples of 14 days old mice and obtained comparable results with significantly reduced levels of total phosphorylated PKB and unchanged levels of phosphorylated substrates (data not shown).



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 2. Tissue distribution of PKB{gamma} and levels of PKB{alpha} and PKBß in Pkb{gamma} mutant mice. (A) The mRNA level of PKB{gamma} was determined in 15 different organs from adult Pkb{gamma}+/+ mice. Total RNA was isolated from three adult mice and the levels were normalized to the level of PKB{gamma} in the brain (100%). MG, mammary gland. Error bars represent s.d. mRNA levels of (B) PKB{alpha} and (C) PKBß were determined using total RNA from six different organs of adult Pkb{gamma} wild-type (n=3; black bars) and mutant mice (n=3; white bars). mRNA levels of PKB{alpha} and PKBß were normalized to the level of PKB{alpha} in wild-type brain (100%). Error bars represent s.d. (D) Western blot analysis of PKB{alpha}, ß and {gamma} within ten different brain regions using isoform specific antibodies.

 



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 3. Phospho-western blot analysis of brains from Pkb{gamma} mutant mice. (A) Brains of three wild-type and three mutant mice were analysed for phosphorylation status of proteins involved in PKB signalling. p, indicates phosphorylated protein. (B) Western blot quantification. Levels of p-Ser473 and p27 were normalized to the level of actin, all phosphorylated proteins were normalized to the level of unphosphorylated protein. *P<0.05. Error bars represent s.d.

 
Several recent studies emphasize the importance of insulin-like growth factor 1 (IGF1) signalling in the survival and proliferation of oligodendrocytes and myelination in the central nervous system (D'Ercole et al., 2002Go). Mice lacking IGF1 also have reduced brain weight and reduced size of the corpus callosum and anterior commissure (Ye et al., 2002Go). Therefore, we performed a western blot analysis with cell lineage-specific markers using antibodies against myelin basic protein (oligodendrocytes), glial fibrillary acidic protein (astrocytes) and M-neurofilaments (neurons). Significantly, no obvious differences in the expression levels of these marker proteins were observed when comparing samples of Pkb{gamma}+/+ and Pkb{gamma}-/- mice (n=5 per genotype, data not shown).



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 4. Dispensable role of PKB{gamma} for body weight and glucose metabolism. (A) Body weights of male Pkb{gamma}+/+ (white bars) and Pkb{gamma}-/- (black bars) mice were measured at different points in time (n=5-8 animals per genotype). Error bars represent s.d. NB, newborn. (B) Blood glucose concentrations from random-fed (RF) and overnight fasted (ONF) mice (n=8; 6 months old; Pkb{gamma}+/+ white bars and Pkb{gamma}-/- black bars). Error bars represent s.d. (C) Insulin tolerance test. Animals (n=6; 6 months old; Pkb{gamma}+/+ white triangles and Pkb{gamma}-/- black circles) were fasted overnight and insulin (1 U/kg) was administered by intraperitoneal injection. (C) Glucose concentrations were determined at indicated time points from whole blood collected from tail veins. Values were normalized to the starting glucose concentration at the administration of insulin. Error bars represent s.d. (D) Glucose tolerance test. Animals (n=6; 5-6 months old; Pkb{gamma}+/+ white triangles and Pkb{gamma}-/- black circles) were fasted overnight and glucose (2 g/kg) was orally administered. Blood glucose concentrations were sampled at the indicated times. Values were normalized to the starting glucose concentration at the administration of glucose. Error bars represent s.d.

 
PKB{gamma} is not required for postnatal survival, fertility, body weight and glucose metabolism
There was no evidence for increased mortality of Pkb{gamma}-/- mice after birth in an analysis of more than 400 pups (aged 3-4 weeks) [Pkb{gamma}+/+: Pkb{gamma}+/-: Pkb{gamma} -/-=104 (25.6%): 206 (50.7%): 96 (23.6%)]. As PKB{gamma} is highly expressed in the testis, fertility of mutant mice was tested using male Pkb{gamma}-/- x female Pkb{gamma}+/+ and female Pkb{gamma}-/- x male Pkb{gamma}+/+ matings. Both male and female mutant mice matings gave normal pregnancies and births, indicating that fertility is not impaired in either male or female Pkb{gamma} mutant mice (data not shown).

As PKB has been implicated in the regulation of cell and organ growth, body weight was measured in male Pkb{gamma} mutant mice and wild-type littermate controls (n=5-8 per group) at different time points (Chen et al., 2001Go; Cho et al., 2001bGo; Peng et al., 2003Go; Yang et al., 2003Go). Body weight did not differ significantly between male Pkb{gamma} mutant mice and wild-type controls at any time point (Fig. 4A). A similar result was obtained with female Pkb{gamma}-/- mice and Pkb{gamma}+/+ controls (n=5-8 per group, data not shown), indicating that PKB{gamma} does not play a significant role in the overall growth of mice.

To investigate a potential role of PKB{gamma} in the regulation of glucose metabolism, blood glucose levels were measured in adult (5-6 months) Pkb{gamma} mutant mice under random-fed and fasting condition, and compared with age- and gender-matched wild-type controls. Interestingly, both random-fed and fasting blood glucose levels, were not significantly different between wild-type and mutant mice (Fig. 4B). Additionally, blood insulin levels in random-fed condition did not differ significantly between Pkb{gamma}+/+ and Pkb{gamma} -/- mice (1.32±0.08 µg/l versus 1.30±0.13 µg/l; n=6). To further investigate glucose metabolism, overnight fasted mice were challenged with insulin (insulin tolerance test) or glucose (glucose tolerance test). To test the insulin responsiveness, insulin (1 U/kg) was applied by intraperitoneal injection und blood glucose levels were measured at indicated time points using blood from tail veins. No obvious differences of blood glucose levels in the insulin tolerance test were found between the groups with mutant and control mice (Fig. 4C). Additionally, mice were challenged with orally applied glucose (2 g/kg) and blood glucose levels were measured at indicated time. Compared with wild-type mice, Pkb{gamma} -/- mice displayed a very similar response to the glucose load (Fig. 4D). Taken together, these results suggest that PKB{gamma} does not play a significant role in the maintenance of glucose homeostasis.

Essential role of PKB{gamma} in postnatal brain development
Next, adult Pkb{gamma}+/+ and Pkb{gamma}-/- mice were dissected and all major organs were investigated macroscopically. Compared with Pkb{gamma}+/+ littermate controls, the overall size of brains from adult Pkb{gamma}-/- mice was strikingly reduced. A representative example is shown in Fig. 5B-D. Furthermore, the weights of freshly dissected brains of Pkb{gamma} wild-type and Pkb{gamma} mutant mice were measured at different ages (Fig. 5A). Compared with age- and gender-matched wild-type littermate controls, brains from adult Pkb{gamma}-/- mice (3-12 months old) exhibited a highly significant reduction in weight of about 25% (range 22%-29%), affecting both males and females (data for females not shown, n=5-8). Interestingly, at birth, brain weight did not differ significantly between Pkb{gamma}+/+ and Pkb{gamma}-/- mice. The reduction in brain size and weight was first observed at the age of 1 month, but was less pronounced compared with adult mice ({approx}18%). In contrast to Pkb{alpha}, Pkbß and IgfI-null mutant mice (Beck et al., 1995Go; Cheng et al., 1998Go; Garofalo et al., 2003Go; Powell-Braxton et al., 1993Go), the brain/body weight ratio of Pkb{gamma} mutant mice was also significantly reduced to a similar extent.



View larger version (65K):
[in this window]
[in a new window]
 
Fig. 5. Reduced brain weight and size of Pkb{gamma} mutant mice. (A) Weight of freshly dissected brains of male Pkb{gamma}+/+ (white bars) and Pkb{gamma}-/- (black bars) mice were measured at different points in time (n=5-8 animals per genotype). *P<0.05. Error bars represent s.d. NB, newborn. (B) Cranial, (C) caudal and (D) lateral views of brains from adult Pkb{gamma} wild-type (left side) and knockout (right side) mice. Co, cortex; CE, cerebellum; OB, olfactory bulb; BS, brainstem; HY, hypothalamus. (E-J) Representative sections from T2- weighted 3D MRI data sets acquired in vivo from the brains of Pkb{gamma}+/+ (E,G,I) and Pkb{gamma}-/- mice (F,H,J) from Pkb{gamma}+/- matings in sagittal (E,F), horizontal (G,H) and coronal (I,J) orientation. CC, corpus callosum; AC, anterior commissure; PC, posterior commissure. Scale bar: 1 mm.

 
In vivo magnetic resonance imaging (MRI) of Pkb{gamma}-/- mice
MRI is an excellent non-invasive technique for studying brain anatomy in transgenic and mutant mice (Kooy et al., 2001Go; Natt et al., 2002Go). For further characterization of Pkb{gamma} mutant brain anatomy, five adult female mutant and five age and gender matched wild-type littermate controls (with the same genetic background) from Pkb{gamma}+/- matings were examined using high-resolution 3D MRI as previously described (Natt et al., 2002Go). Fig. 5E-J shows representative T2-weighted images of Pkb{gamma}+/+ and Pkb{gamma}-/- brains in a sagittal, horizontal, and coronal section orientation. Complementary in vivo volumetry based on T1-weighted 3D MRI confirmed the much smaller brain size of all five Pkb{gamma} mutant mice. Compared with wild-type littermates, whole brain volume in Pkb{gamma}-/- mice was significantly reduced by about 24% (513±14 mm3 versus 391±16 mm3, P<0.01; n=5). Although several brain regions were affected, including olfactory bulb, cortex and hippocampal formation, no alteration in the structural organization of the brain was observed, confirming the macro-pathological findings. Moreover, because the volume of the ventricular spaces in Pkb{gamma}-/- mice was reduced (7.85±2.2 mm3 versus 5.55±2.8 mm3) in proportion to that of the whole brain and MRI revealed no enlargement of the subarachnoid space, the occurrence of an internal or external hydrocephalus is excluded as a cause of reduced brain size. Interestingly, in contrast to any wild-type littermate controls, all five Pkb{gamma}-/- mice presented with a marked thinning of the corpus callosum (downward arrowheads in Fig. 5E,F). White matter fibres connections are depicted as hypointense structures in T2-weighted images. Although unequivocally identifiable in Pkb{gamma}+/+ mice (Fig. 5E,G,I), the corpus callosum is partly indistinguishable from surrounding grey matter in Pkb{gamma}-/- mice (Fig. 5F,H,J). Anterior and posterior commissures as well as the hippocampal fimbria are less prominently affected.



View larger version (123K):
[in this window]
[in a new window]
 
Fig. 6. Histology of brains from Pkb{gamma} mutant mice. Representative sections (HE staining) of the cortex (A,D), hippocampus (B,E) and cerebellum (C,F) from adult Pkb{gamma}+/+ (A-C) and Pkb{gamma}-/- (D-F) mice in parasagittal orientation. Representative sections stained for myelin (Luxol-Fast Blue/Eosin) of whole brain (G,J), corpus callosum (H,K) and anterior commissure (I,L) from Pkb{gamma}+/+ (G-I) and Pkb{gamma}-/- mice (J-L) in coronal orientation. White matter structures are labelled as follows: CC, corpus callosum; AC, anterior commissure.

 
Histology of Pkb{gamma}-/- mouse brains
Histological examination of Pkb{gamma}-/- brain was performed to investigate changes at the microscopic level. Various brain regions, including cerebellum, hippocampus and corpus callosum, were examined following Haematoxylin/Eosin staining (Fig. 6A-F). With the exception of the reduced size of all regions, no abnormalities in the overall structure of the different brain regions were observed. In line with the in vivo MRI findings, the thickness of the corpus callosum in Pkb{gamma} mutant mice was markedly reduced (downward arrowheads in Fig. 6G,J). Additionally, myelin staining with luxol Fast Blue revealed not only a reduction in thickness of the corpus callosum but also less intense staining of the structure (Fig. 6H,K).

Cell number in the brains of Pkb{gamma}-/- mice
Next, we indirectly assessed the cell number by measuring the amount of DNA in whole brains derived from Pkb{gamma}+/+ and Pkb{gamma}-/- mice. The amount of DNA is considered as an indicator of cell number, whereas the amount of DNA per gram of tissue is an indicator of cell density which is reciprocal to cell volume (Zamenhof, 1976Go). The DNA contents of brains from newborns and 1-month-old mice were determined using the method described by Labarca and Paigen (Labarca and Paigen, 1980Go). Briefly, this method is based on the enhancement of fluorescence after binding of bisbenzimid to DNA. Compared with wild-type control samples, whole brain DNA content of Pkb{gamma}-/- newborns did not differ significantly, indicating that cell number was not changed. Similarly, the DNA content per gram of brain tissue was comparable between Pkb{gamma} wild-type and mutant mice, indicating a comparable cell size. In contrast to newborns, the DNA content in brains of 1-month-old Pkb{gamma} mutant mice was slightly, but significantly, reduced compared with the Pkb{gamma}+/+ controls (Table 1). However, the DNA content per gram of tissue was, significantly increased in samples from Pkb{gamma}-/- compared with wild-type littermate controls, indicative of increased cell density (and reduced cell size).


View this table:
[in this window]
[in a new window]
 
Table 1. Cell number in the brain of Pkb{gamma}wild-type and mutant mice

 
Additionally, the relative cell size in the posterior cortex of adult mice (3 months) was determined based on histological slides stained with DAPI. Cells were analysed using Image-Pro Plus in a defined field of view ({approx}1000 per field), and the area occupied by one cell was subsequently calculated. In line with the results of the DNA content experiment, the relative cell size was significantly and consistently reduced in Pkb{gamma} mutant mice (100±10% versus 80±7%; n=5 per genotype; P<0.05). Taken together, the results show that both cell size and cell number contribute to the reduction in brain size observed in mutant mice, but the relative contribution of cell size reduction plays a more important part.

Susceptibility to glutamate and staurosporine induced cell death
It is established that the PI3K/PKB pathway plays a crucial role in cell survival in the central nervous system (Datta et al., 1999Go; Dudek et al., 1997Go; Kim et al., 2002Go). To investigate the potential role of PKB{gamma} in apoptosis, primary cell cultures were established from Pkb{gamma}+/+ and Pkb{gamma}-/- hippocampal neurons. Immunocytochemistry at day 28 using antibodies against tau (for axons) and Map2C (for dendrites) did not reveal any obvious defects in the differentiation of Pkb{gamma}-/- hippocampal neurons (Fig. 7A-D). Consistent with the analysis of the expression pattern of PKB isoforms in various brain regions (Fig. 2D), we found that PKB{alpha}, PKBß and PKB{gamma}, respectively, were expressed in cultured wild-type primary hippocampal neurons. In accordance with the result of Fig. 1D, we did not find a compensatory upregulation of PKB{alpha} and PKBß in Pkb{gamma}-deficient cells (Fig. 7E). To test the potential role of PKB{gamma} in the survival of hippocampal neurons, cell cultures were challenged with glutamate (15 mM/24 hours) or staurosporine (50 nM/12 hours) after 7 days in culture. Apoptotic cells were detected using the TUNEL assay. In untreated cells cultures, no significant difference in the percentage of apoptotic cells between Pkb{gamma}+/+ and Pkb{gamma}-/- hippocampal neurons was observed (Fig. 7F). After treatment with glutamate or staurosporine, the percentage of apoptotic cells was significantly increased (51% and 24%, respectively, P<0.01) in cultures from Pkb{gamma}-/- hippocampal neurons (Fig. 7F). Additionally, we analysed the number of apoptotic cells from adult brains (n=5 per genotype) using TUNEL staining on parasagittal sections. Similar to the results of untreated cultures, we did not find any difference between Pkb{gamma}+/+ and Pkb{gamma}-/- mice (data not shown).



View larger version (69K):
[in this window]
[in a new window]
 
Fig. 7. Increased susceptibility to glutamate and staurosporine induced cell death. (A-D) Primary hippocampal neurons were established from E16.5 embryos and kept in culture for 28 days. Immunocytochemistry was performed using antibodies against dendritic (Map2C) or axonal (tau) proteins. (E) PKB{alpha}, PKBß and PKB{gamma} expression in Pkb{gamma} wild-type and mutant hippocampal neurons. (F) Seven-day-old cultures were treated with glutamate (15 mM/24 hours) or with staurosporine (50 nM/12 hours) or were left untreated (Pkb{gamma}+/+ white bars and Pkb{gamma}-/- black bars). Apoptotic cells were identified by TUNEL-assay and at least 200 cells per culture were counted (n=5 cultures per treatment and genotype). *P<0.05. Error bars represent s.d.

 
Microarray analysis of Pkb{gamma}-/- brains
In the CNS, a considerable amount of cellular and physiological events occur during postnatal development, such as neuronal outgrowth, differentiation, synaptogenesis and maturation. To investigate a potential role of PKB{gamma} in these events, we analyzed gene expression patterns in brains of Pkb{gamma}+/+ and Pkb{gamma}-/- mice at different time points during postnatal brain development, i.e. day 1, day 7 and day 30. RNA was extracted from whole mice brains and microarray analysis was performed on three individual brains per genotype and time point using murine Affymetrix GeneChipsTM. Changes below 1.5-fold increase were considered insignificant, and differentially regulated genes were subjected to a one-way ANOVA analysis (Table 2). As the brain consists of various heterogeneous cell populations, any change of expression occurring in a specific cell type will be quenched in the pool of whole brain RNA. It is therefore likely that the real expression changes in specific tissues are higher than apparent in this experiment. Among the 17,000 expressed genes, we found 37 genes to be differentially expressed in Pkb{gamma}-/- brains versus Pkb{gamma}+/+ brains. Of these, 16 genes were upregulated and 21 genes downregulated. Among the genes with changed expression are several transcription factors and genes implicated in cell cycle and proliferation. Significantly, one of the most interesting findings is that at P30, several genes involved in synaptic transmission (pre- and postsynaptic), including ionotropic glutamate receptor (NMDAR1), potassium-chloride co-transporter 2 (KCC2), chapsyin 110 [channel-associated protein of synapses, 110 kDa (DLG2)] and synaptotagmin 2 (SYT2), have significantly reduced expression levels in Pkb{gamma} mutant brains. Additionally, Ca2+/calmodulin-dependent protein kinase II {alpha} (CaMKII), an enzyme that is essential in synaptic plasticity and memory formation, was found at reduced expression levels (Ninan and Arancio, 2004Go).


View this table:
[in this window]
[in a new window]
 
Table 2. Microarray analysis of Pkb{gamma} mutant brain

 

    Discussion
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Here, we report the phenotypic consequences of the ablation of the Pkb{gamma} gene. Mice with targeted disruption of all single PKB isoform were generated and all demonstrated a distinct phenotype. Mice deficient in Pkb{alpha} are smaller with a 30% reduction in body size and partial neonatal lethality, which might be caused by placental insufficiency (Chen et al., 2001Go; Cho et al., 2001bGo; Yang et al., 2003Go). By contrast, Pkbß knockout mice exhibited a diabetes-like syndrome with hyperglycemia and impaired insulin action in fat, liver and skeletal muscle and, depending on the genetic background, mild growth retardation (Cho et al., 2001; Garofalo et al., 2003Go). Recently, Peng and colleagues reported the generation of Pkb{alpha}ß double mutant mice with severe intrauterine growth retardation that die shortly after birth with multiple defects in skin, bone and fat tissue (Peng et al., 2003Go). However, our results demonstrate that Pkb{gamma}-deficient mice display a distinct phenotype without increased mortality, growth retardation and altered glucose homeostasis. Inactivation of the Pkb{gamma} gene leads to a considerable reduction in total phosphorylated/activated PKB in the mutant brain without any compensatory increase of the {alpha} and ß isoforms (assessed at the mRNA and protein levels), suggesting a failure to fully compensate for the loss of PKB{gamma}. This result is consistent with findings in Pkb{alpha} and Pkbß mutant mice, where no compensatory upregulation of 2 remaining isoforms was found (Cho et al., 2001bGo; Garofalo et al., 2003Go; Yang et al., 2003Go). It has been speculated that the distinct phenotypes of Pkb{alpha} and Pkbß mutant mice are due to specific and distinct functions of the different PKB isoforms. By contrast, Peng and colleagues proposed that the individual phenotypes are due to loss of the dominant isoform in a specific tissue, which leads to significant reduction of total activated PKB below a crucial level (Peng et al., 2003Go). For example, the observed diabetes mellitus-like syndrome of Pkbß-/- mice could be due to ablation of the dominant isoform in the classical insulin-responsive tissues such as fat, liver and muscle. Moreover, the loss of a second isoform would have an additive effect in reducing the level of total PKB and, therefore, would intensify the phenotype. This possibility is supported by the observation of Pkb{alpha}ß double knockout mice (Peng et al., 2003Go) and our unpublished data on the Pkb{alpha}{gamma} double mutant mice (Z.-Z.Y. and B.A.H., unpublished). Ablation of a single copy of Pkb{gamma} in Pkb{alpha}-deficient mice (Pkb{alpha}-/- Pkb{gamma}+/- led to a higher perinatal mortality compared with Pkb{alpha} single mutant mice and the ablation of both Pkb{gamma} alleles in Pkb{alpha}-/- mice led to more pronounced dwarfism and intra-uterine death of all Pkb{alpha}-/-Pkb{gamma}-/- double mutant animals. However, it cannot be confirmed yet whether the observed phenotypes are due to a combination of reduced level of activated PKB and the loss of isoform-specific functions.

The IGF1/PI3K/PKB pathway plays a crucial role in mammalian brain development and function (D'Ercole et al., 2002Go; Rodgers and Theibert, 2002Go). Besides the severe growth retardation, adult mice with IGF1 deficiency exhibit a significant (38%) brain weight reduction (Beck et al., 1995Go). Similar to the Pkb{gamma} mutant mice, all brain parts of the Igf1-/- mice were affected but the general anatomical organisation was normal. Furthermore, ablation of IGF1 resulted in a cell type-dependent loss of neurons, as well as a reduced total number of oligodendrocytes and hypomyelination (Beck et al., 1995Go; Ye et al., 2002Go). In addition, targeted deletion of IRS2 in mice also produced a pronounced brain growth deficiency, but in contrast to Pkb{gamma} mutants, the reduction was already apparent during embryonic (E15.5) development (Schubert et al., 2003Go). By contrast, an increased brain mass was observed in mice overexpressing IGF1 (Mathews et al., 1988Go; Ye et al., 1995Go). Moreover, mice with brain-specific deletion of PTEN, a negative regulator of the PI3K/PKB pathway, exhibited an enlarged brain with seizures and ataxia resembling Lhermitte-Duclos disease (Backman et al., 2001Go; Kwon et al., 2001Go). Less is known about the consequences of Pkb{alpha} and Pkbß inactivation for mouse brain development. Compared with Pkb{gamma}-/- mice, adult Pkb{alpha} and Pkbß mutant mice showed only a slight decrease in brain weight (Garofalo et al., 2003Go; Yang et al., 2004Go). In both Pkb{alpha} and Pkbß mutant mice, no changes in the gross brain morphology were reported.

However, inactivation of the Pkb{gamma} gene resulted in a significant reduction of brain weight and size. Interestingly, Pkb{gamma} deficiency did not affect the general anatomical organization of the brain. In vivo 3D MRI and histological analysis excluded the absence of a specific brain region as the main cause of the weight reduction, consistent with the result of the broad expression profile among brain regions. More specifically, the proportionally reduced ventricular system rules out major disturbances in production, circulation and absorption of cerebrospinal fluid as a cause of reduced cell size/number in Pkb{gamma}-/- mice. The biological relevance of the MRI signal alterations in white matter such as the corpus callosum requires further investigation. Nevertheless, it should be noted that the in vivo MRI results are consistent with a pronounced, but not complete, deficit in myelin deposition (Boretius, 2003Go), which is also strongly supported by the histological findings for myelin staining. In agreement with our results, mice deficient in IGF1, a potent activator of PKB{gamma}, the myelin-rich white matter regions, including corpus callosum and anterior commissure, were overproportionally reduced by about 70% (Beck et al., 1995Go). By contrast, mice overexpressing IGF1 display an increased brain weight and the corpus callosum of the Igf1 transgenic mice was increased in excess of proportionality (Carson et al., 1993Go).

The PI3-K/PKB signalling pathway plays a crucial role in the determination of cell size (Scanga et al., 2000Go; Shioi et al., 2002Go; Tuttle et al., 2001Go; Verdu et al., 1999Go). Results from transgenic mice overexpressing PKB show larger cardiac myocytes and thymocytes, or hypertrophy and hyperplasia in the pancreas (Kovacic et al., 2003Go; Mangi et al., 2003Go). An increase in neuronal soma size was observed in mice with brain-specific deletion of PTEN (Backman et al., 2001Go; Kwon et al., 2001Go). By contrast, the size of skeletal muscle cells in Pkb{alpha}ß double mutant mice was dramatically reduced (Peng et al., 2003Go). Our results show that both cell number and cell size are affected, but that reduced cell size contributes more than the reduced cell number. Additionally, it has been shown that the mTOR signalling pathway is also involved in the determination of cell size (Montagne et al., 1999Go; Oldham et al., 2000Go; Zhang et al., 2000Go). PKB modulates mTOR activity by phosphorylating TSC2, with a subsequent disruption of the TSC1-TSC2 interaction (Inoki et al., 2002Go; Potter et al., 2003Go).

Recent publications have linked PI3-K/PKB with synaptic plasticity and memory (Dash et al., 2004Go; Kelly and Lynch, 2000Go; Lin et al., 2001Go; Robles et al., 2003Go; Sanna et al., 2002Go). Wang and colleagues demonstrated that the A-type {gamma}-aminobutyric acid receptors (GABAAR), which mediate fast inhibitory synaptic transmission, is phosphorylated by PKB (Wang et al., 2003Go). Phosphorylation of GABAAR leads to an increased number of receptor on the cell membrane and an increased synaptic transmission. Additionally, Lin et al. established a role of the PI3-K/PKB pathway in fear conditioning in the amygdala (Lin et al., 2001Go). As we found several genes involved in neuronal circuit activity in our microarray experiment, future behavioural and electrophysiological studies of Pkb{gamma} mutant brains will elucidate the specific role of PKB{gamma} in synaptic transmission, learning and memory.

In summary, we have demonstrated that Pkb{gamma}-deficient mice display a phenotype distinct from Pkb{alpha} and Pkbß mutant mice. Our results provide novel insights into the physiological function of PKB{gamma} and suggest a crucial role in postnatal brain development of mammals. Identification of PKB{gamma} specific substrates involved in postnatal brain development is now of critical importance.


    ACKNOWLEDGMENTS
 
The authors thank Michael Leitges (Max-Planck-Institut für Experimentelle Endokrinologie, Hannover, Germany) for providing the IRES/lacZ/Neo targeting cassette. From the FMI we acknowledge J. F. Spetz and P. Kopp for ES cell culture and generation of chimera, D. Hynx for animal care, H. Brinkhaus for help with neuronal cell culture, E. Oakeley and H. Angliker for microarray analysis, M. Sticker for helpful advice in histology and R. Portmann for advice on Western blot quantification. O.T. is supported by the Novartis Stiftung für Medizinisch-Biologische Forschung, Z.Z.Y. is funded in part by a grant from Bundesamt für Bildung und Wissenschaft (BBW #98.0176) and B.D. by the Swiss Cancer League (KFS 1167-09-2001 and KFS 01002-02-2000). The Friedrich Miescher Institute for Biomedical Research is funded by the Novartis Research Foundation.


    REFERENCES
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 

Alessi, D. R., Andjelkovic, M., Caudwell, B., Cron, P., Morrice, N., Cohen, P. and Hemmings, B. A. (1996). Mechanism of activation of protein kinase B by insulin and IGF-1. EMBO J. 15,6541 -6551.[Medline]

Alessi, D. R., Deak, M., Casamayor, A., Caudwell, F. B., Morrice, N., Norman, D. G., Gaffney, P., Reese, C. B., MacDougall, C. N., Harbison, D. et al. (1997). 3-Phosphoinositide-dependent protein kinase-1 (PDK1): structural and functional homology with the Drosophila DSTPK61 kinase. Curr. Biol. 7, 776-789.[CrossRef][Medline]

Altomare, D. A., Lyons, G. E., Mitsuuchi, Y., Cheng, J. Q. and Testa, J. R. (1998). Akt2 mRNA is highly expressed in embryonic brown fat and the AKT2 kinase is activated by insulin. Oncogene 16,2407 -2411.[CrossRef][Medline]

Backman, S. A., Stambolic, V., Suzuki, A., Haight, J., Elia, A., Pretorius, J., Tsao, M. S., Shannon, P., Bolon, B., Ivy, G. O. et al. (2001). Deletion of Pten in mouse brain causes seizures, ataxia and defects in soma size resembling Lhermitte-Duclos disease. Nat. Genet. 29,396 -403.[CrossRef][Medline]

Beck, K. D., Powell-Braxton, L., Widmer, H. R., Valverde, J. and Hefti, F. (1995). Igf1 gene disruption results in reduced brain size, CNS hypomyelination, and loss of hippocampal granule and striatal parvalbumin-containing neurons. Neuron 14,717 -730.[CrossRef][Medline]

Boretius, S., Merkler, D., Awn, N., Stadelmann, C., Natt, O., Watanabe, T., Michaelis, T., Frahms, J. and Brück, W. (2003). How do T1-, T2- and MT-weighted images reflect de- and remyelination? In vivo MRI of mice treated with the demyelinating neurotoxic agent cuprizone. Proc. Intl. Soc. Magn. Reson. Med. 12, 280.

Brazil, D. P. and Hemmings, B. A. (2001). Ten years of protein kinase B signalling: a hard Akt to follow. Trends Biochem. Sci. 26,657 -664.[CrossRef][Medline]

Brodbeck, D., Cron, P. and Hemmings, B. A. (1999). A human protein kinase Bgamma with regulatory phosphorylation sites in the activation loop and in the C-terminal hydrophobic domain. J. Biol. Chem. 274,9133 -9136.[Abstract/Free Full Text]

Burgering, B. M. and Coffer, P. J. (1995). Protein kinase B (c-Akt) in phosphatidylinositol-3-OH kinase signal transduction. Nature 376,599 -602.[CrossRef][Medline]

Carson, M. J., Behringer, R. R., Brinster, R. L. and McMorris, F. A. (1993). Insulin-like growth factor I increases brain growth and central nervous system myelination in transgenic mice. Neuron 10,729 -740.[CrossRef][Medline]

Chan, T. O., Rittenhouse, S. E. and Tsichlis, P. N. (1999). AKT/PKB and other D3 phosphoinositide-regulated kinases: kinase activation by phosphoinositide-dependent phosphorylation. Annu. Rev. Biochem. 68,965 -1014.[CrossRef][Medline]

Chen, W. S., Xu, P. Z., Gottlob, K., Chen, M. L., Sokol, K., Shiyanova, T., Roninson, I., Weng, W., Suzuki, R., Tobe, K. et al. (2001). Growth retardation and increased apoptosis in mice with homozygous disruption of the Akt1 gene. Genes Dev. 15,2203 -2208.[Abstract/Free Full Text]

Cheng, C. M., Joncas, G., Reinhardt, R. R., Farrer, R., Quarles, R., Janssen, J., McDonald, M. P., Crawley, J. N., Powell-Braxton, L. and Bondy, C. A. (1998). Biochemical and morphometric analyses show that myelination in the insulin-like growth factor 1 null brain is proportionate to its neuronal composition. J. Neurosci. 18,5673 -5681.[Abstract/Free Full Text]

Cheng, J. Q., Godwin, A. K., Bellacosa, A., Taguchi, T., Franke, T. F., Hamilton, T. C., Tsichlis, P. N. and Testa, J. R. (1992). AKT2, a putative oncogene encoding a member of a subfamily of protein-serine/threonine kinases, is amplified in human ovarian carcinomas. Proc. Natl. Acad. Sci. USA 89,9267 -9271.[Abstract/Free Full Text]

Cho, H., Mu, J., Kim, J. K., Thorvaldsen, J. L., Chu, Q., Crenshaw, E. B., 3rd, Kaestner, K. H., Bartolomei, M. S., Shulman, G. I. and Birnbaum, M. J. (2001a). Insulin resistance and a diabetes mellitus-like syndrome in mice lacking the protein kinase Akt2 (PKB beta). Science 292,1728 -1731.[Abstract/Free Full Text]

Cho, H., Thorvaldsen, J. L., Chu, Q., Feng, F. and Birnbaum, M. J. (2001b). Akt1/PKBalpha is required for normal growth but dispensable for maintenance of glucose homeostasis in mice. J. Biol. Chem. 276,38349 -38352.[Abstract/Free Full Text]

Cross, D. A., Alessi, D. R., Cohen, P., Andjelkovich, M. and Hemmings, B. A. (1995). Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature 378,785 -789.[CrossRef][Medline]

Dash, P. K., Mach, S. A., Moody, M. R. and Moore, A. N. (2004). Performance in long-term memory tasks is augmented by a phosphorylated growth factor receptor fragment. J. Neurosci. Res. 77,205 -216.[CrossRef][Medline]

Datta, S. R., Brunet, A. and Greenberg, M. E. (1999). Cellular survival: a play in three Akts. Genes Dev. 13,2905 -2927.[Free Full Text]

D'Ercole, A. J., Ye, P. and O'Kusky, J. R. (2002). Mutant mouse models of insulin-like growth factor actions in the central nervous system. Neuropeptides 36,209 -220.[CrossRef][Medline]

Dudek, H., Datta, S. R., Franke, T. F., Birnbaum, M. J., Yao, R., Cooper, G. M., Segal, R. A., Kaplan, D. R. and Greenberg, M. E. (1997). Regulation of neuronal survival by the serine-threonine protein kinase Akt. Science 275,661 -665.[Abstract/Free Full Text]

Franke, T. F., Yang, S. I., Chan, T. O., Datta, K., Kazlauskas, A., Morrison, D. K., Kaplan, D. R. and Tsichlis, P. N. (1995). The protein kinase encoded by the Akt proto-oncogene is a target of the PDGF-activated phosphatidylinositol 3-kinase. Cell 81,727 -736.[CrossRef][Medline]

Garofalo, R. S., Orena, S. J., Rafidi, K., Torchia, A. J., Stock, J. L., Hildebrandt, A. L., Coskran, T., Black, S. C., Brees, D. J., Wicks, J. R. et al. (2003). Severe diabetes, age-dependent loss of adipose tissue, and mild growth deficiency in mice lacking Akt2/PKB beta. J. Clin. Invest. 112,197 -208.[CrossRef][Medline]