|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online June 8, 2005
doi: 10.1242/10.1242/dev.01882
Neurobiology and Behavior Program, Department of Biological Structure, 357420 Health Sciences Center, University of Washington, School of Medicine, Seattle, WA 98195, USA
* Author for correspondence (e-mail: tomreh{at}u.washington.edu)
Accepted 27 April 2005
| SUMMARY |
|---|
|
|
|---|
Key words: TGFß, Müller glia, Proliferation, Progenitors, Retinogenesis, Cytostasis, Rat
| Introduction |
|---|
|
|
|---|
(TGF
) stimulate proliferation of
progenitors isolated from the developing retina
(Anchan et al., 1991
However, little is known regarding the role of extrinsic factors in the
decline of proliferation that occurs during late retinogenesis
(Alexiades and Cepko, 1996
;
Young, 1985
). Retinal
progenitor proliferation peaks around the day of birth, and declines until
approximately the end of the first postnatal week
(Sidman, 1960
;
Young, 1985
). After this time,
there is little evidence for renewed proliferation of either progenitors or
Müller glia in the mammalian retina, except under abnormal conditions
(Fariss et al., 2000
;
Moshiri and Reh, 2004
;
Nork et al., 1986
;
Nork et al., 1987
;
Robison et al., 1990
;
Sueishi et al., 1996
). This
appears to be true of most of the CNS; after the period of embryonic and
neonatal neurogenesis, only a few regions of the CNS retain neural progenitors
(Gage, 2002
).
The molecular basis for the establishment and maintenance of mitotic
quiescence in the CNS is not well understood. Co-culture studies have
demonstrated that neurons can inhibit glial proliferation
(Gomes et al, 1999
). For
example, Hatten (Hatten, 1987
)
found that proliferation of postnatal mouse cerebellar glia was inhibited
fivefold when cultured with cerebellar neurons. Recently, TGFß family
members have been implicated in the inhibition of proliferation in the nervous
system. Constam et al. (Constam et al.,
1994
) demonstrated that the postnatal decline in cerebellar
precursor proliferation is paralleled by an increase in neuronal TGFß2
expression, and that TGFß2 inhibits precursor proliferation in culture.
Moreover, growth and differentiation factor 11 (GDF11), a member of the
TGFß superfamily expressed in the olfactory epithelium, was shown to
inhibit proliferation of neuronal precursors in explant cultures of mouse
olfactory epithelium (Wu et al.,
2003
).
In light of these studies, we sought to determine whether the postnatal reduction in progenitor and glial proliferation is regulated by signaling factors present in the developing retina. We found that progenitor and Müller glial proliferation was inhibited by co-culture with retinal cells, and further characterized the nature of the mitotic inhibitor using a combination of receptor blocking experiments, addition of TGFßs, intraocular injections and explant cultures of retinal glia and progenitors. The results of our experiments support a model in which TGFß2, primarily derived from retinal neurons, inhibits proliferation of retinal progenitors and glia at the end of retinogenesis.
| Materials and methods |
|---|
|
|
|---|
Immunohistochemistry
Tissues were rinsed in PBS, fixed in 4% paraformaldehyde/4% sucrose in PBS
for 1 hour, and cryoprotected in 30% sucrose prior to cryosectioning.
Cryosections were mounted on Superfrost slides (VWR). Slides stained with
anti-BrdU were incubated for 10 minutes in 4 N HCl, washed in PBS and blocked
at room temperature for 1.5 hours in 0.3% TritonX-100/5% goat serum/PBS. All
primary antibody staining procedures were performed overnight at room
temperature in 0.3% TX-100/PBS, followed by four 15 minute PBS washes.
Secondary antibody incubations were performed for 1 hour at room temperature
in 0.3% TX-100/PBS, followed by four 15 minute PBS washes. For DAPI staining,
1 µg/ml DAPI (sigma) was used, followed by two PBS rinses.
Sections/coverslips were rinsed in water, dried, and mounted in Flouromount
(Southern Biotechnology) medium.
Antibodies used include: mouse anti-rat ß3 tubulin (1:500, BabCo), mouse-anti-BrdU(1:150, G3G4 Developmental Studies HB), mouse anti-nestin (1:80, DSHB), rat anti-BrdU (1:100, Accurate), rabbit anti-bovine CRALBP (1:500, UW55, gift from Jack Saari, University of Washington), guinea pig anti-glast (1:3000, Chemicon), rabbit anti-human TGFß2 (1:200, Santa Cruz), rabbit anti-human TGFßR1 (1:100, Santa Cruz), rabbit anti-human TGFßRII (1:100, Santa Cruz). Secondary antibodies used include: goat anti-rabbit Alexa 568 (1:500, Molecular Probes), goat anti-rabbit Alexa 488 (1:500, Molecular Probes), goat anti-mouse Alexa 488 (1:500, Molecular Probes), goat anti-mouse Alexa 568 (1:500, Molecular Probes), goat anti-rat 488 (1:500, Molecular Probes) and goat anti-guinea pig Cy3 (1:700, Chemicon).
Retinal cell cultures
Rats were sacrificed by CO2 overanesthesia and cervical
dislocation. Eyes were removed and retinas were dissected in Hank's buffered
Salt Solution (HBSS, Gibco-BRL). Retinal explants were cultured in DMEM/F-12
and B27 (Invitrogen). Following culture, explants were either fixed and
processed for immunohistochemistry, or dissociated and plated on
poly-ornithine-coated glass coverslips for 2 hours, then fixed and processed
for immunohistochemistry. For dissociated cell cultures, retinas were rinsed
in sterile Ca2+ and Mg2+-free HBSS (CMF) and dissociated
at 37°C for 5-10 minutes in a 0.5% trypsin/CMF solution. Trypsin was
inactivated by one-fifth the volume of fetal bovine serum and the cells were
spun at 1500 rpm for 5 minutes and resuspended in DMEM/F12 media supplemented
with 0.6% glucose, 0.1125% NaHCO3, 5 mM HEPES, 1% fetal bovine
serum (Gibco-BRL), penicillin (1 unit/ml) and streptomycin(1 µg/ml), and
hormone supplement including putrescine (9.66 µg/ml), progesterone (0.02
µM), selenium (30 µM), apo-Transferrin (0.1 mg/ml) and insulin (0.025
mg/ml). Dissociated retinas were plated on poly-D-Lysine coated glass
coverslips, overlaid with Matrigel basement membrane (Collaborative Research)
and maintained at 37°C. 5-Bromo-2'Deoxyuridine (BrdU; Sigma) was
used at 10 µg/ml. Growth factors/blocking factors (all from R&D
Systems) used include recombinant human TGFß2, mTGFßRII-hFc (0.5
µg/ml), mActivinRIIB-hFc (0.5 µg/ml) and mBMPRIB-hFc (2 µg/ml).
Cell counting and statistics
Cells were counted using a Zeiss Axiophot fluorescent microscope and Spot
II camera. For P4 and P6 explants, three or four individuals from three
litters were used. For each dissociated retinal explant, five or six random
fields were chosen, and the percentage of BrdU+ cells (out of a
total of 150-200 cells) was calculated for each field. For the P5.5
intraocular injections, sections were selected in which the optic nerve was
visible, and the number of BrdU+ cells/mm2 was
determined for eight fields. Six animals were analyzed for the control (DMSO)
group and five animals were analyzed in the treated group (SB-431542). For the
P10 intraocular injections, the following numbers of animals were analyzed:
four in the control group, two with the anti-TGFß cocktail alone, four in
the 250 ng EGF-treated group, and four in the group with 250 ng EGF +
anti-TGFß cocktail. Student's t-test and ANOVA were used to
compare the groups for significant differences.
Quantitative PCR
Quantitative RT-PCR was performed as previously described
(Kubota et al., 2004
) using an
Opticon monitor from MJ Research and Sybr Green PCR Master Mix (Applied
Biosystems). RNA samples were taken from three different individuals at the
age indicated. Total RNA was collected using Trizol (Invitrogen), DNAse
treated using Rneasy mini-kit (Qiagen) and quantified by spectrophotometry.
RNA (1 µg) was used for the reverse transcription reaction, using Oligo-dTs
and Superscript II RT. cDNA samples were run in triplicate for each primer
set. The cycle at which a given sample/primer combination reached log-phase
was noted and normalized to GAPDH levels. Primers were obtained from
Invitrogen and designed using Primer3 (MIT) to amplify 200 bp of each gene.
Primer sequences, 5' to 3': Gapdh 5', AAGGTCATCCCAGAGCTGAA;
GAPDH 3', GTCCTCAGTGTAGCCCAGGA; TGFß1 5',
ATGACATGAACCGACCCTTC; TGFß1 3', ACTTCCAACCCAGGTCCTTC; TGFß2
5', CAACACCATAAACCCCGAAG; TGFß2 3', GGCTTTCCCGAGGACTTTAG;
TGFß3 5', CTTACCTCCGCAGCTCAGAC; TGFß3 3',
CCTCAGCTGCACTTACACGA; TGFßRI 5', ACCTTCTGATCCATCCGTTG; TGFßRI
3', CTTCCTGTTGGCTGAGCTGT; TGFßRII 5', CCTGTGTGGAGAGCATCAAA;
TGFßRII 3', ATCTGGGTGCTCCAGTTCAC.
Efficiency curves were performed by diluting template DNA 8-, 16-, 32- and 64-fold. The average difference for all primers between each twofold dilution was one.
Western blotting
Retinas were dissected in PBS, and the central and peripheral retinas were
separated. Protein was extracted using M-PER buffer (Pierce) and quantified by
Coomassie Reagent (BioRad) as per manufacturer's instructions. Protein (30
µg) was loaded in each well. Membranes were incubated with primary
antibodies rabbit anti-human TGFß2 (1:200, Santa Cruz), rabbit anti-human
TGFßRI (1:100, Santa Cruz) and rabbit anti-human TGFßRII (1:100,
Santa Cruz), rabbit anti-Foxo1 (1:200, CeMines), rabbit anti-Smad2/3 (1:1000,
BD Biosciences). Secondary antibodies were goat anti-mouse alkaline
phosphatase and goat anti-rabbit alkaline phosphatase from the BioRad
Immunostar Chemilluminescence kit.
| Results |
|---|
|
|
|---|
A TGFß signal from the retina inhibits proliferation in the retina
The termination of proliferation in the postnatal retina might be explained
by either intrinsic changes in the progenitor cells or by extrinsic factors in
the progenitor micro-environment. We hypothesized that a signal from mature
retinal cells might be responsible for the termination of proliferation in the
retina. To test this hypothesis, we used the experimental protocol shown in
Fig. 2A. P4 rat retinas were
dissociated and cultured for 24 hours. Surviving cells were re-dissociated and
plated onto Matrigel-coated, glass coverslips. Following the first passaging,
many of the surviving, proliferating cells are progenitors, as indicated by
immunoreactivity for the progenitor marker nestin
(Fig. 2B,D). On the third day
of culture, retinas from P13 animals were harvested, dissociated and plated on
4 µm filter culture plate inserts, which were inserted into the wells that
contain the P4-derived retinal cells. Thus, any soluble factors from the newly
added retinal cells that could mediate an effect on proliferation should have
access to the underlying progenitors. The cells were co-cultured in this
manner for 12 hours, with BrdU added during the last 2 hours.
Fig. 2B shows a typical field of nestin-positive progenitor cells under control conditions, with no additional retinal cells added to the culture. Under control conditions, 25% (±2.4) of nestin-expressing cells enter S-phase during the BrdU pulse (Fig. 2F). However, when 5 million P13 retinal cells are added (Fig. 2D), the percentage of progenitor cells entering S-phase drops to 15% (±2.2), consistent with the hypothesis that a soluble cytostatic factor is produced by retinal cells.
|
44% (±2.3) of
CRALBP-positive Müller glia are BrdU-positive in the control condition
(Fig. 2C,G) However, when 5
million dissociated retinal cells are added to these glia, the percentage of
CRALBP-positive cells incorporating BrdU shrinks to 23% (±2.8)
(Fig. 2E,G). These data
therefore indicate that a soluble factor released by retinal cells inhibits
Müller glial proliferation.
|
TGFß ligands and receptors are expressed in the postnatal retina
TGFß signaling has been implicated in controlling the proliferation of
a variety of cell types (Anchan and Reh,
1995
; Hunter et al.,
1993
; Pillaire et al.,
1999
). To determine whether TGFß signaling components are
expressed in the first postnatal weeks, RT-PCR and immunohistochemistry were
performed on retinas from rats aged P4 to adult. Levels of transcription of
TGFß ligands and receptors were investigated via quantitative RT-PCR.
At P4, mRNA encoding TGFß ligands and receptors was present in the
retina (Fig. 4K). Quantitative
RT-PCR results suggest the most highly expressed TGFß ligand was
TGFß2, as TGFß2 transcripts are 80-fold more abundant than
TGFß3 and eightfold more abundant than TGFß1
(Fig. 4G). Thus, the mRNA for
TGFßs and their receptors are present at P4, and TGFß2 is the
predominant ligand expressed. Immunolocalization of receptor protein
expression reveals that TGFßRI and RII are expressed in the
nestin-positive processes of P4 retinal progenitors (arrowheads,
Fig. 4A-F). In addition, at
higher magnification, we observe nestin-positive cell bodies that co-label
with both TGFß receptor proteins (see Fig. S1 in the supplementary
material). Furthermore, TGFß2 is most highly expressed in ß3
tubulin-positive cells in the ganglion cell layer and the inner part of the
INL (presumably amacrine cells) (Fig.
4H-J). All sections shown are taken from central retina, and we
did not observe significant gradients of expression in either the ligands or
receptors when examined by immunostaining or western blot (data not shown).
However, we did observe an increase in retinal Smad2/3 expression between P4
and P6 by western blot (see Fig. S2 in the supplementary material). This
increase might enhance the effectiveness of TGFß signaling that occurs at
this time. Furthermore, at P6, when proliferation is absent from the central
retina, we observed higher levels of forkhead box family member Foxo1
expression in the central retina compared with peripheral retina by western
blot (see Fig. S2 in the supplementary material). As Foxo1 has been shown to
enhance TGFß signaling in neuroepithelial cells, its presence in the
central retina may indicate higher levels of TGFß signaling
(Seoane et al., 2004
).
These data suggest that: (1) retinal progenitors in the postnatal retina possess the TGFß receptor complement necessary for signaling; and (2) the predominant TGFß ligand expressed at this stage, TGFß2, is expressed by retinal neurons. Furthermore, at P4 and P6, downstream TGFß signaling components, such as Smad2/3 and Foxo1 are present and may play a role in the regulation of retinal proliferation.
|
12-fold higher expression than TGFß1
(Fig. 5K). Again,
immunostaining results show TGFß2 expression primarily in ß3
tubulin-positive neurons in the inner nuclear layer (arrowheads,
Fig. 5G-I). At this stage,
TGFß receptor I and II expression can be found in Glast-positive
Müller cell bodies of the inner nuclear layer (arrowheads) and
Müller glial processes (arrows) in the outer nuclear layer
(Fig. 5A-F), indicating that
Müller glia are competent to respond to TGFß signals. Again, all
sections shown are taken from the central retina, and we did not observe a
significant central-peripheral gradient in either receptor or ligand
expression at any developmental timepoint. At both P4 and P10, the TGFß
receptor is also expressed in ganglion cells and it is possible that some of
the effects of TGFß on progenitors and glia are not direct. Taken together, these data indicate that: (1) the primary TGFß receptor ligand in the postnatal retina is TGFß2; (2) TGFß2 is primarily expressed by inner retinal neurons; and (3) both postnatal progenitors and Müller glia express TGFß receptors. The data are consistent with the hypothesis that production of TGFß2 by retinal neurons during development acts to limit progenitor and Müller glial proliferation.
|
|
In addition to their role in the regulation of proliferation, TGFßs
have been shown to promote cell death in embryonic mouse retina
(Dunker and Krieglstein, 2003
;
Dunker et al., 2001
). To
determine whether the changes we observed in the number of BrdU-positive cells
in these explant cultures were due to a TGFß-mediated increase in
apoptosis, we performed TUNEL analysis on sectioned, TGFß-treated
explants. No consistent or significant changes in the numbers or locations of
apoptotic cells could be observed between control and TGFß treated
explants (data not shown).
Inhibition of TGFß activity restores proliferation to the P6 retina in vitro and in vivo
As noted above, postnatal day 6 retinas show a markedly reduced level of
proliferation when compared with P4 retinas (see
Fig. 1). To determine if
proliferation in P6 retinas could be restored by inhibiting TGFß
signaling, we used a TGFß neutralizing monoclonal antibody, which binds
TGFß ligands 1, 2 and 3 of multiple species, including rat
(Dasch et al., 1989
). When
explants were treated with the anti-TGFß antibody for 24 hours in the
presence of BrdU, there was a 170% (±19) increase in the percentage of
cells incorporating BrdU during the culture period, compared with controls
(mouse IGG alone, Fig. 7A-C).
At this stage of development, the proliferating cells could be either
Müller glia or retinal progenitors. To determine this, we labeled the
dividing cells with anti-BrdU and CRALBP. The anti-TGFß treated explants
showed an increase in BrdU labeling for both CRALBP+ Müller
glia and progenitor cells (data not shown). Qualitatively, the increase in
proliferation in these explants occurred most often as an expansion of the
peripheral zone into more central areas of the retina (data not shown).
These explant experiments show that TGFß signaling has an anti-proliferative effect on cells of the postnatal rat retina, and that inhibiting this endogenous signal maintains proliferation of the progenitors past the developmental period in which the retina would normally become mitotically quiescent.
Inhibition of TGFß signaling in vivo at postnatal day 6 also extends
the period of proliferation. For these experiments, we used SB-431542, a small
molecule inhibitor of TGFßRI/Alk5
(Callahan et al., 2002
;
Inman et al., 2002
). Postnatal
day 5.5 pups were given intraocular injections of either DMSO
(Fig. 8A) or 40 nanomoles
SB431542 dissolved in DMSO (Fig.
8B), followed by a single BrdU injection 12 hours later, at P6.
There was an increase in the number of BrdU+ cells in
SB431542-treated animals (Fig.
8B) compared with DMSO-treated animals
(Fig. 8A); control retinas
contained an average of 105 (±27) BrdU-labeled cells/mm2 of
central retina, compared with 240 (±40) in animals treated with
SB-431542. These data further support the possibility that TGFß is an
important inhibitor of progenitor proliferation in the postnatal retina.
|
|
|
To test whether TGFß acts through p27kip1 to inhibit proliferation, we added TGFß2 to cultures of Müller glia. We found that TGFß treatment can upregulate p27kip1 expression in dissociated cultures of Müller glia to 130% of control levels (data not shown). We also examined p27kip1 expression in the retina of rats that had received injections of EGF and EGF combined with TGFß inhibitors. In the control condition, p27kip1 expression was expressed by CRALBP-positive, Müller glial cells located in the inner nuclear layer (arrows, Fig. 10A-C). In animals injected with 250 ng EGF alone, p27kip1 expression appeared slightly downregulated in the inner nuclear layer (Fig. 10D-F); however, in animals treated with EGF and the anti-TGFß cocktail, p27kip expression was substantially reduced (Fig. 10G-I).
| Discussion |
|---|
|
|
|---|
The immunostaining pattern we observed for TGFß2, the most abundantly
expressed TGFß ligand, and its receptors suggests a paracrine signaling
mechanism is responsible for the inhibition of proliferation; TGFß2
expression was found in the amacrine and ganglion cells at P4, and later in
the ß3-tubulin-positive, inner-retinal neurons. The presence of the
paracrine signaling pathway could ensure that progenitors provide the
necessary numbers of late-born cell types needed to make connections with the
already existing early-born cells. As noted in the Introduction, mitogenic Shh
is produced in the retinal ganglion cells during development
(Jensen and Wallace, 1997
;
Levine et al, 1997
;
Dakubo et al., 2003
;
Wang et al., 2002
). In light
of our results, retinal neurons appear to provide both mitogenic and
cytostatic factors. The co-expression of mitogenic and anti-mitogenic signals
within the same tissue has also been observed in the cerebellum; postmitotic
neurons produce the mitogen, Shh and the mitotic inhibitory signal, TGFß
(Constam et al., 1994
;
Dahmane and Ruiz-i-Altaba,
1999
; Wallace,
1999
; Wechsler-Reya and Scott,
1999
). In addition, in the olfactory epithelium, where GDF11 has
been shown to inhibit neurogenesis, mitogenic Fgf8 and Follistatin, an
inhibitor of GDF11, are expressed (Calof et
al., 1998
; Shou et al.,
2000
; Wu et al.,
2003
). A common source of mitogen and growth-inhibitory signals
might finely tune the numbers and ratios of cells as they are born or as
neurons die, resulting in properly functioning circuits.
|
|
Our results are consistent with data from previous in vitro studies of
Müller glia, demonstrating that EGF is a mitogen for Müller glial
cells (Ikeda and Puro, 1995
;
Mascarelli et al., 1991
;
Milenkovic et al., 2003
;
Milenkovic et al., 2004
;
Roque et al., 1992
;
Scherer and Schnitzer, 1994
).
In addition, TGFß has been implicated as an inhibitor of Müller
glial proliferation in vitro (Ikeda and
Puro, 1995
). Furthermore Ikeda et al found that cultured
Müller cells express type I and type II TGFß receptors
(Ikeda et al., 1998
).
Moreover, the antagonism between mitogenic factors like EGF and cytostatic
factors like TGFß may be present in astrocytes as well. For example, many
studies have reported the mitogenic effects of EGF and related ligands on
astrocyte proliferation (Bachoo et al.,
2002
; Doetsch et al.,
2002
; Huff et al.,
1990
; Leutz and Schachner,
1981
; Rabchevsky et al.,
1998
). TGFß can antagonize the EGF response in astrocytes
(Hunter et al., 1993
;
Sousa Vde et al., 2004
). In
fact, de Sampaio e Spohr et. al. have proposed a paracrine interaction between
neurons and astrocytes, also mediated by TGFß1, similar to what we have
proposed for Müller glia (de Sampaio
e Spohr et al., 2002
).
Together with these previous studies, our results support a model of
neurogenesis in which the balance of mitogenic factors and mitotic inhibitors
determine the level of proliferation in both the developing and postmitotic
retina. The antagonistic interaction between the EGF and TGFß pathways
may be due to intracellular intersection of these signaling pathways
(ten Dijke et al., 2000
). This
counteractive effect might allow EGF to play a mitogenic role in the presence
of anti-mitogenic TGFß signals in the postnatal retina. For example, the
interferon
(Jak/Stat) and EGF (Erk kinase) signaling pathways can
upregulate inhibitory Smad7, which prevents nuclear translocation and
transcriptional activation of Smad target genes
(Ulloa et al., 1999
). EGF also
inhibits the TGFß pathway through phosphorylation of Smad2/3 in the
linker region, preventing nuclear translocation
(Kretzschmar et al., 1999
).
EGF can also counteract the cytostatic effect of TGFß by interfering with
its ability to activate CDKI p15INK4b
(Dunfield and Nachtigal,
2003
).
One remaining question, however, is how does TGFß inhibit
proliferation in the central to peripheral pattern observed, when we saw no
gradient in expression of signaling components? This might be accomplished
through intracellular read-outs of EGF and TGFß signaling. Indeed,
retinal progenitor cells are known to change their responsiveness to EGF
during development (Lillien and Cepko,
1992
). This enhanced responsiveness to EGF in the late retinal
progenitor cells is due, in part, to an increase in the level of the EGF
receptor expression; however, it is likely that intracellular interaction with
TGFß signaling is also important.
Recent studies provide insight into how the intracellular readout of
mitogenic versus cyctostatic TGFß signals occurs molecularly. Seoane et.
al. (Seoane et al., 2004
)
found that the forkhead box (Fox) family of transcription factors act as both
positive and negative regulators of Smad-mediated transcription in
neuroepithelial cells (Seoane et al.,
2004
). The authors found that Foxo proteins, which associate with
Smads and facilitate transcriptional activation at the p21cip
promoter, were expelled from the nucleus in the presence of PI3 kinase
signaling. Foxg1, which promotes the differentiation of cortical progenitors,
blocked the ability of the Foxo/Smad complex to activate transcription of
p21cip in this same study
(Hanashima et al., 2004
;
Hanashima et al., 2002
).
Therefore, it is possible that the response to the EGF and TGFß signals
received by a given cell are determined by the expression pattern or levels of
factors such as the Fox proteins. Our data suggests Foxo1 might facilitate
TGFß signaling in the central retina at P6, as Foxo1 protein is more
abundant centrally than peripherally. It is notable that in our in vivo P5.5
injections and P6 explant cultures, inhibition of TGFßRI alone was
sufficient to stimulate proliferation. Yet at P10, the addition of EGF was
required to promote Müller glial proliferation in vivo. Thus, both the
response to mitotic inhibitors, as well as the availability of mitogens,
shifts from conditions favoring proliferation to conditions that maintain
quiescence at the termination of neurogenesis.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/132/13/3015/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Alexiades, M. R. and Cepko, C. (1996). Quantitative analysis of proliferation and cell cycle length during development of the rat retina. Dev. Dyn. 205,293 -307.[CrossRef][Medline]
Anchan, R. M. and Reh, T. A. (1995). Transforming growth factor-beta-3 is mitogenic for rat retinal progenitor cells in vitro. J. Neurobiol. 28,133 -145.[CrossRef][Medline]
Anchan, R. M., Reh, T. A., Angello, J., Balliet, A. and Walker, M. (1991). EGF and TGF-alpha stimulate retinal neuroepithelial cell proliferation in vitro. Neuron 6, 923-936.[CrossRef][Medline]
Bachoo, R. M., Maher, E. A., Ligon, K. L., Sharpless, N. E., Chan, S. S., You, M. J., Tang, Y., DeFrances, J., Stover, E., Weissleder, R. et al. (2002). Epidermal growth factor receptor and Ink4a/Arf: convergent mechanisms governing terminal differentiation and transformation along the neural stem cell to astrocyte axis. Cancer Cells 1,269 -277.[CrossRef][Medline]
Callahan, J. F., Burgess, J. L., Fornwald, J. A., Gaster, L. M., Harling, J. D., Harrington, F. P., Heer, J., Kwon, C., Lehr, R., Mathur, A. et al. (2002). Identification of novel inhibitors of the transforming growth factor beta1 (TGF-beta1) type 1 receptor (ALK5). J. Med. Chem. 45,999 -1001.[CrossRef][Medline]
Calof, A. L., Mumm, J. S., Rim, P. C. and Shou, J. (1998). The neuronal stem cell of the olfactory epithelium. J. Neurobiol. 36,190 -205.[CrossRef][Medline]
Constam, D. B., Schmid, P., Aguzzi, A., Schachner, M. and Fontana, A. (1994). Transient production of TGF-beta 2 by postnatal cerebellar neurons and its effect on neuroblast proliferation. Eur. J. Neurosci. 6,766 -778.[CrossRef][Medline]
Dahmane, N. and Ruiz-i-Altaba, A. (1999). Sonic hedgehog regulates the growth and patterning of the cerebellum. Development 126,3089 -3100.[Abstract]
Dakubo, G. D., Wang, Y. P., Mazerolle, C., Campsall, K.,
McMahon, A. P. and Wallace, V. A. (2003). Retinal ganglion
cell-derived sonic hedgehog signaling is required for optic disc and stalk
neuroepithelial cell development. Development
130,2967
-2680.
Dasch, J. R., Pace, D. R., Waegell, W., Inenaga, D. and Ellingsworth, L. (1989). Monoclonal antibodies recognizing transforming growth factor-beta. Bioactivity neutralization and transforming growth factor beta 2 affinity purification. J. Immunol. 142,1536 -1541.[Abstract]
de Sampaio e Spohr, T. C., Martinez, R., da Silva, E. F., Neto, V. M. and Gomes, F. C. (2002). Neuro-glia interaction effects on GFAP gene: a novel role for transforming growth factor-beta1. Eur J. Neurosci. 16,2059 -2069.[CrossRef][Medline]
Doetsch, F., Petreanu, L., Caille, I., Garcia-Verdugo, J. M. and Alvarez-Buylla, A. (2002). EGF converts transit-amplifying neurogenic precursors in the adult brain into multipotent stem cells. Neuron 36,1021 -1034.[CrossRef][Medline]
Dunfield, L. D. and Nachtigal, M. W. (2003). Inhibition of the antiproliferative effect of TGFßeta by EGF in primary human ovarian cancer cells. Oncogene 22,4745 -4751.[CrossRef][Medline]
Dunker, N. and Krieglstein, K. (2003). Reduced programmed cell death in the retina and defects in lens and cornea of Tgfbeta2(-/-) Tgfbeta3(-/-) double-deficient mice. Cell Tissue Res. 313,1 -10.[CrossRef][Medline]
Dunker, N., Schuster, N. and Krieglstein, K.
(2001). TGF-beta modulates programmed cell death in the retina of
the developing chick embryo. Development
128,1933
-1942.
Dyer, M. A. and Cepko, C. L. (2000). Control of Muller glial cell proliferation and activation following retinal injury. Nat. Neurosci. 3,873 -880.[CrossRef][Medline]
Dyer, M. A. and Cepko, C. L. (2001). p27Kip1
and p57Kip2 regulate proliferation in distinct retinal progenitor cell
populations. J. Neurosci.
21,4259
-4271.
Fariss, R. N., Li, Z. Y. and Milam, A. H. (2000). Abnormalities in rod photoreceptors, amacrine cells, and horizontal cells in human retinas with retinitis pigmentosa. Am. J. Ophthalmol. 129,215 -223.[CrossRef][Medline]
Fischer, A. J. and Reh, T. A. (2001). Muller glia are a potential source of neural regeneration in the postnatal chicken retina. Nat. Neurosci. 4, 247-252.[CrossRef][Medline]
Fischer, A. J. and Reh, T. A. (2002). Exogenous growth factors stimulate the regeneration of ganglion cells in the chicken retina. Dev. Biol. 251,367 -379.[CrossRef][Medline]
Fischer, A. J., McGuire, C. R., Dierks, B. D. and Reh, T. A.
(2002). Insulin and fibroblast growth factor 2 activate a
neurogenic program in Muller glia of the chicken retina. J.
Neurosci. 22,9387
-9398.
Gage, F. H. (2002). Neurogenesis in the adult
brain. J. Neurosci. 22,612
-613.
Gomes, F. C., Garcia-Abreu, J., Galou, M., Paulin, D. and Moura Neto, V. (1999). Neurons induce GFAP gene promoter of cultured astrocytes from transgenic mice. Glia 26, 97-108.[CrossRef][Medline]
Hanashima, C., Shen, L., Li, S. C. and Lai, E.
(2002). Brain factor-1 controls the proliferation and
differentiation of neocortical progenitor cells through independent
mechanisms. J. Neurosci.
22,6526
-6536.
Hanashima, C., Li, S. C., Shen, L., Lai, E. and Fishell, G.
(2004). Foxg1 suppresses early cortical cell fate.
Science 303,56
-59.
Hatten, M. E. (1987). Neuronal inhibition of
astroglial cell proliferation is membrane mediated. J. Cell
Biol. 104,1353
-1360.
Huff, K. R., Schreier, W. and Ibric, L. (1990). Proliferation-related responses in rat astrocytes to epidermal growth factor. Int. J. Dev. Neurosci. 8, 255-266.[CrossRef][Medline]
Hunter, K. E., Sporn, M. B. and Davies, A. M. (1993). Transforming growth factor-betas inhibit mitogen-stimulated proliferation of astrocytes. Glia 7, 203-211.[CrossRef][Medline]
Ikeda, T. and Puro, D. G. (1995). Regulation of retinal glial cell proliferation by antiproliferative molecules. Exp. Eye Res. 60,435 -443.[CrossRef][Medline]
Ikeda, T., Homma, Y., Nisida, K., Hirase, K., Sotozono, C., Kinoshita, S. and Puro, D. G. (1998). Expression of transforming growth factor-beta s and their receptors by human retinal glial cells. Curr. Eye Res. 17,546 -550.[CrossRef][Medline]
Inman, G. J., Nicolas, F. J., Callahan, J. F., Harling, J. D.,
Gaster, L. M., Reith, A. D., Laping, N. J. and Hill, C. S.
(2002). SB-431542 is a potent and specific inhibitor of
transforming growth factor-beta superfamily type I activin receptor-like
kinase (ALK) receptors ALK4, ALK5, and ALK7. Mol.
Pharmacol. 62,65
-74.
Jensen, A. M. and Wallace, V. A. (1997). Expression of Sonic hedgehog and its putative role as a precursor cell mitogen in the developing mouse retina. Development 124,363 -371.[Abstract]
Kretzschmar, M., Doody, J., Timokhina, I. and Massague, J.
(1999). A mechanism of repression of TGFbeta/Smad signaling by
oncogenic Ras. Genes Dev.
13,804
-816.
Kubota, R., McGuire, C., Dierks, B. and Reh, T. A. (2004). Identification of ciliary epithelial-specific genes using subtractive libraries and cDNA arrays in the avian eye. Dev. Dyn. 229,529 -540.[CrossRef][Medline]
Leutz, A. and Schachner, M. (1981). Epidermal growth factor stimulates DNA-synthesis of astrocytes in primary cerebellar cultures. Cell Tissue Res. 220,393 -404.[Medline]
Levine, E. M., Roelink, H., Turner, J. and Reh, T. A.
(1997). Sonic hedgehog promotes rod photoreceptor differentiation
in mammalian retinal cells in vitro. J. Neurosci.
17,6277
-6288.
Levine, E. M., Close, J., Fero, M., Ostrovsky, A. and Reh, T. A. (2000). p27(Kip1) regulates cell cycle withdrawal of late multipotent progenitor cells in the mammalian retina. Dev. Biol. 219,299 -314.[CrossRef][Medline]
Lillien, L. and Cepko, C. (1992). Control of proliferation in the retina: temporal changes in responsiveness to FGF and TGF alpha. Development 115,253 -266.[Abstract]
Mascarelli, F., Tassin, J. and Courtois, Y. (1991). Effect of FGFs on adult bovine Muller cells: proliferation, binding and internalization. Growth Factors 4,81 -95.[Medline]
Milenkovic, I., Weick, M., Wiedemann, P., Reichenbach, A. and
Bringmann, A. (2003). P2Y receptor-mediated stimulation of
Muller glial cell DNA synthesis: dependence on EGF and PDGF receptor
transactivation. Invest. Ophthalmol. Vis. Sci.
44,1211
-1220.
Milenkovic, I., Weick, M., Wiedemann, P., Reichenbach, A. and Bringmann, A. (2004). Neuropeptide Y-evoked proliferation of retinal glial (Muller) cells. Graefes. Arch. Clin. Exp. Ophthalmol. 242,944 -950.[CrossRef][Medline]
Moshiri, A. and Reh, T. A. (2004). Persistent
progenitors at the retinal margin of ptc+/- mice. J.
Neurosci. 24,229
-237.
Nork, T. M., Ghobrial, M. W., Peyman, G. A. and Tso, M. O. (1986). Massive retinal gliosis. A reactive proliferation of Muller cells. Arch. Ophthalmol. 104,1383 -1389.[Abstract]
Nork, T. M., Wallow, I. H., Sramek, S. J. and Anderson, G. (1987). Muller's cell involvement in proliferative diabetic retinopathy. Arch. Ophthalmol. 105,1424 -1429.[Abstract]
Pillaire, M. J., Casagrande, F., Malecaze, F., Manenti, S. and Darbon, J. M. (1999). Regulation by transforming growth factor-beta 1 of G1 cyclin-dependent kinases in human retinal epithelial cells. Exp. Eye Res. 68,193 -199.[CrossRef][Medline]
Polyak, K., Kato, J. Y., Solomon, M. J., Sherr, C. J., Massague,
J., Roberts, J. M. and Koff, A. (1994). p27Kip1, a cyclin-Cdk
inhibitor, links transforming growth factor-beta and contact inhibition to
cell cycle arrest. Genes Dev.
8, 9-22.
Rabchevsky, A. G., Weinitz, J. M., Coulpier, M., Fages, C.,
Tinel, M. and Junier, M. P. (1998). A role for transforming
growth factor alpha as an inducer of astrogliosis. J.
Neurosci. 18,10541
-10552.
Reynisdottir, I., Polyak, K., Iavarone, A. and Massague, J.
(1995). Kip/Cip and Ink4 Cdk inhibitors cooperate to induce cell
cycle arrest in response to TGF-beta. Genes Dev.
9,1831
-1845.
Robison, W. G., Jr, Tillis, T. N., Laver, N. and Kinoshita, J. H. (1990). Diabetes-related histopathologies of the rat retina prevented with an aldose reductase inhibitor. Exp. Eye Res. 50,355 -366.[CrossRef][Medline]
Roque, R. S., Caldwell, R. B. and Behzadian, M. A.
(1992). Cultured Muller cells have high levels of epidermal
growth factor receptors. Invest. Ophthalmol. Vis. Sci.
33,2587
-2595.
Scherer, J. and Schnitzer, J. (1994). Growth factor effects on the proliferation of different retinal glial cells in vitro. Brain Res. Dev. Brain Res. 80,209 -221.[CrossRef][Medline]
Seoane, J., Le, H. V., Shen, L., Anderson, S. A. and Massague, J. (2004). Integration of Smad and forkhead pathways in the control of neuroepithelial and glioblastoma cell proliferation. Cell 117,211 -223.[CrossRef][Medline]
Sherr, C. J. and Roberts, J. M. (1999). CDK
inhibitors: positive and negative regulators of G1-phase progression.
Genes Dev. 13,1501
-1512.
Shou, J., Murray, R. C., Rim, P. C. and Calof, A. L. (2000). Opposing effects of bone morphogenetic proteins on neuron production and survival in the olfactory receptor neuron lineage. Development 127,5403 -5413.[Abstract]
Sidman, R. L. (1960). The Structure of the Eye. In Seventh International Congress of Anatomists (ed. G. K. Smelser), pp. 487-505. New York: Academic Press.
Sousa Vde, O., Romao, L., Neto, V. M. and Gomes, F. C. (2004). Glial fibrillary acidic protein gene promoter is differently modulated by transforming growth factor-beta 1 in astrocytes from distinct brain regions. Eur. J. Neurosci. 19,1721 -1730.[CrossRef][Medline]
Sueishi, K., Hata, Y., Murata, T., Nakagawa, K., Ishibashi, T. and Inomata, H. (1996). Endothelial and glial cell interaction in diabetic retinopathy via the function of vascular endothelial growth factor (VEGF). Pol. J. Pharmacol. 48,307 -316.[Medline]
ten Dijke, P., Miyazono, K. and Heldin, C. H. (2000). Signa