|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 27 July 2005
doi: 10.1242/dev.01951
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


Sars International Centre for Marine Molecular Biology at the University of Bergen, Thormoehlensgate 55, 5008 Bergen, Norway
Author for correspondence (e-mail:
tom.becker{at}sars.uib.no)
Accepted 29 June 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Cis-regulatory sequence, Synteny, In vivo imaging, Zebrafish
| Introduction |
|---|
|
|
|---|
Spurred by these successes, efforts have been aimed at establishing
enhancer detection in vertebrate model organisms
(Korn et al., 1992
; Bayer et
al., 1992). More recently, transposon based enhancer detection protocols have
been reported for Medaka and for the zebrafish
(Grabher et al., 2003
;
Balciunas et al., 2004
;
Parinov et al., 2004
), but to
date very few insertion sites have been characterized, and no large-scale
effort has been attempted. Engineered murine leukemia retroviruses (MLV)
represent the most efficient insertional agents in vertebrate systems to date,
and have been developed as gene delivery vectors for gene therapy, insertional
mutagenesis and other experimental approaches
(Frankel et al., 1985
;
Jahner et al., 1982
;
Sanes, 1989
;
Austin and Cepko, 1994
;
Gaiano et al., 1996a
;
Gaiano et al., 1996b
;
Pfeifer and Verma, 2001
;
Amsterdam et al., 2004
). When
pseudotyped with the Vesicular Stomatitis Virus G protein (VSV-G), MLV can
infect zebrafish cells (Gaiano et al.,
1996a
; Burns et al.,
1993
; Lin et al.,
1994
) and expression from an internal ubiquitous promoter was
shown to be detectable after integration and subsequent germline passage
(Linney et al., 1999
). This
latter finding suggested that MLV proviruses are not transcriptionally
silenced in the zebrafish genome, in contrast to what has been observed in
their normal host, the mouse (Jahner and Janisch, 1985). We have devised and
report here an MLV-derived enhancer detection vector containing an internal,
basal zebrafish promoter upstream of a yellow fluorescent protein (YFP)
reporter gene. We demonstrate that this vector expresses the reporter gene in
a subset of genomic integrations in cultured zebrafish cells, as well as in
zebrafish embryos derived from parents carrying proviral germline insertions.
A recent genetic screen in our laboratory has generated around 1000 transgenic
lines of zebrafish that express fluorescent proteins in early tissue specific
patterns, and we show here that the corresponding insertions can be mapped
onto the unfinished zebrafish genome. Many of the insertions have occurred
close to developmental regulatory genes, exemplified by a number of known
transcriptional regulators. The method and the results described in this paper
represent the first approach to experimentally characterize regions of any
vertebrate genome with cis-regulatory activity and the genes therein on a
genomic scale and will probably enhance our understanding of transcriptional
regulation during vertebrate, including human, embryonic development.
| Materials and methods |
|---|
|
|
|---|
Production of VSV-G pseudotyped retrovirus
Generation of pseudotyped viruses was carried out as previously described
(Chen et al., 2002
). The viral
vector pCLGY and a construct expressing the envelope protein VSV-G
(Burns et al., 1993
) were
co-transfected into a 293 gag-pol packaging cell line (293 gp/bsr, gift of Dr
Inder Verma). Virus was harvested 48 hours post transfection, and concentrated
by ultracentrifugation at 50,000 g at 4°C for 90
minutes.
Analysis of zebrafish cells infected with retrovirus
Cultured zebrafish Pac2 fibroblast cells
(Chen et al., 2002
) were
infected with the VSV-G pseudotyped CLGY virus, and analyzed for fluorescence
48 hours post infection by flow cytometry, using a FACScalibur analyzer
(Becton Dickinson, USA). The numbers of integrated virus per cell were
calculated using real-time PCR, essentially as previously described
(Chen et al., 2002
). In brief,
genomic DNA was isolated from the same batch of infected cells as used for
flow cytometry. Proviral sequence was amplified using previously described
primers and probes (Amsterdam et al.,
1999
). To normalize for the DNA amount used as template for the
PCR reactions, an endogenous sequence was co-amplified with the proviral
sequence, using the following primers and probes: forward,
GTATGCCAACAAAGGCAGCA; reverse TGGGTTTTCTGGTTCCAGGT; Taqman probe, Yakima
Yellow-CCCATCGAGCAGATCCCCGA-Darquencher.
Generation and identification of transgenic founder fish and F1 embryos
Zebrafish were obtained from our breeding colony kept and raised according
to a protocol developed in our laboratory
(www.sars.no/manual.doc).
Zebrafish embryos were dechorionated at early blastula stages in 1x
Holtfreters solution containing pronaseE (Sigma). Ten to 20 nl of the
concentrated virus, containing 4 µg of polybrene per ml, were injected at
three or four locations among the cells of blastula-stage zebrafish embryos
(
500-2000 cell stage), as previously described
(Gaiano et al., 1996a
;
Chen et al., 2002
). After
injection, embryos were incubated at 37°C for 2-4 hours before being
transferred to 28.5°C for further raising.
Injected founders (F0 generation) were raised to sexual maturity and outcrossed to wild-type fish. F1 larvae were screened at 24 hours post fertilization using a TE2000-S inverted microscope (Nikon) equipped with 10x and 20x lenses, and a 500/20 nm excitation filter and a 515 nm BP emission filter (Chroma) for detection of YFP. Photographs of live positive embryos were taken using a Spot monochrome digital camera and associated software (Diagnostic Systems). Images were processed in Adobe Photoshop by adjusting levels. High resolution images of the lines in this paper are available at http://clgy.no/clgyimages/.
Cloning of flanking sequences from activated integrated vectors
Eight YFP-positive embryos from each enhancer detection line were raised
until 5 dpf. Genomic DNA was isolated from each individual larva and flanking
genomic sequence of the activated viral integration was amplified using linker
mediated PCR (LM-PCR) (Wu et al.,
2003
). Genomic DNA was digested with MseI and the
resulting fragments were ligated to an MseI linker. LM-PCR was
performed with one primer specific to the viral LTR and the other primer
specific to the linker. Nested PCR was then performed using a second pair of
primers internal to the first primer pair. Based on agarose gel analysis of
the PCR reaction, the activated integration was identified based on size and
its presence in all YFP-positive embryos with the same expression pattern. The
identified integration was sequenced after direct cloning into the TOPO TA
cloning kit (Invitrogen, Carlsbad, CA). The genomic integration site was
subsequently identified by BLAST against the ENSEMBL zebrafish genome sequence
(www.ensembl.org).
A sequence was deemed to flank an enhancer detection insertion if it: (1) was
present exclusively in eight YFP-positive larvae with the same expression
pattern; (2) contained both LTR and linker sequence; (3) matched to a genomic
sequence starting within three bases downstream of the LTR; (4) showed 95% or
greater identity to genomic DNA; and (5) matched to only one locus with 95% or
greater identity (modified after Wu et
al., 2003
).
In situ hybridization and immunodetection
In situ hybridizations were carried out as described
(Jowett and Lettice, 1994
).
For immunodetection of YFP, Embryos were fixed for 3 hours at room temperature
in 4% PFA.
After rinsing three times for 10 minutes in PBT, embryos were dehydrated stepwise: twice for 5 minutes in 50% methanol/50% PBT; twice for 5 minutes in 100% methanol and stored in 100% methanol overnight at 20°C. After stepwise rehydration into PBT, embryos were permeabilized in 0.01 mg/ml Proteinase K (in PBT) for 5 minutes at room temperature then rinsed three times for 5 minutes in PBT.
Post fixation was performed in 4% PFA for 20 minutes at room temperature then embryos were rinsed three times for 5 minutes in PBT. Preparations were blocked at room temperature for 2 hours in incubation buffer (10% goat serum, 1% DMSO, 1% Triton-X in PBS).
Incubation with primary antibody was carried out for 24 to 30 hours at 4°C (polyclonal rabbit anti GFP from Torrey Pines Biolabs at 1:000 dilution in incubation buffer).
After six 30 minutes rinses in PBT at room temperature, specimens were blocked for 2 hours in incubation buffer. Incubation with secondary antibody was carried out for 18 hours at 4°C (Sigma goat ant-rabbit IgG, catalogue number A11034, at 1:200 dilution in incubation buffer), followed by a six 30-minute rinses at room temperature. The HRP signal was then developed by incubation in DAB solution/0.3% H2O2 for 20 until the reaction was stopped by five 5-minutes washes in PBS.
| Results |
|---|
|
|
|---|
|
Regulated expression in transgenic lines
To investigate if integrated proviruses could be activated to express YFP
after passing through the germline, injected fish embryos were raised to
sexual maturity and crossed to nontransgenic wild-type fish. The F1 progeny
from these crosses were then screened with a fluorescence microscope at
one-day post fertilization (1 dpf). We found that on average one out of three
founders transmitted an activated insertion, leading to the isolation of 95
individual reporter expression patterns. As expected, we observed
non-Mendelian inheritance of activated provirus in the F1 clutches, where
frequencies of YFP-expressing embryos for any given expression pattern were in
the range of 1-20%. These rates reflect the late viral infection of germline
cells, and have been reported previously
(Gaiano et al., 1996a
;
Amsterdam, 2003
). The number of
different activated insertions transmitted through the germline of positive
founders was characteristically one, but there were cases of four different
patterns from the same founder. In each case, all positive embryos with one
distinct expression pattern were collected and grown to sexual maturity to
create a transgenic line of fish. From F1 onwards, activated insertions were
inherited in a Mendelian fashion, and we have observed stable expression up to
generation F5 for multiple transgenic lines (data not shown). We found
expression in distinct patterns (Fig.
2;
http://clgy.no/clgyimages/),
ranging from a subset of cell types (e.g. CLGY19), CNS domains (e.g. CLGY5) to
widespread expression (e.g. CLGY14). Enhancer detection events were most
frequently observed expressing in the central nervous system (CNS), but also
in derivatives of the mesoderm (e.g. somites or notochord: CLGY21 and CLGY32,
respectively) or of the endoderm (e.g. hatching glands: CLGY129).
|
3/founder)
relative to the 25 zebrafish chromosomes. The flanking fragment of each
activated provirus was sequenced (see Table S1 in the supplementary material)
and used to search the zebrafish genome assembly in the Ensembl database
(http://www.ensembl.org/)
using BLASTN. For unambiguous mapping of the insertion onto the zebrafish
genome, we required a single unique hit with over 95% identity to genomic
sequence (Table 1). The average
amplicon size was 127 bp, and the shortest, 28 and 25 bp, produced single
unique hits of 100% over the entire length (CLGY47 and CLGY198). In 10 out of
95 cases, we did not obtain any high identity matches in the genome database,
and in a further 13, there were multiple hits with high identity. In an
additional six cases, the insertion was mapped to a contig not yet assembled
or found close to the end of an assembled contig, leaving 65 insertions that
gave single unique hits in assembled sequence or large unassigned contigs.
Over half (33/64) of these insertions are located in finished sequence
according to the Sanger Centre genome annotation, usually either BAC sequence
or manually annotated sequence. Further improvements in the zebrafish genome
sequence will allow resolution of the remaining 31 cases. Alternatively,
longer flanking sequence can be generated starting from the sequence already
obtained. We have listed the flanking sequences identified in each transgenic
line in Table S1 (see supplementary material).
|
Reporter gene expression patterns resemble those of endogenous genes close to the insertion site
We obtained antisense in situ probes for 10 candidate genes identified by
our approach that are described in the literature and found that the
expression of YFP closely resembles the endogenous transcriptional pattern
(Figs 2 and
3). In
Fig. 3 an immunostain of the
YFP pattern was compared with the RNA pattern of the candidate gene mapping
close by in the zebrafish genome. Expression patterns were found to be very
similar in CLGY5/pax6.2 (pax6b Zebrafish Information
Network) (Nornes et al.,
1998
), CLGY4/apoeb (B. Thisse, S. Pflumio, M.
Fürthauer, B. Loppin, V. Heyer, A. Degrave, R. Woehl, A. Lux, T. Steffan,
X. Q. Charbonnier, and C. Thisse, unpublished), CLGY183/emx3
(Houart et al., 2002
),
CLGY198/hoxc8a (Prince et al.,
1998
), CLGY11/otx1l
(Hauptmann et al., 2002
),
CLGY375/ptc1 (Concordet et al.,
1996
), CLGY21/snai1a
(Thisse et al., 1993
) and
CLGY75/sox19 (B. Thisse, S. Pflumio, M. Fürthauer, B. Loppin, V.
Heyer, A. Degrave, R. Woehl, A. Lux, T. Steffan, X. Q. Charbonnier, and C.
Thisse, unpublished). CLGY183 and CLGY375 had been mapped to unfinished
scaffold sequence but show the correct pattern. CLGY75 was mapped to finished
sequence, but the insertion is found 14 kb downstream of the sox19
transcriptional unit. Nevertheless, the endogenous RNA pattern is virtually
the same as the reporter expression of the transgenic line. Likewise, CLGY11
is an insertion over 30 kb upstream of the otx1l transcriptional
unit, yet the patterns shown here are closely matching
(Fig. 3).
|
By contrast, CLGY298 (Fig.
4), which is located in finished sequence, does not resemble the
expression pattern of either of the two genes flanking it (not shown). The
gene it is closest to, ube2h, is broadly expressed throughout the
embryo (H.K. and T.S.B., unpublished), whereas nrf1, about 15 kb away
on the other side, is expressed throughout the central nervous system
(Becker et al., 1998
). Reporter
expression in CLGY298, however, is found in sensory neurons in the olfactory
placodes, the trigeminal ganglia, the inner ear, the lateral line, the spinal
cord and the retina, and continues to be expressed there at least up to day 10
(Fig. 4; not shown). There are
also three genes encoding miRNAs between nrf1 and ube2h,
which are conserved from human to fish. These miRNAs are 11, 10 and 9.8 kb
from CLGY298. The corresponding genomic region contains many transcriptional
units, and perhaps the basal promoter in the integrated provirus is driven by
enhancers other than the ones of the two flanking genes, for instance
plexin A4 (plxna4 Zebrafish Information Network)
maps far downstream of nrf1 and is expressed in primary sensory
neurons (Miyashita et al.,
2004
). We conclude that in the majority of our enhancer detection
lines the reporter expression is closely matching the endogenous pattern of a
nearby gene, but there can be exceptions where the pattern can be that of a
gene that is not the closest to the insertion. However, in three cases
described here, CLGY35/pou5f1, CLGY75/sox19 and
CLGY128/foxd5, the expression pattern of the other candidate gene is
not known and it is possible that both genes are regulated by the same
enhancer(s), forming what has been termed a regulatory landscape
(Spitz et al., 2003
).
Allelic integrations
Wu et al. have reported that of the 903 MLV randomly sequenced integrations
in the human genome, no integration hot spots had been observed, concluding
that the resolution of this number of integrations may not allow the
observation of obvious integration preferences of MLV vectors. We have
screened an estimated 800 insertions in the zebrafish genome, and of 65
activated insertions mapped here, four loci were hit twice: CLGY4/162,
CLGY24/35, CLGY131/372 and CLGY185/198
(Table 1). CLGY4 and CLGY162
are 5649 bp and 3001 bp downstream of the last exon of apoeb,
CLGY24/35 are insertions 3153 bp and 8084 bp upstream of pou5f1, and
CLGY131/372 are insertions 2675 bp and 743 bp upstream of the start codon of
ccnd1, a G1/S-specific cyclin. The CLGY185/198 alleles represent
integrations 4902 bp and 3988 bp upstream of the hoxc8a gene
(Table 1) Each of these allelic
pairs of integrations have very similar if not identical expression patterns
(Fig. 2), suggesting that in
each case, the integrations have landed in an area controlled by the same
enhancer(s). It is striking that in each of the five cases the integrations
are close to a gene in a somewhat restricted area. It is not clear whether
these genomic locations represent areas in the zebrafish genome that are more
accessible to viral integration, or whether the selection for activated
insertions biases towards identifying integrations in regions with a higher
probability of activation. We conclude that it is possible that MLV vectors do
have preferred integration regions with respect to where in or around a gene
the insertion occurs. Certainly, our screen creates a bias towards
integrations that will be expressed, and therefore around genes that have
certain types of enhancers (or around the enhancers themselves), but higher
numbers of insertions are required to resolve this issue.
Integrations in a gene desert
We identified four integrations in a genomic region on chromosome 20
spanning a 320 kb interval without known or predicted genes, flanked on one
side by a novel transcript, a putative orthologue to human allantoicase (ALLC,
ENSDART00000033971) and on the other side by the zebrafish sox11b
gene. We observed that these insertions exhibit very similar expression
patterns in olfactory placodes, dorsal telencephalon and hindbrain
(Table 1 and
Fig. 2; CLGY22, CLGY65, CLGY205
and CLGY368). The sites of expression of sox11b at 24 hpf include the
telencephalon and hindbrain (Rimini et
al., 1999
; De Martino et al.,
2000
), while the expression pattern for the novel zebrafish
transcript, to which CLGY205 is closer than to sox11b, is not known.
CLGY205 is the insertion farthest from sox11b (roughly 222kb), and
there are fewer cells expressing YFP in the telencephalon and hindbrain in
CLGY205 compared with the other three insertions. A gene desert is also found
on human chromosome 2 upstream of SOX11, and an ultra conserved
region (UCR) was mapped to this region
(Sandelin et al., 2004
;
Woolfe et al., 2005
). This UCR
maps 89 kb upstream of sox11b, and CLGY205 is therefore farthest away
from it. Whether this UCR contains the enhancer responsible for reporter gene
expression in these four insertions, however, remains to be seen. Regardless
of this, these cases demonstrate that our methodology will be useful to
identify vertebrate gene deserts that contain strong enhancers.
|
| Discussion |
|---|
|
|
|---|
The integration preferences of MLV-derived viruses in the human genome were
described by Wu et al. (Wu et al.,
2003
), showing a certain tendency of MLV to integrate close to
transcription start sites of genes. About 34% of mapped MLV integrations had
occurred in RefSeq genes, while a further 11.2% integrated within 5 kb
upstream of genes (Wu et al.,
2003
). However, in our study, only about one in eight integrations
were activated, suggesting that either these vectors integrate into genes less
frequently in the zebrafish genome, or, most likely, that not all integrations
into genes are expressed during embryogenesis. Similar to MLV vectors,
P-elements preferentially integrate into 5' regions of genes in
Drosophila (Bellen,
1999
), but P-element mediated enhancer detection has a frequency
of activation five times higher than in our study
(Bellen, 1999
;
Bier et al., 1989
;
Wilson et al., 1989
;
O'Kane and Gehring, 1987
).
Although the zebrafish genome harbors more genes, it is less compact than the
Drosophila genome, and therefore the lower enhancer detection
frequency might be a function of greater distances between genes, and
therefore between cis-regulatory elements. As we have shown here, many
activated insertions are within a 15 kb distance, typically less, from the
nearest gene, but whether this correlates with the `striking distance' of the
average enhancer is impossible to say as insertions might occur with higher
frequency around enhancer sequences. A glimpse of how such distances could be
estimated in the future is perhaps given by the four integrations in a gene
desert on chromosome 20. Although the three insertions closer to the
sox11b transcriptional unit have very similar expression patterns,
CLGY202, which is 215 kb upstream of the gene, exhibits much weaker
expression. A gene desert is also located upstream of the human SOX11
gene, and was recently found to contain ultra conserved elements
(Sandelin et al., 2004
;
Woolfe et al., 2005
). Whether
it is these elements that drive expression from the four integrations listed
here will have to be confirmed by experiment but the fact that interaction can
occur over such large distances suggests that genes with such elements are
large targets and may be overrepresented in future enhancer detection screens.
This may also be true for insertions into Hox clusters, which are
overrepresented in our screen. It is of concern for future large-scale screens
that four insertions out of 95 would have landed in the same gene desert;
however, an intense search for this pattern in our current screen has revealed
only one additional insertion in this gene desert in over 900 additional lines
screened (H.K. and T.S.B., unpublished).
A further eight out of 65 insertions listed in this paper are near genes
associated with UCRs, and these are the four hox insertions, CLGY5
(pax6.2), CLGY11 (otx1l), CLGY77 (TLE3) and CLGY375
(ptc1) (Sandelin et al.,
2004
; Woolfe et al.,
2005
). Among the other known genes in this paper, there are many
regulators of early development. Interestingly, the basal promoter used in
this study is of the gata2 gene, which is itself an early
developmental regulator and is associated with UCRs
(Sandelin et al., 2004
).
Whether the choice of promoter has any bearing on the types of genes
identified in enhancer detection screens, however, remains to be seen.
In the absence of knowing the expression patterns of all candidate genes in
the vicinity of an insertion, we have used the gene closest to the insertion
to predict the specificity of the cis-regulatory element(s) driving expression
of the YFP reporter. This is an approximation, owing to current limited
knowledge of the location of cis-regulatory sequences, and we have shown that
this is not always correct. For example CLGY75 is 14 kb upstream of
sox19 but is closer to another gene (ENSDARG00000034116), yet
displays the expression pattern of sox19
(Fig. 3). It is, however,
possible that both genes are regulated by the same sequences, similar to the
hoxd regulatory landscape described by Spitz et al.
(Spitz et al., 2003
). There is
also a detection event not resembling the expression patterns of genes located
on either side of it: CLGY298 shows a very specific expression pattern in
sensory placodes, but the closest gene, ube2h, has a much more
widespread expression pattern (H.K. and T.S.B., unpublished), and the next
gene on the other side, nrf1, also shows a different expression
pattern (Becker et al., 1998
).
To further complicate matters, there are also three miRNAs between these two
genes, and plexin A4, far beyond nrf1, has an expression
pattern reminiscent of CLGY298 (Miyashita
et al., 2004
).
In this case, a possible explanation might be that the basal promoter of our vector is not compatible with the enhancers of the neighboring genes, and/or is activated by different regulatory elements, for example those of plexin A4.
Based on genomic mapping, two of the integrations reported here could
disrupt gene expression: CLGY8 and CLGY69 have occurred into an exon and
3'UTR, respectively. Furthermore, seven of the transgenic lines carry
insertions within the first 2 kb upstream of the transcript and another five
are located in the 1st intron (Table
1, Fig. 4),
locations with a tendency to be mutagenic as shown in insertional genetic
screens in zebrafish (Amsterdam,
2003
; Amsterdam et al.,
1999
). So far one of these (CLGY375, ptc1) has turned out
to be homozygous lethal (S.E. and T.S.B., unpublished). By cloning the
flanking sequences and by mapping of activated insertions to the genome, one
can predict the potential mutagenicity of the insertion before screening for
phenotypes, including subtle and non-lethal adult phenotypes that would be
missed in a conventional phenotype-driven screen. However, based on our
numbers, we estimate that only 5-10% of enhancer detection insertions will
result in disruption of gene function, and these will not necessarily have a
detectable phenotype.
We have shown here that many insertions can be mapped to the zebrafish
genome sequence, rapidly generating candidate genes whose expression patterns
can be compared with that of the enhancer detection line. Our forward screen
makes it feasible to assign expression profiles and function to large numbers
of genomic loci and associated novel and predicted transcripts, as well as
putative cis-regulatory sequences, in particular the recently identified UCRs.
About 1.7% of the human genome are conserved non-genic sequences (CNGs;
Dermitzakis et al., 2005
). A
subset of these probably have cis-regulatory function during embryonic
development and can be identified by sequence conservation and tested through
transgenic approaches (e.g. Nobrega et
al., 2003
; Woolfe et al.,
2005
). However, not all regulatory sequences are highly conserved,
and our approach represents the first systematic attempt to characterize
genomic regions for their cis-regulatory activity in any vertebrate
species.
Collections of transgenic lines with similar or overlapping expression
patterns can serve as a starting point for characterization of developmental
signaling pathways in particular tissues or organs for isolation and testing
of cis-regulatory sequences that confer similar or identical expression
patterns. In Drosophila, a major breakthrough of P-element mediated
enhancer detection was the establishment of specific markers for tissues that
had been previously difficult to visualize
(Bellen, 1999
;
Bier et al., 1989
;
Wilson et al., 1989
;
O'Kane and Gehring, 1987
).
Retroviral vector mediated enhancer detection in the zebrafish opens up the
possibility of studying cellular origin and lineages in any tissues and
organs. For example, the vertebrate brain is made up of a large number of
different neurons of which many are not well described. With the large number
of transgenic lines that can be generated using this approach it should be
possible in the future to label a large part of the different categories of
neurons present in the vertebrate brain.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/132/17/3799/DC1
* Present address: EMBL, Developmental Biology Programme, Meyerhofstrasse1,
69117 Heidelberg, Germany ![]()
Present address: Institute for Biomedicine, University of Bergen, Jonas
Lies Vei 91, 5008 Bergen, Norway ![]()
| REFERENCES |
|---|
|
|
|---|
Amsterdam, A. (2003). Insertional mutagenesis in zebrafish. Dev. Dyn. 228,523 -534.[CrossRef][Medline]
Amsterdam, A., Burgess, S., Golling, G., Chen, W., Sun, Z.,
Townsend, K., Farrington, S., Haldi, M. and Hopkins, N.
(1999). A large-scale insertional mutagenesis screen in
zebrafish. Genes Dev.
13,2713
-2724.
Amsterdam, A., Nissen, R. M., Sun, Z., Swindell, E. C.,
Farrington, S. and Hopkins, N. (2004.). Identification
of 315 genes essential for early zebrafish development. Proc. Natl.
Acad. Sci. USA 101,12792
-12797.
Austin, C. P. and Cepko, C. L. (1994). Retrovirus mediated gene transduction into the vertebrate CNS. Gene Ther. 1,S6 -S9.
Balciunas, D., Davidson, A. E., Sivasubbu, S., Hermanson, S. B., Welle, Z. and Ekker, S. C. (2004). Enhancer trapping in zebrafish using the Sleeping Beauty transposon. BMC Genomics 5,62 .[CrossRef][Medline]
Bayer, T. A. and Campos-Ortega, J. A. (1992). A transgene containing lacZ is expressed in primary sensory neurons in zebrafish. Development 115,421 -426.[Abstract]
Becker, T. S., Burgess, S. M., Amsterdam, A. H., Allende, M. L. and Hopkins, N. (1998). Not really finished is crucial for development of the zebrafish outer retina and encodes a transcription factor highly homologous to Nuclear Respiratory Factor-1 and avian Initiation Binding Repressor. Development 125,4369 -4378.[Abstract]
Bellen, H. J. (1999. Ten years of enhancer
detection: lessons from the fly. Plant Cell
11,2271
-2281.
Bier, E., Vaessin, H., Shepherd, S., Lee, K., McCall, K.,
Barbel, S., Ackerman, L., Carretto, R., Uemura, T., Grell, E. et
al. (1989). Searching for pattern and mutation in the
Drosophila genome with a P-lacZ vector. Genes Dev.
3,1273
-1287.
Burgess, S., Reim, G., Chen, W., Hopkins, N. and Brand, M. (2002). The zebrafish spiel-ohne-grenzen spg. gene encodes the POU domain protein Pou2 related to mammalian Oct4 and is essential for formation of the midbrain and hindbrain, and for pre-gastrula morphogenesis. Development 129,905 -916.
Burns, J. C., Friedmann, T., Driever, W., Burrascano, M. and
Yee, J. K. (1993). Vesicular stomatitis virus G glycoprotein
pseudotyped retroviral vectors: concentration to very high titer and efficient
gene transfer into mammalian and nonmammalian cells. Proc. Natl.
Acad. Sci. USA 90,8033
-8037.
Chen, W., Burgess, S., Golling, G., Amsterdam, A. and Hopkins, N. (2002). High-throughput selection of retrovirus producer cell lines leads to markedly improved efficiency of germ line-transmissible insertions in zebra fish. J. Virol. 765,2192 -2198.
Concordet, J. P., Lewis, K. E., Moore, J. W., Goodrich, L. V., Johnson, R. L., Scott, M. P. and Ingham, P. W. (1996). Spatial regulation of a zebrafish patched homologue reflects the roles of sonic hedgehog and protein kinase A in neural tube and somite patterning. Development 122,2835 -2846.[Abstract]
De Martino, S., Yan, Y.-L., Jowett, T., Postlethwait, J. H., Varga, Z., Ashworth, A. and Austin, C. A. (2000). Expression of sox11 gene duplicates in zebrafish suggests the recriprocal loss of ancestral gene expression patterns in development. Dev. Dyn. 217,279 -292.[CrossRef][Medline]
Dermitzakis, E. T., Reymond, A. and Antonarakis, S. E. (2005). Conserved non-genic sequencesan unexpected feature of mammalian genomes. Nat. Rev. Genet 6, 151-157.[CrossRef][Medline]
Frankel, W., Potter, T. A., Rosenberg, N., Lenz, J. and Rajan,
T. V. (1985). Retroviral insertional mutagenesis of a target
allele in a heterozygous murine cell line. Proc. Natl. Acad. Sci.
USA 82,6600
-6604.
Gaiano, N., Allende, M., Amsterdam, A., Kawakami, K. and
Hopkins, N. (1996a). Highly efficient germ-line transmission
of proviral insertions in zebrafish. Proc. Natl. Acad. Sci.
USA 93,7777
-7782.
Gaiano, N., Amsterdam, A., Kawakami, K., Allende, M., Becker, T. and Hopkins, N. (1996b). Insertional mutagenesis and rapid cloning of essential genes in zebrafish. Nature 383,829 -832.[CrossRef][Medline]
Grabher, C., Henrich, T., Sasado, T., Arenz, A., Furutani-Seiki, M. and Wittbrodt, J. (2003). Transposon-mediated enhancer trapping in medaka. Gene 322, 57-66.[CrossRef][Medline]
Hauptmann, G., Söll, I. and Gerster, T. (2002). The early embryonic zebrafish forebrain is subdivided into molecularly distinct transverse and longitudinal domains. Brain Res. Bull. 57,371 -375.[CrossRef][Medline]
Houart, C., Caneparo, L., Heisenberg, C. P., Barth, K. A., Take-uchi, M. and Wilson, S. W. (2002). Establishment of the telencephalon during gastrulation by local antagonism of Wnt signaling. Neuron 35,255 -265.[CrossRef][Medline]
Jahner, D. and Jaenisch, R. (1985). Retrovirus-induced de novo methylation of flanking host sequences correlates with gene inactivity. Nature 315,594 -597.[CrossRef][Medline]
Jahner, D., Stuhlmann, H., Stewart, C. L., Harbers, K., Lohler, J., Simon, I. and Jaenisch, R. (1982). De novo methylation and expression of retroviral genomes during mouse embryogenesis. Nature 298,623 -628.[CrossRef][Medline]
Jowett, T. and Lettice, L. (1994). Whole-mount in situ hybridizations on zebrafish embryos using a mixture of digoxigenin- and fluorescein-labelled probes. Trends Genet. 10, 73-74.[CrossRef][Medline]
Korn, R., Schoor, M., Neuhaus, H., Henseling, U., Soininen, R., Zachgo, J. and Gossler, A. (1992). Enhancer trap integrations in mouse embryonic stem cells give rise to staining patterns in chimaeric embryos with a high frequency and detect endogenous genes. Mech. Dev. 39,95 -109.[CrossRef][Medline]
Lin, S., Gaiano, N., Culp, P., Burns, J. C., Friedmann, T., Yee,
J. K. and Hopkins, N. (1994). Integration and
germ-line transmission of a pseudotyped retroviral vector in zebrafish.
Science 265,666
-669.
Linney, E., Hardison, N. L., Lonze, B. E., Lyons, S. and DiNapoli, L. (1999). Transgene expression in zebrafish: A comparison of retroviral-vector and DNA-injection approaches. Dev. Biol. 213,207 -216.[CrossRef][Medline]
Meng, A., Tang, H., Ong, B. A., Farrell, M. J. and Lin, S.
(1997). Promoter analysis in living zebrafish embryos identifies
a cis-acting motif required for neuronal expression of GATA-2.
Proc. Natl. Acad. Sci. USA
94,6267
-6272.
Miyashita, T., Yeo, S. Y., Hirate, Y., Segawa, H., Wada, H.,
Little, M. H., Yamada, T., Takahashi, N. and Okamoto, H.
(2004). PlexinA4 is necessary as a downstream target of Islet2 to
mediate Slit signaling for promotion of sensory axon branching.
Development 131,3705
-3715.
Naviaux, R. K., Costanzi, E., Haas, M. and Verma, I. M.
(1996). The pCL vector system: rapid production of helper-free,
high-titer, recombinant retroviruses. J. Virol.
70,5701
-5705.
Nobrega, M. A., Ovcharenko, I., Afzal, V. and Rubin, E. M.
(2003). Scanning human gene deserts for long-range enhancers.
Science 302,413
.
Nornes, S., Clarkson, M., Mikkola, I., Pedersen, M., Bardsley, A., Martinez, J. P., Krauss, S. and Johansen, T. (1998). Zebrafish contains two pax6 genes involved in eye development. Mech. Dev. 77,185 -196.[CrossRef][Medline]
O'Kane, C. J. and Gehring, W. J. (1987).
Detection in situ of genomic regulatory elements in Drosophila.
Proc. Natl. Acad. Sci. USA
84,9123
-9127.
Parinov, S., Kondrichin, I., Korzh, V. and Emelyanov, A. (2004). Tol2 transposon-mediated enhancer trap to identify developmentally regulated zebrafish genes in vivo. Dev. Dyn. 231,449 -459.[CrossRef][Medline]
Pfeifer, A. and Verma, I. M. (2001). Gene therapy: promises and problems. Annu. Rev. Genom. Hum. G 2,177 -211.
Prince, V. E., Joly, L., Ekker, M. and Ho, R. K. (1998). Zebrafish hox genes: genomic organization and modified colinear expression patterns in the trunk. Development 125,407 -420.[Abstract]
Rimini, R., Beltrame, M., Argenton, F., Szymczak, D., Cotelli, F. and Bianchi, M. (1999). Expression patterns of zebrafish sox11A, sox11B and sox21. Mech. Dev. 89,167 -171.[CrossRef][Medline]
Sandelin, A., Bailey, P., Bruce, S., Engstrom, P. G., Klos, J. M., Wasserman, W. W., Ericson, J. and Lenhard. B. (2004). Arrays of ultraconserved non-coding regions span the loci of key developmental genes in vertebrate genomes. BMC Genomics 21,99 .
Sanes, J. R. (1989). Analysing cell lineage with a recombinant retrovirus. Trends Neurosci. 12, 21-28.[CrossRef][Medline]
Schroeder, M. D., Pearce, M., Fak, J., Fan, H., Unnerstall, U., Emberly, E., Rajewsky, N., Siggia, E. D. and Gaul, U. (2004). Transcriptional Control in the Segmentation Gene Network of Drosophila. PLoS Biol. 29, e271.
Spitz, F., Gonzalez, F. and Duboule, D. (2003). A global control region defines a chromosomal regulatory landscape containing the HoxD cluster. Cell 113,405 -417.[CrossRef][Medline]
Spradling, A. C., Stern, D., Beaton, A., Rhem, E. J., Laverty,
T., Mozden, N., Misra, S. and Rubin, G. M. (1999). The
Berkeley Drosophila Genome Project gene disruption project: Single P-element
insertions mutating 25% of vital Drosophila genes.
Genetics 153,135
-177.
Thisse, B., Pflumio, S., Fürthauer, M., Loppin, B., Heyer, V., Degrave, A., Woehl, R., Lux, A., Steffan, T., Charbonnier, X.Q. and Thisse, C. (2001). Expression of the zebrafish genome during embryogenesis. ZFIN Direct Data Submission Unpublished.
Thisse, C., Thisse, B., Schilling, T. F. and Postlethwait, J. H. (1993). Structure of the zebrafish snail1 gene and its expression in wild-type, spadetail and no tail mutant embryos. Development 119,1203 -1215.[Abstract]
Wilson, C., Pearson, R. K., Bellen, H. J., O'Kane, C. J.,
Grossniklaus, U. and Gehring, W. J. (1989).
P-element-mediated enhancer detection: an efficient method for isolating and
characterizing developmentally regulated genes in Drosophila. Genes
Dev. 3,1301
-1313.
Woolfe, A., Goodson, M., Goode, D. K., Snell, P., McEwen, G. K., Vavouri, T., Smith, S. F., North, P., Callaway, H., Kelly, K. et al. (2005). Highly conserved non-coding sequences are associated with vertebrate development. PLoS Biol. 3, e7.[CrossRef][Medline]
Wu, X., Li, Y., Crise, B. and Burgess, S. M.
(2003). Transcription start regions in the human genome are
favored targets for MLV integration. Science
300,1749
-1751.
This article has been cited by other articles:
![]() |
J. L. Brown, M. Snir, H. Noushmehr, M. Kirby, S.-K. Hong, A. G. Elkahloun, and B. Feldman Transcriptional profiling of endogenous germ layer precursor cells identifies dusp4 as an essential gene in zebrafish endoderm specification PNAS, August 26, 2008; 105(34): 12337 - 12342. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Feitsma and E. Cuppen Zebrafish as a Cancer Model Mol. Cancer Res., May 1, 2008; 6(5): 685 - 694. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nagayoshi, E. Hayashi, G. Abe, N. Osato, K. Asakawa, A. Urasaki, K. Horikawa, K. Ikeo, H. Takeda, and K. Kawakami Insertional mutagenesis by the Tol2 transposon-mediated enhancer trap approach generated mutations in two developmental genes: tcf7 and synembryn-like Development, January 1, 2008; 135(1): 159 - 169. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. G. Engstrom, S. J. Ho Sui, O. Drivenes, T. S. Becker, and B. Lenhard Genomic regulatory blocks underlie extensive microsynteny conservation in insects Genome Res., December 1, 2007; 17(12): 1898 - 1908. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kikuta, M. Laplante, P. Navratilova, A. Z. Komisarczuk, P. G. Engstrom, D. Fredman, A. Akalin, M. Caccamo, I. Sealy, K. Howe, et al. Genomic regulatory blocks encompass multiple neighboring genes and maintain conserved synteny in vertebrates Genome Res., May 1, 2007; 17(5): 545 - 555. [Abstract] [Full Text] [PDF] |