|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 8 December 2004
doi: 10.1242/dev.01578
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Developmental Neurobiology Group, Temasek Life Sciences Laboratory, 1 Research
Link, Singapore 117604, Rep. of Singapore
2 Max Planck Institute for Developmental Biology, Spemannstrasse 35, 72076
Tübingen, Germany
3 Pharmazentrum Frankfurt, Klinikum der Johann Wolfgang Goethe-Universität
Frankfurt, 60590 Frankfurt, Germany
* Author for correspondence (e-mail: suresh{at}tll.org.sg)
Accepted 29 October 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Retinotectal projection, Topographic mapping, Fasciculation, Axon branching, Visual system, Zebrafish
| Introduction |
|---|
|
|
|---|
There are a number of complexities in the establishment of the retinotectal
projection that remain poorly understood. Axons that grow to the posterior
tectum encounter large changes in the absolute concentration of graded cues,
but are still able to interpret small differences across the width of the
growth cone. How is this possible? In chemotaxing bacteria, adaptation to
changes in absolute concentration involves cyclical desensitization and
resensitization to the cue. Growth cones also are capable of this behavior
(Ming et al., 2002
).
Desensitization may occur via ubiquitin-mediated protein degradation, while
resensitization requires localized protein synthesis
(Campbell and Holt, 2001
); the
molecular details of this process remain unclear. Other questions revolve
around how a retinal growth cone is able to arborize at the correct location.
In the zebrafish, axons grow to their target position without branching. They
then stop and arborize. There must be some mechanism that correlates
positional information in retinal axons with gradient information present on
the tectum to produce a change in cellular behavior.
In an effort to better understand the processes involved, a large-scale
genetic screen has been carried out in the zebrafish
(Baier et al., 1996
). One
mutant with aberrant topographic mapping isolated in this screen is
esrom (Karlstrom et al.,
1996
; Trowe et al.,
1996
). We report here the positional cloning of esrom,
and analysis of its function in retinal axons. It has previously been
suggested that esrom could encode a component of the cytoskeleton
(Odenthal et al., 1996
). We
show here that Esrom is a large protein that affects regulation of the tumor
suppressor Tuberin. Based on its properties, we propose that Esrom is involved
in the interpretation of cues that mediate topographic map formation.
| Materials and methods |
|---|
|
|
|---|
DiI/DiD labeling
DiI or DiD (Molecular Probes) was dissolved in chloroform, loaded into
pulled glass capillaries and injected into specific regions of the eye using a
gas pressure injector. The position of injection was confirmed by confocal
microscopy of the eye, and only embryos with non-overlapping label were used
for further analysis. The retinotectal projection was imaged using confocal
microscopy with a 20x water immersion objective; z stacks were
deconvolved using Auto-Deblur (AutoQuant Imaging).
Eye transplantation
Transplantations were carried out as described previously
(Wagle et al., 2004
).
Retinal cultures
Two-day-old embryos were genotyped on the basis of their pigmentation
phenotype. Retinae were then isolated, fragmented, placed in glass-bottom
culture dishes coated with polylysine and laminin, and grown in L15 medium
supplemented with BSA and N1 (Sigma)
(Wagle et al., 2004
). Both
mutant and wild-type explants were placed in different regions of the same
dish.
To assess fasciculation, cultures were grown for 24 hours at 28°C. Eight clumps from three different cultures were imaged with a 20x phase objective, using a 12-bit Hammamatsu Orca-II camera on a Leica DM-IRBE microscope. Analysis was carried out with MetaMorph (Universal Imaging). Axons were examined at a distance of 50 µm from the periphery of the clump; the region tool was used to create a line at this distance. The number of single axon and bundles intersecting this line was counted manually. Bundles were defined as two or more axons growing together for a distance of at least 25 µm in the vicinity of the position of assessment. An outgrowth was judged to be a single axon when its width was eight units or less, and the change in intensity relative to background was less than 80 units. These parameters were measured with the linescan function. The ratio of bundles to single axons was calculated for each clump, to correct for any bias due to different clump size.
Mapping and positional cloning
esrte50, esrte75, and
esrtno7b heterozygotes in the AB background were crossed
to the WIK strain. The resulting progeny were used as parents for
self-crossing and generating haploids. DNA from 3-day-old mutant embryos was
extracted in 25 µl TE containing 1.8 mg/ml Proteinase K, which was
incubated at 55°C for 6 hours. The total volume in each well was made up
to 100 µl. From this, 2.5 µl was used as template for 10 µl PCR
reactions. SSLP and SSCP polymorphisms were used for fine-mapping, and a total
of 1286 meioses were screened. SSCPs were detected as described
(Foemzler and Beier, 1999
).
The PCR product (4 µl) was run on 8% non-denaturing PAGE, which was then
developed by silver staining. The zebrafish genomic PAC library created by
Chris Amemiya in the pCYPAC6 vector (German Genome Resource Center) was used
for the chromosome walk. PCR-based screening of library number 706 with Z6663,
fa97c06, fc50b12 and fj33d03 identified six PAC clones. DNA from these clones
was isolated using the Qiagen large-construct kit. Insert ends were sequenced
using SP6 and T7 primers. These sequences were then used for walking and
building a genomic contig spanning esrom. Similarly, a zebrafish BAC
library from Inctye Genomics (in the pBeloBAc11vector) was also screened by
PCR to isolate clones that were not represented in the PAC library. The contig
was shotgun sequenced at the Sanger Center.
Primer pairs used for mapping were: Z6663, CATCTTCATTGCCCAGCC (forward) and ATAGGAGCCCATCTGCACAC (reverse); Z7813, AATTCAATTAGGGCCAGGCT (forward) and ATGCGTGAACCATTACTGCA (reverse); fa97c06, AAAAATTTCCGATTCTGTGAAGG (forward) and ACAAATCTCCTACTTCGCCACAC (reverse); fj33d03, AGAGACCGCGCTTAATAAATCA (forward) AATATGCCGATGGCTAAAACC (reverse).
Gene knockdown by morpholino
Morpholino 1 (CACAGGACTCACTGATGATATGAAGG) was targeted to disrupt the
splicing of the first exon within the RCC1 domain, while morpholino 2
(TTATTACTTACAGCAGCCATGTCTT) was designed to target the exon at amino acid
4080, which falls between the Myc-type dimerization domain and B-box zinc
finger. Splice sites were predicted by comparison to the human genome. A
control morpholino (CCTCTTACCTCAGTTACAATTTATA) and the control provided by
Gene Tools were also used. Morpholinos were injected into one-cell stage
zebrafish wild-type embryos. Three-day old embryos were screened for the
xanthophore phenotype of esrom and fixed the next day in 4%
paraformaldehyde at 4°C overnight. These embryos were mounted in 1.5%
low-melting temperature agarose and the anterior eyes were labeled with DiI.
For RT-PCR, RNA was extracted from 2.5-day-old embryos and the RT reaction was
carried using an oligo dT primer. The cDNA was PCR amplified using a forward
primer in the normal transcript and reverse primer designed within the
intronic region.
Cloning of esrom
RNA was extracted from 2- to 3-day-old wild-type zebrafish embryonic brain.
The 5' end of esrom was cloned using gene specific primer
GAAGAGGCAGGCGCAGGATAA for RT reaction followed by RACE with the SMARTTM
RACE cDNA amplification system (BD Biosciences). For cloning 13 kb of
esrom cDNA, 2 µg of RNA from 2- to 4-day-old wild-type zebrafish
embryo was used for reverse transcription reaction with Powerscript (BD
Biosciences) and threhalose. The RT product (2 µl) was used for
long-distance PCR with the Expand Long PCR template PCR system (Roche). The
primers used were TTTCACTTCGGCCAATTGAACGTGGTTGGATCGCCTGCAATCGGG (forward) and
GCCCTGGGCTTGAGCTGCAC (reverse).
E3 ligase assay
A 579 bp fragment bearing the RING domain was cloned in-frame with GST in
PGEX-4T2 between BamHI and NotI. The construct was
transformed in BL21 cells. Bacterial culture (50 ml) was induced at 37°C
with 1 mM IPTG for 4 hours. The cells were lysed in lysis buffer (50 mM
Tris-HCl pH 7.4, 2 mM EDTA, 0.1% Triton X-100, 1 M MgCl2, 0.1 M
MnCl2, 0.3 M PMSF). The protein was pulled down from the
supernatant using 200 µl of GST sepharose 4B beads (Amersham Pharmacia
Biotech). For the E3 ligase assay, 15 µl of the beads was incubated with
reaction buffer (20x is: 1 M Tris pH 7.5, 40 mM ATP, 100 mM
MgCl2, 40 mM DTT), 200 nM E1, 0.5 µM E2 and 8 µg Ubiquitin.
The reaction was incubated at 30°C for 3 hours and then loaded on 6% PAGE.
The western was performed using anti-Ubiquitin antibody and ECL detection
system.
Antibody specificity
One-hundred 48-hour-old embryos were homogenized and incubated overnight at
4°C in a protein extraction buffer (10 mM Tris pH 7.4, 2% Triton X-100, 1
mM PMSF, 1 mM aproptinin, 1 mM leupeptin, 1 mM trypsin inhibitor) and
centrifuged. The pellet was suspended in 150 ml of 2% SDS and run on a 5% SDS
PAGE. The proteins were blot transferred onto a PVDF membrane (BioRad) and
probed with the C terminus PAM antibody
(Guo et al., 1998
) and
developed using ECL. The C terminus end of esrom containing the
LDLRA, RING and the zinc finger was cloned in PGEX-4T and purified as above
and run on 8% SDS PAGE and the western was carried out using the same PAM
antibody.
A second antibody, made to amino acids 4601-4614 of human PAM
(Ehnert et al., 2004
), was
also used for immunofluorescence. Pre-absorption was carried out by incubating
the antibody with a peptide (CPAGPKGKQLEGSE) overnight at 4°C, followed by
centrifugation at 100,000 g for 30 minutes.
Zebrafish ESTs corresponding to human TSC2 (Zon Lab Comparative Genomics, http://www.tchlab.org) and assembly 2 of the zebrafish genome (http://www.sanger.ac.uk/Projects/D_rerio/) show 100% amino acid conservation over a 15 residue stretch containing the Ser939 Tuberin phosphorylation site (ESTs: zfishC-a2119f08.p1ca, zfishC-a2119f08.p1cz and zfish41364-379d12.q1c) (Sanger sequences: NA21443, NA442 and NA5028).
RNA in situ hybridization
The intra molecular PHR repeat region was cloned into pGEM-T (Promega). In
vitro transcribed DIG-labeled sense and antisense probes were synthesized in
vitro using T7 and SP6 RNA polymerase (Ambion). For fluorescence detection,
probes were detected using peroxidase-labeled anti-DIG antibody, followed by
tyramide signal amplification (Perkin Elmer) and incubation in 1:1000
AlexaFluor 594 streptavidin (Molecular Probes).
Immunofluorescence
Cultures were fixed in 4% formaldehyde, permeabilized in 0.1% Triton X-100
and blocked with 3% BSA. Incubation with primary antibody was carried out at
4°C overnight. Antibodies were used at the following concentrations:
anti-PAM (Guo et al., 1998
),
1:500; anti-PAM (Ehnert et al.,
2004
), 1:100; anti-Phospho-Tuberin (Ser939) (Cell Signaling
Technology), 1:100; mouse anti-
-tubulin (Sigma), 1:2000. The cultures
were washed several times in PBST and incubated with the appropriate secondary
antibody (AlexaFluor 546 anti-rabbit, AlexaFluor 488 anti-rabbit or AlexaFluor
568 anti-mouse). They were then washed five times to remove unbound
antibody.
Ligand binding assay
The membrane covering the lens of 4-day-old embryos was peeled off in PBS
buffer. Fish embryos were incubated for 90 minutes in HBHA (Hanks buffered
saline with 0.5 mg/ml BSA, 0.1% NaN3, 20 mM HEPES, pH 7.0)
containing 1 µg of zebrafish EphrinB2-human Fc chimera (R&D Systems).
They were then washed five times with HBHA and fixed in acetone formaldehyde
fixative. The embryos were washed four times with PBS pH 7.0 and blocked for 1
hour in PBST (containing 1% BSA and 0.1% Triton). Bound protein was detected
using Alexa Fluor 488 anti-human IgG.
Lipofection
A dual-cassette plasmid containing a Gal4-VP16 transcriptional activator
under the goldfish
-tubulin promoter and a tandem array of 14 UAS
elements with a fish basal promoter driving expression of an
Unc76-EGFP fusion was provided by the Fraser laboratory. The
T
1:Gal4 cassette was excised and subcloned into
pBluescript SKII, and the UAS cassette and plasmid backbone were
recircularized. The
-tubulin promoter was replaced with the
HuC promoter (Park et al.,
2000
). Lipofection procedures were based on that of
Xenopus (Holt et al.,
1990
). Larvae were mounted in agarose at 30-hours
post-fertilization and retinal cells were transfected by microinjection into
the neural retina of the two plasmids (300-400 ng/µl) in 20% Neuroporter
(Gene Therapy Systems).
Fluorescence imaging and quantitation
For fluorescently labeled embryos, samples were imaged with a Zeiss 510 LSM
confocal microscope, using water immersion objectives. Tectal arbors were
imaged with a 63x immersion objective. Measurements were made on
projections using NIH ImageJ. Arborization area is the area of the convex
polygon connecting axon tips to the first branch point. Maturity index is
according to Schmidt et al. (Schmidt et
al., 2004
) and is defined as the total number of axon tips divided
by highest order branch in that arbor (typically under 2.00 for immature
arbors, up to 4.00 for very bushy arbors). Arborization area is underestimated
owing to curvature of the tectum.
RGC cultures after antibody staining were imaged with a 20x phase
objective on a Zeiss LSM510 confocal. Analysis was done using MetaMorph
(Universal Imaging), Microsoft Excel and JMP IN (SAS Institute). Each channel
was thresholded independently, and the distal-most 20 µm of each clearly
individuated axon was traced, including any side branches or filopodia in this
region. Axons were selected for analysis in the bright-field image without
knowledge of genotype. Intensity of
-tubulin was used as a control for
the measurement technique, and showed a roughly normal distribution and no
differences between mutant and wild type. Statistical outliers (1.5xIQR
method) for
-tubulin threshold area or intensity were excluded from
analysis (seven out of 293 measurements). For combining data, intensity
measurements were normalized to the wild type mean in each experiment. Results
were the same for each individual experiment as for pooled data.
Phospho-Tuberin measurements were not normally distributed, and were
significantly different by Wilcoxon rank sum test (P<0.0001).
| Results |
|---|
|
|
|---|
|
|
|
|
The Esrom protein
Esrom is a multidomain protein (Fig.
4A) with potential leucine zippers LZ1 and LZ2, an unusual RCC1
(regulator of chromatin condensation)-like domain (674-1052) interrupted by a
basic rich region (BR), PHR repeat regions, filamin repeats (2335-2428), a
region similar to the Myc-binding region of PAM (truncated by 75 amino acids),
a histone-binding region (HHD), a serine-rich region (SR), a nuclear
localization sequence (3093-3112), a B-box zinc finger (4154-4199), a C3HC4
type RING zinc finger (4324-4375), a cytochrome heme binding region
(4513-4518), a LDLRA1 (low-density lipoprotein receptor class A) motif
(4302-4327) and a bHLH (basic helix-loop-helix) Myc type dimerization domain
(4021-4036).
|
, a RING protein with domain architecture similar to the Esrom C
terminus (Xu et al., 2003b
Localization of Esrom
The esrom gene is widely expressed when the visual system begins
developing, as determined by in situ hybridization
(Fig. 4D,E). In the eye,
esrom appears to be transcribed in all cells, including retinal
ganglion cells, with no obvious gradient
(Fig. 4F,G). To determine the
distribution of the Esrom protein, an antibody made to the highly conserved C
terminus of PAM (Guo et al.,
1998
) was used. This antibody, which binds to the C terminus of
Esrom (Fig. 4H), recognizes a
single high molecular weight zebrafish protein
(Fig. 4I). When used for
immunofluorescence, punctate label was detected in retinal ganglion cells,
including in lamellipodia and filopodia
(Fig. 4J-M). A second antibody
to PAM (Ehnert et al., 2004
)
also gave similar punctate labeling. When this antibody was pre-absorbed with
a peptide from the corresponding region of the zebrafish Esrom protein, a
reduction in fluorescence intensity was seen
(Fig. 4N,O). Taken together,
these data indicate that Esrom protein is present in retinal axons. The puncta
are similar to cytoplasmic bodies formed by other B-box and RING
finger-containing proteins and is likely to reflect supramolecular assemblies
formed by these domains (Borden et al.,
1996
; Kentsis et al.,
2002
). The localization of the Esrom protein suggests that it
functions in retinal ganglion cells, possibly in growth cones.
Branching in retinal axons
The Drosophila highwire mutant has increased branching of
motoneurons at the neuromuscular junction
(Wan et al., 2000
).
Surprisingly, esrom mutant retinal axons did not show increased
branching. This could be seen when individual retinal ganglion cells were
labeled by lipofection with an unc76-eGFP fusion construct
(Fig. 5A-C) and their arbors
measured. No difference could be detected between the tectal arborizations of
mutant and wild-type axons in terms of number of branches, area or maturity
index, a measure of arbor bushiness
(Schmidt et al., 2004
), at 4
days post-fertilization (Fig.
5D). Although the lipofection of RGCs was equally efficient in
mutants and wild type, tectal arbors often never appeared in esrom.
Whole-mount staining with the Zn8 antibody confirmed that fewer axons reach
the tectum (data not shown). Esrom is thus required to ensure that retinal
axons reach the tectum and that they branch in the appropriate position; it
does not regulate the amount of branching during map formation.
|
|
The region of Tuberin required for PAM interaction contains a conserved
serine (Ser939), which is phosphorylated by at least two distinct pathways.
Akt/PKB phosphorylates Ser939 as a result of activation of the PI(3)-kinase
pathway, as does RSK1 in response to protein kinase C (PKC) and MEK-dependent
signaling, though to a lesser extent than Akt
(Dan et al., 2002
;
Inoki et al., 2002
;
Manning et al., 2002
;
Potter et al., 2002
;
Tee et al., 2003a
;
Roux et al., 2004
). An
antibody specific to Ser939 Phospho-Tuberin revealed a heterogeneous
distribution in both wild-type and mutant retinal axons
(Fig. 7A). Many axons contained
an enrichment of Phospho-Tuberin in the most distal 10-20 µm, including
active and collapsed growth cones. In axon shafts, Phospho-Tuberin often
localized to large varicosities, branch points and at sites of inter-axonal
contact.
Because it appeared that mutant retinal explants showed intense focal
enrichments of Phospho-Tuberin antibody staining at axon tips
(Fig. 7), we focused on the
distal-most 20 µm of RGC axons and measured fluorescence intensity. As this
region varies from axon to axon in several morphological criteria, the
intensity of
-tubulin antibody staining was used as a measurement
control (see Materials and methods for quantitation details). Phospho-Tuberin
levels were found to be significantly higher in mutant axons
(Fig. 7C), while
-tubulin levels were similar.
| Discussion |
|---|
|
|
|---|
We observed that the tumor suppressor and intracellular signaling molecule Tuberin is misregulated in esrom mutant axons. Although Tuberin and its binding partner Hamartin are known to localize to axons and growth cones, it is not clear what role they play in axon growth and guidance. The elevated levels of Ser939-phosphorylated Tuberin could be explained in several ways. Although we currently lack the data to distinguish conclusively between these possibilities, each scenario predicts different effects on processes known to be downstream of Tuberin. In one scenario, Esrom could modulate signaling pathways upstream of Tuberin, in which case the hyperphosphorylation in mutants should lead to a decrease in Tuberin function and an increase in activitation of the TOR pathway. Alternatively, there may simply be more Tuberin in mutants, and thus a proportional increase in Phospho-Tuberin; this predicts an overabundance of functional Tuberin and a downregulation of the TOR pathway. Yet another possibility is that phosphorylated Tuberin is normally turned over rapidly, via dephosphorylation or degradation, for example; this process is disrupted in mutants. Because phosphorylated Tuberin can be functionally inhibited by mechanisms other than degradation, it is not clear what effects the accumulation of Phospho-Tuberin might have in this case.
It remains to be determined if the misregulation of Tuberin contributes to
the retinotectal phenotype observed in esrom mutants. The
best-characterized role of Tuberin is as a regulator of protein synthesis
(Inoki et al., 2003
;
Tee et al., 2003b
). The
localized translation of mRNAs is required for growth cone responses to
certain guidance cues, as well as for adaptive resensitization during
chemotaxis (Campbell and Holt,
2001
; Ming et al.,
2002
). Transcripts that have been found in axons of diverse
neuronal types include ß-actin and other cytoskeletal components
(Piper and Holt, 2004
), which
are key regulatory targets for axon guidance cues. EphA2, a receptor tyrosine
kinase involved in topographic mapping, has been shown to be under
translational regulation in axons as well
(Brittis et al., 2002
).
However, in addition to protein synthesis, Tuberin and Hamartin regulate other
cellular processes that could potentially affect axon guidance and
fasciculation.
Orthologs of Esrom have been recently implicated in seemingly diverse
processes. In C. elegans, RPM-1 forms an SCF-type E3 ligase complex
that may regulate an insulin superfamily receptor, anaplastic lymphoma kinase
(Liao et al., 2004
). In
Drosophila, Highwire binds the fly co-SMAD Medea and influences BMP
signaling (McCabe et al.,
2004
). Finally, in mammalian cells, the membrane localization of
PAM has been shown to be regulated by signaling downstream of G-protein
coupled receptors that recognize the phospholipid sphingosine 1-phosphate
(Pierre et al., 2004
). This is
essential for the potent and long-term inhibition of adenylate cyclase by PAM.
The ability of PAM to regulate adenylate cyclase
(Scholich et al., 2001
), which
is presumably shared by Esrom (as the RCC1 homology domain is conserved), is
particularly interesting, as cAMP levels are important modulators of growth
cone responses to guidance cues (Ming et
al., 1997
; Song et al.,
1997
).
In conclusion, by positional cloning and analysis of the zebrafish esrom mutant, we have identified a large protein with multiple domains, which is needed for the accurate response of retinal growth cone to cues in vivo. Growth cone navigation requires a complex network of interacting signal transduction pathways that affect diverse subcellular processes in highly dynamic and localized ways. It is interesting to speculate that the large size and multiple interactions of Esrom and its orthologs allow it to serve as a network hub that coordinates a set of signaling processes important in various neuronal contexts, including axon guidance, synaptic growth and neurophysiology. Esrom can perhaps be viewed as a microprocessor, enabling the simultaneous control of different processes in response to multiple inputs. In the case of the retinotectal projection, Esrom could be a component of a coincidence detector that matches position on the tectum to identity of the cell, helping the axon to grow and to branch where appropriate.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/132/2/247/DC1
| REFERENCES |
|---|
|
|
|---|
Astrinidis, A., Cash, T. P., Hunter, D. S., Walker, C. L., Chernoff, J. and Henske, E. P. (2002). Tuberin, the tuberous sclerosis complex 2 tumor suppressor gene product, regulates Rho activation, cell adhesion and migration. Oncogene 21,8470 -8476.[CrossRef][Medline]
Baier, H., Klostermann, S., Trowe, T., Karlstrom, R. O., Nusslein-Volhard, C. and Bonhoeffer, F. (1996). Genetic dissection of the retinotectal projection. Development 123,415 -425.[Abstract]
Borden, K. L., Lally, J. M., Martin, S. R., O'Reilly, N. J.,
Solomon, E. and Freemont, P. S. (1996). In vivo and in
vitro characterization of the B1 and B2 zinc-binding domains from the acute
promyelocytic leukemia protooncoprotein PML. Proc. Natl. Acad. Sci.
USA 93,1601
-1606.
Brittis, P. A., Lu, Q. and Flanagan, J. G. (2002). Axonal protein synthesis provides a mechanism for localized regulation at an intermediate target. Cell 110,223 -235.[CrossRef][Medline]
Burgess, R. W., Peterson, K. A., Johnson, M. J., Roix, J. J.,
Welsh, I. C. and O'Brien, T. P. (2004). Evidence for a
conserved function in synapse formation reveals Phr1 as a candidate gene for
respiratory failure in newborn mice. Mol. Cell. Biol.
24,1096
-1105.
Burrill, J. D. and Easter, S. S., Jr (1994). Development of the retinofugal projections in the embryonic and larval zebrafish (Brachydanio rerio). J. Comp. Neurol. 346,583 -600.[CrossRef][Medline]
Campbell, D. S. and Holt, C. E. (2001). Chemotropic responses of retinal growth cones mediated by rapid local protein synthesis and degradation. Neuron 32,1013 -1026.[CrossRef][Medline]
Dan, H. C., Sun, M., Yang, L., Feldman, R. I., Sui, X. M., Ou,
C. C., Nellist, M., Yeung, R. S., Halley, D. J., Nicosia, S. V. et
al. (2002). Phosphatidylinositol 3-kinase/Akt pathway
regulates tuberous sclerosis tumor suppressor complex by phosphorylation of
tuberin. J. Biol. Chem.
277,35364
-35370.
DiAntonio, A., Haghighi, A. P., Portman, S. L., Lee, J. D., Amaranto, A. M. and Goodman, C. S. (2001). Ubiquitination-dependent mechanisms regulate synaptic growth and function. Nature 412,449 -452.[CrossRef][Medline]
Draper, B. W., Morcos, P. A. and Kimmel, C. B. (2001). Inhibition of zebrafish fgf8 pre-mRNA splicing with morpholino oligos: a quantifiable method for gene knockdown. Genesis 30,154 -156.[CrossRef][Medline]
Ehnert, C., Tegeder, I., Pierre, S., Birod, K., Nguyen, H. V., Schmidtko, A., Geisslinger, G. and Scholich, K. (2004). Protein associated with Myc (PAM) is involved in spinal nociceptive processing. J. Neurochem. 88,948 -957.[Medline]
Foemzler, D. and Beier, D. (1999). Gene Mapping in Zebrafish Using Single-Strand Conformation Polymorphism Analysis. In The zebrafish: genetics and genomics, Vol.60 (ed. H. Detrich, M. Westerfield and L. Zon), San Diego, CA: Academic Press.
Fricke, C., Lee, J. S., Geiger-Rudolph, S., Bonhoeffer, F. and
Chien, C. B. (2001). astray, a zebrafish roundabout homolog
required for retinal axon guidance. Science
292,507
-510.
Furukawa, M., He, Y. J., Borchers, C. and Xiong, Y. (2003). Targeting of protein ubiquitination by BTB-Cullin 3-Roc1 ubiquitin ligases. Nat. Cell Biol. 5,1001 -1007.[CrossRef][Medline]
Guo, Q., Xie, J., Dang, C. V., Liu, E. T. and Bishop, J. M.
(1998). Identification of a large Myc-binding protein that
contains RCC1-like repeats. Proc. Natl. Acad. Sci. USA
95,9172
-9177.
Hindges, R., McLaughlin, T., Genoud, N., Henkemeyer, M. and O'Leary, D. D. (2002). EphB forward signaling controls directional branch extension and arborization required for dorsal-ventral retinotopic mapping. Neuron 35,475 -487.[CrossRef][Medline]
Holt, C. E., Garlick, N. and Cornel, E. (1990). Lipofection of cDNAs in the embryonic vertebrate central nervous system. Neuron 4,203 -214.[CrossRef][Medline]
Inoki, K., Li, Y., Zhu, T., Wu, J. and Guan, K. L. (2002). TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR signalling. Nat. Cell Biol. 4, 648-657.[CrossRef][Medline]
Inoki, K., Li, Y., Xu, T. and Guan, K. L.
(2003). Rheb GTPase is a direct target of TSC2 GAP activity and
regulates mTOR signaling. Genes Dev.
17,1829
-1834.
Jones, K. A., Jiang, X., Yamamoto, Y. and Yeung, R. S. (2004). Tuberin is a component of lipid rafts and mediates caveolin-1 localization: role of TSC2 in post-Golgi transport. Exp. Cell Res. 295,512 -524.[CrossRef][Medline]
Karlstrom, R. O., Trowe, T., Klostermann, S., Baier, H., Brand, M., Crawford, A. D., Grunewald, B., Haffter, P., Hoffmann, H., Meyer, S. U. et al. (1996). Zebrafish mutations affecting retinotectal axon pathfinding. Development 123,427 -438.[Abstract]
Kentsis, A., Gordon, R. E. and Borden, K. L.
(2002). Control of biochemical reactions through supramolecular
RING domain self-assembly. Proc. Natl. Acad. Sci. USA
99,15404
-15409.
Kleymenova, E., Ibraghimov-Beskrovnaya, O., Kugoh, H., Everitt, J., Xu, H., Kiguchi, K., Landes, G., Harris, P. and Walker, C. (2001). Tuberin-dependent membrane localization of polycystin-1: a functional link between polycystic kidney disease and the TSC2 tumor suppressor gene. Mol. Cell 7, 823-832.[CrossRef][Medline]
Krymskaya, V. P. (2003). Tumour suppressors hamartin and tuberin: intracellular signalling. Cell. Signal. 15,729 -739.[Medline]
Lamb, R. F., Roy, C., Diefenbach, T. J., Vinters, H. V., Johnson, M. W., Jay, D. G. and Hall, A. (2000). The TSC1 tumour suppressor hamartin regulates cell adhesion through ERM proteins and the GTPase Rho. Nat. Cell Biol. 2, 281-287.[CrossRef][Medline]
Le Guyader, S., Maier, J. and Jesuthasan, S. (2004). Esrom, an ortholog of PAM/Hiw/Rpm-1, regulates pteridine synthesis in the zebrafish. Dev. Biol. (in press).
Li, Y., Corradetti, M. N., Inoki, K. and Guan, K. L. (2004). TSC2: filling the GAP in the mTOR signaling pathway. Trends Biochem. Sci. 29,32 -38.[CrossRef][Medline]
Liao, E. H., Hung, W., Abrams, B. and Zhen, M. (2004). An SCF-like ubiquitin ligase complex that controls presynaptic differentiation. Nature 430,345 -350.[CrossRef][Medline]
Lorick, K. L., Jensen, J. P., Fang, S., Ong, A. M., Hatakeyama,
S. and Weissman, A. M. (1999). RING fingers mediate
ubiquitin-conjugating enzyme (E2)-dependent ubiquitination. Proc.
Natl. Acad. Sci. USA 96,11364
-11369.
Mann, F., Ray, S., Harris, W. and Holt, C. (2002). Topographic mapping in dorsoventral axis of the Xenopus retinotectal system depends on signaling through ephrin-B ligands. Neuron 35,461 -473.[CrossRef][Medline]
Manning, B. D., Tee, A. R., Logsdon, M. N., Blenis, J. and Cantley, L. C. (2002). Identification of the tuberous sclerosis complex-2 tumor suppressor gene product tuberin as a target of the phosphoinositide 3-kinase/akt pathway. Mol. Cell 10,151 -162.[CrossRef][Medline]
McCabe, B. D., Hom, S., Aberle, H., Fetter, R. D., Marques, G., Haerry, T. E., Wan, H., O'Connor, M. B., Goodman, C. S. and Haghighi, A. P. (2004). Highwire regulates presynaptic BMP signaling essential for synaptic growth. Neuron 41,891 -905.[CrossRef][Medline]
Ming, G. L., Song, H. J., Berninger, B., Holt, C. E., Tessier-Lavigne, M. and Poo, M. M. (1997). cAMP-dependent growth cone guidance by netrin-1. Neuron 19,1225 -1235.[CrossRef][Medline]
Ming, G. L., Wong, S. T., Henley, J., Yuan, X. B., Song, H. J., Spitzer, N. C. and Poo, M. M. (2002). Adaptation in the chemotactic guidance of nerve growth cones. Nature 417,411 -418.[CrossRef][Medline]
Murthy, V., Han, S., Beauchamp, R. L., Smith, N., Haddad, L. A.,
Ito, N. and Ramesh, V. (2004). Pam and its ortholog highwire
interact with and may negatively regulate the TSC1.TSC2 complex. J.
Biol. Chem. 279,1351
-1358.
Neumann, C. J. and Nuesslein-Volhard, C.
(2000). Patterning of the zebrafish retina by a wave of sonic
hedgehog activity. Science
289,2137
-2139.
Odenthal, J., Rossnagel, K., Haffter, P., Kelsh, R. N., Vogelsang, E., Brand, M., van Eeden, F. J., Furutani-Seiki, M., Granato, M., Hammerschmidt, M. et al. (1996). Mutations affecting xanthophore pigmentation in the zebrafish, Danio rerio. Development 123,391 -398.[Abstract]
Orike, N. and Pini, A. (1996). Axon guidance: following the Eph plan. Curr. Biol. 6, 108-110.[CrossRef][Medline]
Park, H. C., Kim, C. H., Bae, Y. K., Yeo, S. Y., Kim, S. H., Hong, S. K., Shin, J., Yoo, K. W., Hibi, M., Hirano, T. et al. (2000). Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic zebrafish with fluorescent neurons. Dev. Biol. 227,279 -293.[CrossRef][Medline]
Pierre, S. C., Hausler, J., Birod, K., Geisslinger, G. and Scholich, K. (2004). PAM mediates sustained inhibition of cAMP signaling by sphingosine-1-phosphate. EMBO J. 23,3031 -3040.[CrossRef][Medline]
Piper, M. and Holt, C. (2004). RNA Translation in Axons. Annu. Rev. Cell Dev. Biol. 20,505 -523.[CrossRef][Medline]
Potter, C. J., Pedraza, L. G. and Xu, T. (2002). Akt regulates growth by directly phosphorylating Tsc2. Nat. Cell Biol. 4,658 -665.[CrossRef][Medline]
Roux, P. P., Ballif, B. A., Anjum, R., Gygi, S. P. and Blenis,
J. (2004). Tumor-promoting phorbol esters and activated Ras
inactivate the tuberous sclerosis tumor suppressor complex via p90 ribosomal
S6 kinase. Proc. Natl. Acad. Sci. USA
101,13489
-13494.
Sakurai, T., Wong, E., Drescher, U., Tanaka, H. and Jay, D.
G. (2002). Ephrin-A5 restricts topographically specific
arborization in the chick retinotectal projection in vivo. Proc.
Natl. Acad. Sci. USA 99,10795
-10800.
Schaefer, A. M., Hadwiger, G. D. and Nonet, M. L. (2000). rpm-1, a conserved neuronal gene that regulates targeting and synaptogenesis in C. elegans. Neuron 26,345 -356.[CrossRef][Medline]
Schmidt, J. T., Fleming, M. R. and Leu, B. (2004). Presynaptic protein kinase C controls maturation and branch dynamics of developing retinotectal arbors: possible role in activity-driven sharpening. J. Neurobiol. 58,328 -340.[CrossRef][Medline]
Scholich, K., Pierre, S. and Patel, T. B.
(2001). Protein associated with Myc (PAM) is a potent inhibitor
of adenylyl cyclases. J. Biol. Chem.
276,47583
-47589.
Song, H. J., Ming, G. L. and Poo, M. M. (1997). cAMP-induced switching in turning direction of nerve growth cones. Nature 388,275 -279.[CrossRef][Medline]
Sperry, R. W. (1963). Chemoaffinity in the
orderly growth of nerve fiber patterns and connections. Proc. Natl.
Acad. Sci. USA 50,703
-710.
Tee, A. R., Anjum, R. and Blenis, J. (2003a).
Inactivation of the tuberous sclerosis complex-1 and -2 gene products occurs
by phosphoinositide 3-kinase/Akt-dependent and -independent phosphorylation of
tuberin. J. Biol. Chem.
278,37288
-37296.
Tee, A. R., Manning, B. D., Roux, P. P., Cantley, L. C. and Blenis, J. (2003b). Tuberous sclerosis complex gene products, Tuberin and Hamartin, control mTOR signaling by acting as a GTPase-activating protein complex toward Rheb. Curr. Biol. 13,1259 -1268.[CrossRef][Medline]
Trowe, T., Klostermann, S., Baier, H., Granato, M., Crawford, A. D., Grunewald, B., Hoffmann, H., Karlstrom, R. O., Meyer, S. U., Muller, B. et al. (1996). Mutations disrupting the ordering and topographic mapping of axons in the retinotectal projection of the zebrafish, Danio rerio. Development 123,439 -450.[Abstract]
Wagle, M., Grunewald, B., Subburaju, S., Barzaghi, C., le Guyader, S., Chan, J. and Jesuthasan, S. (2004). EphrinB2a in the zebrafish retinotectal system. J. Neurobiol. 59,57 -65.[CrossRef][Medline]
Wan, H. I., DiAntonio, A., Fetter, R. D., Bergstrom, K., Strauss, R. and Goodman, C. S. (2000). Highwire regulates synaptic growth in Drosophila. Neuron 26,313 -329.[CrossRef][Medline]
Xu, L., Wei, Y., Reboul, J., Vaglio, P., Shin, T. H., Vidal, M., Elledge, S. J. and Harper, J. W. (2003a). BTB proteins are substrate-specific adaptors in an SCF-like modular ubiquitin ligase containing CUL-3. Nature 425,316 -321.[CrossRef][Medline]
Xu, L., Yang, L., Moitra, P. K., Hashimoto, K., Rallabhandi, P., Kaul, S., Meroni, G., Jensen, J. P., Weissman, A. M. and D'Arpa, P. (2003b). BTBD1 and BTBD2 colocalize to cytoplasmic bodies with the RBCC/tripartite motif protein, TRIM5delta. Exp. Cell Res. 288,84 -93.[CrossRef][Medline]
Yates, P. A., Roskies, A. L., McLaughlin, T. and O'Leary, D.
D. (2001). Topographic-specific axon branching controlled by
ephrin-As is the critical event in retinotectal map development. J.
Neurosci. 21,8548
-8563.
Zhen, M., Huang, X., Bamber, B. and Jin, Y. (2000). Regulation of presynaptic terminal organization by C. elegans RPM-1, a putative guanine nucleotide exchanger with a RING-H2 finger domain. Neuron 26,331 -343.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
S. B. Uthaman, T. A. Godenschwege, and R. K. Murphey A Mechanism Distinct from Highwire for the Drosophila Ubiquitin Conjugase Bendless in Synaptic Growth and Maturation J. Neurosci., August 20, 2008; 28(34): 8615 - 8623. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Li, G. Kulkarni, and W. G. Wadsworth RPM-1, a Caenorhabditis elegans Protein That Functions in Presynaptic Differentiation, Negatively Regulates Axon Outgrowth by Controlling SAX-3/robo and UNC-5/UNC5 Activity J. Neurosci., April 2, 2008; 28(14): 3595 - 3603. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Bloom, B. R. Miller, J. R. Sanes, and A. DiAntonio The requirement for Phr1 in CNS axon tract formation reveals the corticostriatal boundary as a choice point for cortical axons Genes & Dev., October 15, 2007; 21(20): 2593 - 2606. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Wu, Y. P. Wairkar, C. A. Collins, and A. DiAntonio Highwire Function at the Drosophila Neuromuscular Junction: Spatial, Structural, and Temporal Requirements J. Neurosci., October 19, 2005; 25(42): 9557 - 9566. [Abstract] [Full Text] [PDF] |