|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 5 January 2005
doi: 10.1242/dev.01605
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Genetics, Harvard Medical School, Boston, MA 02115, USA
2 Institute of Physiological Chemistry, University of Halle-Wittenberg, Halle,
06099, Germany
* Author for correspondence (e-mail: tabin{at}genetics.med.harvard.edu)
Accepted 26 November 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Somite, Syndetome, Sclerotome, Myotome, Tendon, Scleraxis, Myf5, Myod1 (MyoD) Sox5, Sox6, FGF, Mouse
| Introduction |
|---|
|
|
|---|
Fate maps, gene expression analyses and generation of mouse mutants reveal
that the somitic compartments are further divided into subdomains with unique
fates. At the dorsomedial edge or lip (DML) of the dermoyotome, cells migrate
underneath to generate the epaxial myotome, which then differentiates rapidly
into back muscle. Central dermomyotome cells de-epithelialize to form the
dorsal dermis, and at limb bud levels, cells delaminate from the ventrolateral
lip (VLL) of the dermomyotome to migrate into the lateral plate mesoderm,
where they develop into limb and limb girdle muscle. At interlimb levels, the
cells from the VLL of the dermomyotome translocate underneath, producing the
hypaxial myotome. The ventrolateral dermomyotome and hypaxial myotome invade
the lateral plate mesoderm together as a somitic bud, from which the body wall
and abdominal muscle emerge. Finally, within the sclerotome, the ventromedial
cells give rise to the vertebral bodies, intervertebral discs and proximal
ribs; the lateral cells, to the neural arches and distal ribs; and the
dorsomedial cells, to the spinous processes
(Brand-Saberi and Christ, 2000
;
Brent and Tabin, 2002
).
In mouse and chick, analysis of the expression of scleraxis (Scx),
a tendon-specific bHLH transcription factor, has revealed the presence of a
fourth somitic compartment, termed the syndetome, from which the axial tendons
emerge (Brent et al., 2003
;
Schweitzer et al., 2001
).
Chick-quail chimeras show the tendon progenitors arising within the anterior
and posterior dorsolateral sclerotome, in response to fibroblast growth
factors (FGFs) secreted from the center of the adjacent myotome
(Brent et al., 2003
). The FGF
signal is received directly, and the response of the sclerotome to it is
mediated by the Ets transcription factors Pea3 (Etv4 - Mouse
Genome Informatics) and Erm (Etv5 - Mouse Genome
Informatics) (Brent and Tabin,
2004
). Thus, interactions between the somitic muscle and cartilage
cell lineages not only lead to establishment of the tendon lineage, but also
place the tendon progenitors at the precise junction between the two tissues
they must eventually join.
In this study, we sought to determine if axial tendon formation proceeds in mouse by the same mechanisms we observed in chick, making use of previously generated targeted mutations that disrupt development of the different somitic lineages. Our examination of tendon development in mice unable to generate normal muscle or cartilage resulted in novel insights into axial tendon formation that were not evident using gain-of-function approaches in chick. Particularly striking in mouse was the observation that in the absence of cartilage differentiation, there is a progenitor fate switch from cartilage to tendon.
The transcription factors responsible for the specification of muscle and
cartilage have been extensively studied. Skeletal muscle development depends
upon the activity of the MRFs Myod1, Myf5, myogenin and MRF4
(Myf6 - Mouse Genome Informatics), which are expressed in the
myoblasts and function to regulate muscle progenitor specification
(Myf5 and Myod1) and differentiation (myogenin and
Myf6) (Pownall et al.,
2002
). During somite development, Myf5 and Myod1
are activated in all muscle progenitors of the epaxial and hypaxial myotomes,
and in the migratory muscle progenitors once they begin differentiating into
limb and abdominal muscle. In the mouse myotome, Myf5 is activated
first in the epaxial and hypaxial progenitors, and Myod1,
2 days
later, in the differentiated myotome
(Pownall et al., 2002
).
Myf5 and Myod1 appear to play largely redundant roles
during specification of the muscle progenitors. While mice carrying targeted
mutations in either Myf5-/- or
Myod1-/- are born with essentially normal skeletal muscle
(Braun et al., 1992
;
Kaul et al., 2000
;
Rudnicki et al., 1992
), loss
of Myf5 or Myod1 results in significantly delayed formation,
respectively, of the epaxial and hypaxial muscles
(Kablar et al., 1998
;
Kablar et al., 2003
;
Kablar et al., 1997
).
Additionally, as Myf5 is expressed prior to Myod1,
myogenesis in Myf5-/- embryos occurs only upon activation
of Myod1 (Braun et al.,
1994
). By contrast, Myf5-/-;
Myod1-/- double mutants contain almost no muscle progenitors,
hence minimal differentiated skeletal muscle
(Kassar-Duchossoy et al.,
2004
; Kaul et al.,
2000
; Rudnicki et al.,
1993
).
Interestingly, it appears that the events of specification of the somitic
muscle progenitors and onset of myotomal FGF signaling are closely linked: in
Myf5-/- mutants, expression of the myotomal FGFs is
delayed until induction of Myod1, and in
Myf5-/-; Myod1-/- double mutants,
expression is never initiated
(Fraidenraich et al., 2000
;
Fraidenraich et al., 1998
;
Grass et al., 1996
). Moreover,
the dependency of FGF expression on induction of Myf5 and
Myod1 appears to be direct. An Fgf4 myotomal enhancer
element has been identified and found to contain E boxes binding Myf5
and Myod1, and it has been shown that these E boxes are required for
Fgf4 expression in the myotome, and that an
FGF4-lacZ transgene, driven by the myotome-specific
enhancer, is not initiated in Myf5-/-;
Myod1-/- mutants
(Fraidenraich et al., 2000
;
Fraidenraich et al.,
1998
).
Specification of the skeletal lineage is also well understood. Within the
Sox family of transcription factors, characterized by a high-mobility-group
(HMG)-box DNA binding domain, three members, Sox9, Sox5 and
Sox6, are known to be expressed in all chondroprogenitor cells and
chondrocytes, and to play essential roles in chondrocyte differentiation.
Analyses of the effect of Sox9-null mutations on cartilage elements
in mouse chimeras and tissue-specific Sox9 knockouts show that loss
of Sox9 results in absence of cartilage development, and that
Sox9 is required at the earliest steps of chondrocyte differentiation
and mesenchymal condensation formation
(Akiyama et al., 2002
;
Bi et al., 1999
;
Bi et al., 2001
;
Healy et al., 1996
;
Healy et al., 1999
;
Zhao et al., 1997
). Moreover,
Sox9 is required for induction of the two other HMG box transcription
factors co-expressed with it, Sox5 and Sox6
(Akiyama et al., 2002
;
Lefebvre et al., 2001
;
Lefebvre et al., 1998
).
Analysis of cartilage development in Sox5 and Sox6 mutants
reveals that these genes play redundant and essential roles: while
Sox5-/- and Sox6-/- mice show mild
skeletal abnormalities, Sox5-/-;
Sox6-/- double mutants present severe chondrodysplasia and die
by E16.5 (Smits et al., 2001
).
Nonetheless, although there is no overt chondrocyte differentiation,
mesenchymal condensations do form, and Sox9 expression is normal,
underscoring the role played by Sox5 and Sox6 downstream of
Sox9 (Smits et al.,
2001
).
Mice carrying mutations in the transcription factors specifying muscle and skeletal development are thus a valuable source of new insight into the course of tendon formation when these tissues are absent. Analyses of targeted mutations in Myf5 and Myod1 embryos not only allow us to test the necessity for muscle development, but because activation of the myotomal FGFs in mouse is directly controlled by expression of Myf5 and Myod1 in the specified muscle progenitors, the effect of FGF signaling loss on tendon development can be assessed as well. Analysis of Sox5-/-; Sox6-/- mutants further enriches our understanding of tendon progenitor formation and differentiation by allowing us to visualize the effect on tendon development when cartilage development is disrupted.
We show here, through analysis of axial tendon development in Myf5-/-; Myod1-/- mutants, that specification of the muscle progenitors is essential for expression as well as differentiation of the earliest markers of the somitic tendon progenitors. We propose that defects in tendon development in the absence of skeletal muscle are probably the result of loss of myotomal FGF signaling, and that the somitic tendon cell lineage thus requires the presence of specified muscle for its induction. Our observations of tendon development in Sox5-/-; Sox6-/- mutant embryos revealed that loss of chondrocyte differentiation results in an expanded somitic tendon progenitor population that, in turn, causes the Sox9-expressing mesenchymal condensations to begin expressing tendon markers. The two lineages arising from the sclerotome thus appear to be alternative and mutually exclusive: when differentiation into one cell fate is blocked, the other is adopted.
| Materials and methods |
|---|
|
|
|---|
In situ hybridization
Whole-mount and section in situ hybridization were performed as previously
described (Brent et al.,
2003
). For section in situ hybridization, embryos were embedded in
paraffin and 10 µm sections were collected. Probes included mouse
Scx (Schweitzer et al.,
2001
), mouse Myod1
(Brent et al., 2003
), mouse
Myf5 (full length RT-PCR product: 5'
ACGGGTCTCCCATGGACATGACGGACGGCTGCCAG and ACGGAATTCTCATAATACGTGATAGATAAGTCTGG),
mouse Fgf4 (a gift from Gail Martin), mouse tendin (image clone
463876), mouse myogenin (a gift from Eric Olson), mouse Sox9 (a gift
from Véronique Lefebvre), mouse mSox5 (a gift from
Véronique Lefebvre), mouse Sox6 (a gift from Véronique
Lefebvre), lacZ (a gift from Connie Cepko), mouse collagen XII (gift
of Ronen Schweitzer) and mouse Pea3 (full-length RT-PCR product:
5' ACGGGTCTCCCATGGAGCGGAGGATGAAAG and 5'
ACGGAATTCCTAGTAAGAATATCCACCTCTG).
Immunohistochemistry, Alcian Blue staining and TUNEL labeling
For myosin detection, following in situ hybridization, sections were
incubated overnight with AP-conjugated MY32 (1:150; Sigma) and detected with
INT/BCIP. Phosphorylated MAPK/ERK was detected with Phospho-p44/42 Map Kinase
(Thr202/Tyr204) antibody (diluted 1:500; Cell Signaling Technology #9101),
followed by a Cy3-conjugated secondary antibody (Jackson ImmunoResearch). For
Alcian Blue staining, paraffin sections were rehydrated, incubated in 3%
acetic acid/water for 3 minutes and stained in 3 mg/ml Alcian Blue for 30
minutes. TUNEL labeling was performed on sections using a fluorescein in situ
cell death detection kit (Roche) according to manufacturer's
specifications.
Trunk cultures
Trunk cultures performed as previously described
(Zuniga et al., 1999
). For
inhibition of FGF signaling, 20 µM SU5402 or an equivalent amount of DMSO
was added to culture media and E10 cultures were incubated for 24 hours. For
FGF4 bead implants, heparin beads (Sigma) were washed in PBS and soaked on ice
for 1 hour in FGF4 protein (Peprotech) (1 mg/ml). Beads were implanted into
somites of E10 wild-type or Myf5-/-;
Myod1-/- embryos. Trunks were placed in culture for 12
hours.
| Results |
|---|
|
|
|---|
|
In summary, our comparisons of Scx, Myf5, Myod1 and Fgf4 confirmed that initiation of the FGFs in the myotome, and of Scx in the sclerotome, occur only after Myf5-dependent specification of the myotome muscle progenitors takes place. By contrast, Scx in the limb is induced prior to expression of the MRFs in the limb muscle progenitors.
In Myf5 mutant embryos there is a delay in the induction of FGFs in the myotome and Scx in the sclerotome
Having determined that Scx induction in the somites is initiated
after myotome formation and expression of Myf5, we asked next whether
Scx would be expressed normally in the somites of mice carrying null
mutations for Myf5. Scx expression in the somites, limb buds and
branchial arches of Myf5+/- embryos looked wild type at
E10.5 (Fig. 2A), with increased
levels at E11.0 (Fig. 2G). By
contrast, in E10.5 Myf5-/- embryos, while Scx
expression in the limb and branchial arches still appeared normal
(Fig. 2D; blue and green
arrows, respectively), it was drastically reduced in the somites, with
expression only in the ventrolateral region of the thoracic somites
(Fig. 2D, red arrow). At E11.0,
while the cervical somites still showed no Scx, levels within the
interlimb somites, relative to E10.5, appeared to have increased both
dorsomedially and ventrolaterally, but less so medially
(Fig. 2J). Finally, by E13.5,
the pattern and levels of Scx expression looked normal (data not
shown). Our results thus indicated that Myf5 is required for timely
activation of Scx in the somites, but not in the limbs or branchial
arches.
|
Because Myf5 and Myod1 compensate for one another during
muscle development, we wanted to examine Myod1 expression in
Myf5-/- embryos in order to determine whether gradual
rescue of Scx and Fgf4 expression would correlate with
induction of Myod1. At E10.5 in the Myf5+/-
embryos, Myod1 was expressed throughout the myotome of somites
anterior to the forelimb (Fig.
2C). In the interlimb somites, expression was visible throughout
the myotome as well, but with strongest levels at the ventrolateral edge
(Fig. 2C). It is known that in
the absence of Myf5, myotome fails to properly form: the
Myod1-expressing muscle progenitor cells remain trapped along the
medial edge of all somites, and along the lateral edge of the interlimb
somites. Myod1 expression remains disrupted in Myf5 mutants
for several days, after which it compensates for Myf5 loss, and
muscle development resumes (Tajbakhsh et
al., 1997
). Accordingly, at E10.5 in the
Myf5-/- embryos, we observed Myod1 expression
limited to the medial and lateral edges of the somite, rather than throughout
the myotome (Fig. 2F); and
while, at E11.0, Myf5+/- embryos showed increased
Myod1 expression in the myotome and forelimb
(Fig. 2I), Myf5-/- embryos at this same stage showed none at the
center of the myotome (Fig. 2L)
and delayed Myod1 expression in the forelimb
(Fig. 2L, blue arrow).
Interestingly, the expression pattern of Myod1 in
Myf5-/- embryos closely resembled that of Scx and
Fgf4 at both E10.5 and E11.0, lending weight to the likelihood that,
in the absence of Myf5, induction of Scx in the sclerotome
and Fgf4 in the myotome is dependent upon Myod1 function. By
contrast, expression of both Scx and Fgf4 appeared normal in
Myod1-/- embryos (data not shown), indicating that the
later-expressed Myod1 is dispensable for Scx expression as
long as Myf5 is present. It is also worth noting that in mouse,
unlike chick, Fgf8 is not expressed at the center of the myotome but
is instead localized to the anterior and posterior edges of the dermomyotome
(Fig. 3O, blue arrows)
(Crossley and Martin, 1995
).
Although this domain is spatially consistent with the proposed role of
Fgf8 in the induction of Scx within the adjacent sclerotome,
Fgf8 does not appear to depend on Myf5 or Myod1 for
its expression (Fig. 3S).
|
We next queried if loss of the Scx-expressing tendon progenitors
in Myf5-/-; Myod1-/- somites would
translate into failed tendon differentiation during later development. In the
double heterozygous embryos, Scx expression at E13.5 was seen marking
the maturing tendons attaching the myogenin-expressing epaxial muscle to the
vertebrae (Fig. 3E,G). By
contrast, in the Myf5-/-; Myod1-/-
double mutants, neither myogenin in the epaxial muscle
(Fig. 3F) nor, strikingly,
Scx in the epaxial tendons (Fig.
3H) was detected, indicating failure of both muscle and tendon
differentiation in these regions. Interestingly, some muscle development was
recently observed (Kassar-Duchossoy et
al., 2004
) in Myf5-/-;
Myod1-/- double mutants; we too found myogenin expressed in
the intercostal region of E13.5 embryos, along with associated expression of
Scx in the intercostal tendons (data not shown). We attribute the
expression of Scx here to the faint and occasional myotomal FGF
signaling we observed in the ventrolateral myotomes. In the epaxial region,
however, our findings confirmed that where there was no muscle development,
there was no expression of Scx, We were able to further verify loss
of the differentiated epaxial tendons in the Myf5-/-;
Myod1-/- mutants by observing the behavior of tendin, a type
II transmembrane protein that is normally highly expressed in the maturing
tendons and ligaments (Brandau et al.,
2001
). In double heterozygous embryos, tendin was found in the
axial tendons associated with the epaxial muscle
(Fig. 3I); however, in the
Myf5-/-; Myod1-/- embryos, as with
Scx, no tendin was detected (Fig.
3J), corroborating lack of differentiated tendons in the absence
of specified or differentiated muscle. In the limb, Scx expression in
E13.5 Myf5-/-; Myod1-/- embryos was
similar to that of wild type (Fig.
3K,L), hence, as opposed to the somites, unaffected by loss of
Myf5 and Myod1 (Fig.
3B, blue arrow). Limb tendon progenitor formation, unlike its
somitic counterpart, thus does not appear, at least as late as E13.5, to
depend on the presence of specified or differentiated muscle.
In chick, we showed that FGF-dependent induction of Scx is
mediated by the Ets transcription factors Pea3 and Erm, and
that transcriptional activation by Pea3 and Erm is necessary
for Scx expression to occur
(Brent and Tabin, 2004
). To
determine whether loss of Scx in Myf5-/-;
Myod1-/- double mutant embryos also correlates with changes in
Pea3 activity, we analyzed expression of Pea3 at E10.5. As
in chick, Pea3 was seen in wild-type embryos in the anterior and
posterior sclerotome, in a broader domain than that of Scx
(Fig. 3M, black arrow). In
Myf5-/-; Myod1-/- double mutant
embryos, absence of myotome differentiation was confirmed by lack of myogenin
expression (Fig. 3M,Q);
however, Pea3 expression in the anterior and posterior sclerotome was
still discernable (Fig. 3R,
black arrow), although the domain was not as well defined as in wild-type
(Fig. 3M). As Pea3 is
not only a transcriptional effector of FGF signaling, but also initially
dependent upon FGF signaling for its expression, it is likely that the
Pea3 expression domain observed in Myf5-/-;
Myod1-/- embryos persists, despite loss of the myotomal FGFs,
because Fgf8 expression is still present in the anterior and
posterior dermomyotome (Fig.
3O,S). Nonetheless, as we showed in chick, clear refinement of the
Pea3 expression domain to the anterior and posterior sclerotome
correlates distinctly with restriction of FGF signaling to the center of the
myotome (Brent and Tabin,
2004
); thus, the more diffuse Pea3 expression domain seen
in Myf5-/-; Myod1-/- double mutants
(Fig. 3R) is probably
attributable to the absence of myotomal FGFs. To confirm that loss of
Scx expression in double mutant embryos correlated with loss of FGF
signaling from the anterior and posterior sclerotome, we utilized
phosphorylated ERK/MAPK, which identifies when and where signaling is active
(Corson et al., 2003
).
Employing an antibody specific to phosphorylated ERK1 and ERK2, we detected
phosphorylated ERK/MAPK in the anterior and posterior sclerotome of
Myf5+/-; Myod1+/- embryos
(Fig. 3P, yellow arrow). By
contrast, in Myf5-/-; Myod1-/-
embryos, this active FGF signaling site was absent
(Fig. 3T, yellow arrow), while
expression of phosphorylated ERK/MAPK in the dorsal root ganglia appeared wild
type (Fig. 3P,T). It thus
appears that loss of somitic Scx expression in Myf5/Myod1
double mutant embryos correlates with the absence of active FGF signaling.
FGF signaling is required for Scx induction in mouse
In chick, a role was identified for the myotomal FGFs in the induction of
Scx within the anterior and posterior sclerotome
(Brent et al., 2003
),
consistent with the striking correlation observed between the losses of
Scx and myotomal FGF expression in Myf5-/-;
Myod1-/- mutant mice. To verify that FGFs are required for
Scx induction in mouse, we took advantage of the FGF receptor
inhibitor SU5402 to block FGF signaling in a trunk culture system. E10.0
trunks were placed in culture for 24 hours, in either the presence or absence
of SU5402. We observed normal induction of Scx in the somites and
limbs of control embryos (Fig.
4A); however, in the presence of SU5402, Scx was lost in
both the somites and limbs (Fig.
4B), indicating a requirement for FGF signaling in the induction
of Scx in mouse, and strengthening our hypothesis that absence of
somitic Scx expression in Myf5-/-;
Myod1-/- embryos reflects a loss of myotomal FGF
signaling.
|
The dorsolateral sclerotome co-expresses markers of tendon and cartilage lineages
Having established a crucial role for myotome specification and myotomal
FGF signaling in the induction of Scx within the somite, we wanted to
learn more about the relationship between the two sclerotome-derived lineages:
the axial cartilage and tendons. To do so, we compared the somitic expression
patterns of some markers of cartilage and tendon progenitors as well as their
differentiated derivatives in mouse. Because Scx is expressed
continuously, it can be used to identify tendon development from the earliest
to most mature stages (Brent et al.,
2003
; Schweitzer et al.,
2001
). For cartilage markers, we selected Sox9, expressed
in and required for specification of all chondroprogenitors
(Bi et al., 1999
;
Healy et al., 1996
), and
Sox5, which is required for and a marker of chondrocyte
differentiation (Smits et al.,
2001
). Following differentiation, the cartilage-producing cells
generate an extracellular matrix, recognizable by its ability to stain with
Alcian Blue. In an E10.5 frontal section, expression of Scx was seen
in the anterior and posterior sclerotome between adjacent myotomes
(Fig. 5A). Sox9 was
observed throughout the sclerotome, particularly in the posterior somite
(Fig. 5B), and more restricted
in the anterior dorsolateral region, which also contains the dorsal root
ganglia (Fig. 5B, asterisks).
Interestingly, both Scx and Sox9 appeared to be expressed
within the anterior and posterior dorsolateral sclerotome
(Fig. 5A,B). Sox5 was
also observed in the sclerotome, in a domain overlapping with that of
Sox9 throughout the sclerotome, and with that of Scx at the
anterior and posterior margins (Fig.
5C). At this stage, no detectable Alcian Blue staining was visible
(Fig. 5D,H), indicating that
although the sclerotomal cartilage progenitors had begun to differentiate into
chondrocytes, as evidenced by expression of Sox5, they were not yet
producing extracellular matrix. Transverse sections at E10.5 allowed for
clearer visualization of the overlapping expression domains of Scx,
Sox9 and Sox5. Although Scx was restricted to the
dorsolateral-most sclerotome just beneath the myotome
(Fig. 5E), Sox9 was
strongly expressed throughout the sclerotome, including the dorsolateral,
ventromedial and dorsomedial regions (Fig.
5F). Sox5, although expressed, like Scx, in the
dorsolateral sclerotome, extended further into the ventromedial area, where it
partially overlapped with Sox9
(Fig. 5G). That Scx,
Sox9 and Sox5 were expressed in the dorsolateral sclerotome at
E10.5 suggests that this domain contains either a mixture of cartilage and
tendon progenitors, or a multipotent progenitor population co-expressing early
markers of both cartilage and tendon. In situ hybridization did not provide
enough resolution to distinguish between these possibilities.
|
Our comparison of specification and differentiation of the cartilage and
tendon progenitors within the sclerotome revealed that although both
populations initially occupied overlapping dorsolateral domains, they became
nonoverlapping and distinct as they began to differentiate. Interestingly, we
found Scx, Sox9 and Sox5 co-expressed at additional sites in
mouse. As early as E10.5, Sox9 and Sox5 were detected in a
population of cells in the neural tube
(Fig. 5F,G), perhaps reflecting
their role in the development of glia
(Stolt et al., 2003
), and by
E13.5 that domain had narrowed to surround the lumen of the neural tube
(Fig. 5R,S). Also at E13.5, we
saw Scx expressed in the dorsal neural tube, although more laterally
so than Sox9 and Sox5
(Fig. 5Q), and also
co-expressed, together with Sox9 and Sox5, in the developing
lung (Fig. 5U-W, arrows).
Scx expression is slightly upregulated in the dorsolateral sclerotome of Sox5/Sox6 mutant embryos
In Sox5-/-; Sox6-/- embryos, the
chondroprogenitors are unable to differentiate into chondrocytes - and as a
result, no cartilage elements form. Sox5-/-;
Sox6-/- double mutants thus allow for examination of the
effect of blocked chondrogenesis on both establishment of the tendon
progenitor pool and formation of properly patterned tendons. We looked at the
effect of Sox5 and Sox6 loss on E10.5 tendon progenitors in
the dorsolateral sclerotome. In the anterior and posterior dorsolateral
sclerotome of double heterozygous embryos, we found Scx expression
resembling wild type in frontal sections
(Fig. 6A). Sox9
expression mirrored that of Scx in this domain, but was additionally
present in the rest of the dorsomedial sclerotome, and in the ventromedial
sclerotome (Fig. 6B). Because
the null alleles of Sox5 and Sox6 were generated by
targeting lacZ to each locus
(Smits et al., 2001
), we used
lacZ expression to identify cells expressing the mutant Sox5
and Sox6 alleles. At E10.5, detection of lacZ transcripts by
in situ hybridization revealed that the targeted alleles were expressed within
the sclerotome - in the same domain as wild-type Sox5 and
Sox6 (Fig. 6C).
|
Because FGF signaling is necessary and sufficient for somitic Scx expression in both mouse and chick, we wondered if the upregulation of Scx we had observed in Sox5/Sox6 double mutant embryos was the result of increased FGF signaling. However, neither Pea3 (Fig. 3G,J) nor phosphorylated ERK/MAPK (Fig. 3I,L, yellow arrows) appeared altered in the anterior and posterior sclerotome, indicating that FGF signaling had not increased. Alternatively, we considered that perhaps the extra Scx-expressing cells in the anterior and posterior sclerotome of the Sox5/Sox6 double mutant embryos were not undergoing normal programmed cell death. To determine this, we performed TUNEL assays at E10.5. In Sox5+/-; Sox6+/- embryos, the majority of cells undergoing programmed cell death appeared to be restricted to the dermomyotome (Fig. 3H); and as we observed a similar pattern of cell death in Sox5-/-; Sox6-/- double mutant embryos (Fig. 3K), we were not able to associate the increase in Scx expression in the anterior and posterior sclerotome with any change in cell death in the somite.
In the absence of cartilage differentiation, the chondroprogenitors adopt a tendon cell fate
Analysis of Sox5-/-; Sox6-/-
embryos at E10.5 revealed that when the Sox9-expressing
chondroprogenitors were unable to express Sox5 and Sox6, Scx
was either upregulated or initiated de novo. As the dorsolateral sclerotome
appeared to express Scx, Sox9, Sox5 and Sox6, reflecting
either a mixture of tendon and cartilage progenitors, or a single cell
population co-expressing markers of both fates, our observation that
Scx levels increase in this region when the chondroprogenitors are
unable to differentiate, might indicate that without Sox5 and
Sox6, more dorsolateral sclerotome cells are able to respond to
tendon inducing signals, such as myotomal FGFs, at early stages; yet, this
increase may not be indicative of a fate change. To resolve this issue, we
needed to determine, using double mutants, what happens to the developing
tendons at later developmental stages, when chondrocyte differentiation should
be occurring but cannot. In wild type, as shown above, by E11.5 the cartilage
and tendon lineages become spatially distinct and nonoverlapping as the
somitic derivatives began to differentiate. To assess tendon development after
this transition, we decided to look at E14.5 embryos. In double heterozygous
mice, Scx could be seen in the mature axial tendons associated with
the vertebrae and ribs (Fig.
7A,G). The axial skeletal elements were differentiated at E14.5 as
well, indicated by Alcian Blue staining
(Fig. 7B,H), and were
expressing lacZ (Fig.
7C,I). Importantly, in the double mutants at E14.5, the axial
cartilage elements were also identifiable using expression of lacZ
because, as previously shown, in the absence of Sox5 and
Sox6, the lacZ-expressing chondroprogenitors still form
mesenchymal condensations at the appropriate sites for axial skeleton assembly
(Fig. 7F,L)
(Smits et al., 2001
). But
although lacZ expression was seen in the
Sox5-/-; Sox6-/- vertebral bodies
(Fig. 7F, green arrow), neural
arches (Fig. 7F, red arrow) and
ribs (Fig. 7L), these mutant
skeletal elements failed to undergo normal chondrocyte differentiation: Alcian
Blue staining revealed only slight differentiation in the vertebral bodies
(Fig. 7E, green arrow), and
none in the neural arches (Fig.
7E, red arrow) or ribs (Fig.
7K).
|
Because Sox9 is expressed in specified chondroprogenitors both prior to and during differentiation, we next asked whether those Sox5-/-; Sox6-/-, Scx-expressing cartilage elements were also Sox9 positive. In double heterozygous E14.5 embryos, Scx and Sox9 appeared clearly mutually exclusive, with Scx marking the tendons surrounding the ribs (Fig. 7M) and Sox9 marking the differentiated chondrocytes (Fig. 7N). Interestingly, Sox9 was also found throughout the Scx-expressing double mutant ribs (Fig. 7P,Q). As these mutant undifferentiated Scx-expressing condensations were nonetheless able to form in appropriate locations, and to express Sox9, we wondered if they were capable of making proper muscle attachments. Simultaneous detection of tendon and muscle revealed that while the intercostal muscles did appear to attach to the Sox5-/-; Sox6-/- ribs (Fig. 7R), the muscles looked mispatterned compared with littermate controls (Fig. 7O).
Our observation that the undifferentiated axial cartilage elements
expressed Scx in the absence of Sox5 and Sox6
suggests that the cartilage derivatives of the dorsolateral sclerotome had
indeed undergone a fate change. To determine if the chondroprogenitors had
actually differentiated into tendon, we looked at expression of two tendon
markers, tendin (Brandau et al.,
2001
) and collagen XII (Dublet
and van der Rest, 1987
; Oh et
al., 1993
) that, unlike Scx, are found not in the
progenitors but in the differentiating tendons. Strikingly, although in the
E14.5 double heterozygous embryos, tendin
(Fig. 8B) and collagen XII
(Fig. 8C) expression, like that
of Scx (Fig. 8A), was
observed surrounding the ribs, in the double mutants, again mimicking
Scx (Fig. 8D), tendin
(Fig. 8E) and Collagen XII
(Fig. 8F) were seen expressed
throughout the undifferentiated rib primordia. We thus conclude that in the
absence of cartilage differentiation, the chondroprogenitors switched to a
genuine tendon cell fate.
|
| Discussion |
|---|
|
|
|---|
|
Secreted factors control the balance of sclerotome lineage formation
Initial patterning of the somite into sclerotome, dermomyotome and myotome
depends upon signals secreted from surrounding tissues
(Brent and Tabin, 2002
).
Formation of the syndetome, which gives rise to the tendon lineage, also
requires the activity of secreted factors, but in this case they arise from
within the somite itself. Our analyses show that these external and internal
signaling pathways must be carefully regulated in order for the different
somitic lineages to form properly. Ventral midline Shh signaling has
been found to play an essential role in both the induction and/or maintenance
of several of these fates (Brent and Tabin,
2002
). During sclerotome formation, Shh signaling is
required for normal expression of a number of genes that function during
development of the axial skeleton, among them Pax1, Pax9, Nkx3.2 and
Sox9 (Buttitta et al.,
2003
; Murtaugh et al.,
1999
; Murtaugh et al.,
2001
; Zeng et al.,
2002
; Zhang et al.,
2001
). Additionally, we have observed that overexpression of
Shh during chick somite development leads to ectopic expression of
not only Sox9, but also Sox5 and Sox6 (A.E.B. and
C.J.T., unpublished). It is likely that varied levels of Shh
signaling are important for patterning the sclerotome into its different
subdomains: highest levels regulating ventromedial expression of Pax1,
Pax9 and Nkx3.2 and formation of the vertebral bodies; and lower
levels controlling both expression of genes in the dorsolateral sclerotome,
such as Zic1 and Uncx4.1, and development of the neural
arches and ribs (Aruga et al.,
1999
; Bussen et al.,
2004
; Leitges et al.,
2000
; Mansouri et al.,
2000
; Nagai et al.,
1997
). Interestingly, we found, in chick, that overexpression of
Shh negatively regulates formation of the other dorsolateral
sclerotome lineage, the tendon progenitors
(Brent et al., 2003
) - an
effect probably due to a concomitant upregulation, within the same cells, of
Pax1 which, in turn, inhibits expression of Scx
(Brent et al., 2003
). It is
too simplistic, however, to conclude that Shh signaling promotes
sclerotome to adopt a cartilage over a tendon fate. Rather, different levels
probably pattern the sclerotome into dorsolateral and ventromedial domains
(Kos et al., 1998
). In
addition, like Myf5 and Myod1, Shh has been shown to be
required for expression of FGFs in the myotome
(Fraidenraich et al., 2000
):
in Shh mutants, expression of the myotomal FGFs is reduced
(Fraidenraich et al., 2000
),
and similar disruption of somitic Scx expression has also been
observed (A.E.B., C.J.T. and A. P. McMahon, unpublished). It is possible that
Shh regulates FGF induction by controlling the myotomal expression of
Myf5 and Myod1; and in support of this conjecture, there is
evidence that Shh is required to induce or maintain expression of
myogenic factors - in particular Shh functions via the Gli proteins
to regulate Myf5 (Gustafsson et
al., 2002
; Kruger et al.,
2001
; Teboul et al.,
2003
). Alternatively, Shh signaling might directly
activate expression of the myotomal FGFs.
It is in any case clear that Shh signaling arising from the
ventral midline plays several pivotal roles in patterning the somite and
sclerotome, and regulating development of both the axial cartilage and tendons
through activation of the myotomal FGFs. Building on our previous observation
that FGFs negatively regulate expression of the ventromedial sclerotome
marker, Pax1 (Brent et al.,
2003
) - an observation probably relevant to the mediolateral
patterning of the sclerotome - we can speculate on how these tendon-promoting,
myotomal FGF signals might affect development of the chondroprogenitors.
Although Pax1 is initially expressed throughout the sclerotome, it is
eventually downregulated everywhere except the ventromedial-most domain, where
it then functions in development of the vertebral bodies. It is thus possible
that myotomal FGF signaling plays a normal role in the downregulation of
Pax1 in the dorsolateral sclerotome; and in support of this
hypothesis, it has been previously reported that in Myf5 mutant
embryos, prior to onset of Myod1 and subsequent rescue of myotomal
FGF expression, Pax1 expression is seen reaching further
dorsolaterally into the somite than it does in wild type
(Grass et al., 1996
).
But does a role for the myotomal FGFs in promoting Scx and
inhibiting Pax1 expression mean that the FGFs negatively regulate
chondroprogenitor formation in the sclerotome? Analysis of Myf5/Myod1
double mutant embryos indicates that this is not the case: despite the fact
that Myf5/Myod1 double mutants show no myotomal FGF signaling and do
not develop axial tendons, they nonetheless form a normal skeleton, implying
that loss of FGF signaling does not impact axial skeleton development from the
sclerotome (Kaul et al.,
2000
). Additionally, whereas FGF overexpression negatively
regulates Pax1 expression in the chick somite
(Brent et al., 2003
),
Sox9, Sox5 and Sox6 remain unaffected (A.E.B. and C.J.T.,
unpublished) - an unsurprising result given our observation that Scx,
Sox9 and Sox5/6 are all normally co-expressed in the
dorsolateral sclerotome. Furthermore, it has been shown in chick that
Fgf8 actually promotes formation of rib cartilage
(Huang et al., 2003
), a
requirement that might be masked in Myf5/Myod1 mutant embryos because
of the persisting expression of Fgf8. We propose that the myotomal
FGFs function to induce Scx in the dorsolateral sclerotome at the
same time that ventral midline Shh signaling induces Sox9
throughout the sclerotome, and that Sox9, in turn, activates
expression of Sox5 and Sox6 - after which some sclerotome
cells differentiate into cartilage, and the tendon fate is inhibited. The
actual mechanism by which, within a uniform or intermingled population, some
dorsolateral sclerotome cells choose the tendon or cartilage fate remains
unknown, but does not appear to involve either an increase in FGF signaling or
a decrease in cell death.
The balance between the activities of the FGF and Shh signaling
pathways not only determines the fate each sclerotomal subdomain adopts, but
also provides insight into the tendon phenotype observed in Sox5/Sox6
mutant embryos. In the absence of Sox5 and Sox6, the
derivatives of the dorsolateral sclerotome, the ribs and neural arches,
undergo a fate change, from cartilage to tendon, while the ventromedial
derivatives, the vertebral bodies, do not. Thus, the capacity of the
sclerotome to switch fates could be specific to the dorsolateral region which,
in fact, expresses both tendon and chondroprogenitor markers. This crucial
regional difference is probably attributable, at least in part, to the spatial
relationship each of the two subdomains maintains to FGF and Shh
signaling. Higher Shh levels in the ventromedial sclerotome may
simultaneously allow for the slight cartilage differentiation that does take
place in Sox5-/-; Sox6-/- embryos, and
prevent adoption of the tendon fate. By contrast, Shh signaling in
the dorsolateral sclerotome, which is located further from the source of the
signal, is lower, whereas FGF levels in this region are robust; it is probably
just because the dorsolateral chondroprogenitors, unable to differentiate in
the absence of Sox5 and Sox6, are in range of the myotomal
FGFs that they are able to switch fates and differentiate into tendon.
Conversely, as the myotomal FGFs would most probably be unable to reach the
ventromedial sclerotome, no fate change would take place there. Additionally,
because the notochord cells of Sox5-/-;
Sox6-/- embryos undergo massive cell death between E11.5 and
E14.5 (Smits and Lefebvre,
2003
), Shh signaling probably becomes reduced, from
E11.5, in the developing double mutant axial skeleton. Thus, because the ribs
and neural arches undergo overt cartilage differentiation slightly later than
do the vertebral bodies, these lateral sclerotome derivatives may be more
affected by Shh loss, not only because they are located further from
the notochord, but also because the notochord itself is vanishing.
Tissue interactions during somite versus limb development
Our analyses of tendon development in Myf5/Myod1 and
Sox5/Sox6 mutant embryos also revealed some interesting differences
in formation of the somite versus limb tendon progenitors. Both arise from a
common mesenchymal origin, and in mouse (this study) as well as chick (A.E.B.
and C.J.T., unpublished) (Brent et al.,
2003
), both lose Scx expression when FGF signaling is
inhibited. Thus, some patterning mechanisms during axial and limb tendon
development appear to be shared. We know that Myf5- and
Myod1-dependent specification of the myotomal muscle progenitors is
required for induction of somitic Scx, and for subsequent axial
tendon differentiation. By contrast, the limb tendon progenitors form and
differentiate normally in the absence of Myf5 and Myod1,
demonstrating, in line with observations in chick, that muscle need not be
present for the limb tendons to form
(Kardon, 1998
). Similarly,
branchial arch expression of Scx is normal in Myf5/Myod1
mutants.
As in the mesenchymal sclerotome, the segregation of limb bud mesenchyme
into both cartilage and tendon lineages must also be accomplished. However,
unlike the mechanisms employed within the somite to complete this task,
different processes function during specification of the limb cartilage and
tendon progenitors (Brent et al.,
2003
; Murtaugh et al.,
1999
; Schweitzer et al.,
2001