|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online January 27, 2005
doi: 10.1242/10.1242/dev.01611














1 Department of Anatomy and Developmental Biology, UCL, Gower Street, London
WC1E 6BT, UK
2 Department of Paediatrics and Child Health, Royal Free and University College
Medical School, University College London, 5 University Street, London WC1E
6JJ, UK
3 Department of Developmental Biology, Stanford University School of Medicine,
Beckman Center B315, 279 Campus Drive, Stanford, CA 94305-5329, USA
4 Department 3 - Genetics, Max-Planck-Institut für Entwicklungsbiologie,
Spemannstrasse 35/III, D-72076 Tübingen, Germany
5 IGBMC, CNRS/INSERM/ULP, Parc d'Innovation, BP 10142, 67404 Illkirch Cedex,
C.U. de Strasbourg, France
6 Universität Heidelberg und Institut für Toxikologie und Genetik,
Forschungszentrum Karlsruhe, Postfach 3640, Germany

Authors for correspondence (e-mail:
m.rees{at}ucl.ac.uk,
talbot{at}cmgm.stanford.edu,
s.wilson{at}ucl.ac.uk)
Accepted 29 November 2004
| SUMMARY |
|---|
|
|
|---|
Foxa2 is also required for induction and/or patterning of several distinct cell types in the ventral CNS. Serotonergic neurones of the raphé nucleus and the trochlear motor nucleus are absent in mol-/- embryos, and oculomotor and facial motoneurones ectopically occupy ventral CNS midline positions in the midbrain and hindbrain. There is also a severe reduction of prospective oligodendrocytes in the midbrain and hindbrain. Finally, in the absence of Foxa2, at least two likely Hh pathway target genes are ectopically expressed in more dorsal regions of the midbrain and hindbrain ventricular neuroepithelium, raising the possibility that Foxa2 activity may normally be required to limit the range of action of secreted Hh proteins.
Key words: Midline development, Hedgehog signalling, Zebrafish
| Introduction |
|---|
|
|
|---|
The floorplate of both tetrapods and teleosts has distinct lateral and
medial subdivisions that are distinguished by expression of different
repertoires of genes and may have different embryonic origins
(Odenthal et al., 2000
;
Charrier et al., 2002
;
Strähle et al., 2004
). In
zebrafish, the two subdivisions of the floorplate are named medial floorplate
(MFP) and lateral floorplate (LFP)
(Odenthal et al., 2000
).
Expression of genes including sonic hedgehog (shh),
tiggywinkle hedgehog (twhh) and the transcription factor
encoding foxa1 (previously forkhead7) are restricted to the
MFP, whereas foxa2 (axial, hnf3b) and foxa
(forkhead4, fkh4, pintallavis) are expressed in both MFP and LFP
cells (Odenthal et al., 2000
;
Odenthal and Nüsslein-Volhard,
1998
).
In zebrafish, it is the Nodal signalling pathway that specifies MFP
identity. Mutations affecting the Nodal ligand Cyclops (Cyc)
(Hatta et al., 1991
;
Sampath et al., 1998
;
Rebagliati et al., 1998
;
Tian et al., 2003
), the
EGF-CFC protein One-eyed-pinhead (Oep)
(Strähle et al., 1997a
;
Schier et al., 1997
;
Zhang et al., 1998
) and the
transcriptional effector of Nodal signalling FoxH1/Schmalspur (Sur)
(Pogoda et al., 2000
;
Sirotkin et al., 2000
) all
show defects in MFP induction. Furthermore, analysis of enhancer elements of
several genes expressed in the floorplate show dependence on Nodal signals for
their activity (Müller et al.,
1999
; Müller et al.,
2000
; Rastegar et al.,
2002
). These observations support a two-step model of floorplate
formation (Odenthal et al.,
2000
; Albert et al.,
2003
), whereby Nodal activity induces the MFP, after which Hh
signals from the MFP and/or underlying axial mesendodermal tissues induce LFP
cells.
In mouse, one of the targets of Hh signalling within prospective floorplate
tissue is Foxa2, which encodes a winged-helix transcription factor.
Foxa2 expression is absent from the ventral CNS of mouse mutants
lacking activity of the Hh transcriptional effector Gli2, and exogenous Shh
can induce ectopic Foxa2 expression (reviewed by
Strähle et al., 2004
).
Reciprocally, Foxa2 consensus binding sites are present within the enhancers
of the mouse and zebrafish shh genes
(Chang et al., 1997
;
Müller et al., 1999
;
Epstein et al., 1999
;
Jeong and Epstein, 2003
) and
ectopic Foxa2 activity can induce shh expression
(Hynes et al., 1995
). These
studies suggest that Hh and Foxa2 act in a positive feedback loop, thereby
explaining the homeogenetic inductive properties of floorplate tissue. It has
proven difficult to test this model so far, as Foxa2 knockout mice
fail to form a node and the consequent absence of axial tissues has precluded
analysis of the direct role of this gene in floorplate development
(Ang and Rossant, 1994
;
Weinstein et al., 1994
).
In zebrafish, LFP-specific expression of foxa2 is absent in Hh
pathway mutants, suggesting dependence on Hh activity for transcription in
this region (Odenthal et al.,
2000
; Schauerte et al.,
1998
). However, within the MFP, it appears that foxa2 is
induced and functions downstream of the Nodal pathway. For example,
cell-autonomous activation of Nodal signalling leads to induction of
foxa2 expression (Müller et
al., 2000
), and exogenous Foxa2 can rescue medial floorplate gene
expression in Nodal pathway mutants
(Rastegar et al., 2002
). These
and other observations have led to the suggestion that during floorplate
induction in fish, Foxa2 functions downstream of Nodal signals
(Rastegar et al., 2002
;
Strähle et al., 2004
),
analogous to the role proposed for Foxa2 acting downstream of Hh activity in
mammals.
In this study, we elucidate the role of Foxa2 in patterning the ventral CNS through phenotypic analysis of mol-/- mutant zebrafish embryos that carry mutations in the foxa2 gene. mol-/- embryos show a fully penetrant and fully expressed phenotype in which a floorplate forms but fails to expand or differentiate. Our results suggest that Nodal-dependent induction of floorplate occurs in the absence of Foxa2 activity but that subsequent steps in floorplate development depend heavily upon functional Foxa2. We also show that absence of Foxa2 function leads to defects in the development of oligodendrocytes, the serotonergic raphé nucleus and several cranial motor nuclei.
| Materials and methods |
|---|
|
|
|---|
Fish stocks
Embryos were obtained by natural spawnings from wild-type and
monorail (mol)tv53a
(Brand et al., 1996
),
monorail (mol)st20, smoothened
(smu)b641
(Barresi et al., 2000
;
Varga et al., 2001
) and
sonic-you (syu)tq252
(Schauerte et al., 1998
) fish.
mol-/- fish expressing the isl1:GFP transgene were
obtained from parents generated by crossing a heterozygous
moltv53a carrier with a homozygous Tg(isl1:GFP) fish
(Higashijima et al., 2000
).
mol-/-;syu-/- double mutant fish were generated
by crossing fish heterozygous for both moltv53a and
syutq252. The moltv53a and
molst20 alleles have very similar phenotypes and
moltv53a mutants were used for most of the phenotypic
characterisation.
Pharmacological blockade of Hh signalling
For inhibition of Hh pathway signalling, embryos were incubated in 100
µM cyclopamine (diluted in fish water from 20 mM stock in ethanol) between
4 hours and the time of fixation for analysis of floorplate differentiation or
between 36 hours and 48 hours for experiments analysing ectopic ntn1
and nk2.2a expression (see Results). Treatment was terminated by
three washes in fish water followed by fixation. To exclude the possibility
that observed defects were due to ethanol treatment, control embryos were
incubated in an equivalent concentration of ethanol without cyclopamine.
Furthermore, cyclopamine treatment gave rise to phenotypes well established as
being due to abrogation of Hh activity, such as partial cyclopia and U-shaped
somites.
Microinjection and rescue experiments
foxa2 morpholino (5'-CCTCCATTTTGACAGCACCGAGCAT-3',
Gene-Tools) was diluted in 1 x Danieau buffer [58 mM NaCl, 0.7 mM KCl,
0.4 mM MgSO4, 0.6 mM Ca (NCO3)2, 5.0 mM HEPES
pH 7.6] and stored at -20°C. Synthetic mRNAs were synthesised using the
SP6 mMessage mMachine transcription kit (Ambion) according to the
manufacturer's protocol. Embryos were injected at the single cell stage with
either 4 ng/µl morpholino, or with between 50 ng/µl and 100 ng/µl
mRNA. Rescue experiments were performed using mRNA transcribed from a
pCS2MT:foxa2-ER plasmid (see
Rastegar et al., 2002
).
Protein activity was initiated at between 50% epiboly and 70% epiboly by
treatment with 10-7 M ßEstradiol (Sigma). Control experiments
were performed using mRNA transcribed from a pCS2MT:hER plasmid
containing no foxa2 sequence. shh RNA was injected at the
single cell stage at a concentration of 50 ng/µl and injected embryos were
left to develop for up to three days before fixation.
In situ hybridisation and immunohistochemistry
In situ hybridisation was carried out as described previously
(Macdonald et al., 1994
) and
standard antibody protocols were used
(Wilson et al., 1990
). The
following mRNA in situ hybridisation probes were used: foxa2
(Strähle et al., 1993
),
foxa1 and foxa (Odenthal et al., 1998); shh
(Krauss et al., 1993
);
twhh (Ekker et al.,
1995
); nk2.2a (Barth
and Wilson, 1995
); col2a1
(Lele and Krone, 1997
);
min1 and min2
(Higashijima et al., 1997
);
tphR (Teraoka et al.,
2004
); th (Holzschuh
et al., 2001
); dbh
(Guo et al., 2000
);
ntn1 (Strähle et al.,
1997b
); ctgf
(Dickmeis et al., 2004
);
arx (Miura et al.,
1997
); her9 (Leve et
al., 2001
); olig2
(Park et al., 2002
);
nkx2.2b (Schäfer et
al., 2004
); mbp and plp
(Brösamle and Halpern,
2002
). In some cases, stained embryos were embedded in gelatin and
25 µm sections cut using a vibratome (Leica). Anti-GFP antibody (AMS
Biotechnology) was used at 1:1000, with anti-rabbit IgG secondary antibody
(Sigma) at 1:200. Anti-acetylated tubulin antibody
(Wilson et al., 1990
) (Sigma)
was used at 1:1000 with an anti-mouse IgG secondary (Sigma). Antibody staining
was visualised with diaminobenzidine (DAB).
Linkage analysis, genetic mapping, cloning and sequencing
The moltv53A locus was mapped using F2 offspring of a
TübingenxWIK reference cross
(Rauch et al., 1997
) with a
panel of simple sequence length polymorphism (SSLP) markers
(Knapik et al., 1996
) on pools
of 48 mutants and 48 wild-type siblings and localised to linkage group 17.
Linkages were confirmed and refined by genotyping single mutant and sibling
embryos. To confirm that foxa2 is tightly linked to the
moltv53A mutation, a polymorphism within the
foxa2 gene was scored by cleavage with the enzyme Tsp509 I.
To identify the lesion in foxa2, RNA pools from 20
mol-/- and 20 wild-type embryos at 24 hpf were reverse
transcribed. The entire coding sequence of the foxa2 gene was
amplified by PCR using the forward and reverse primers
TTCCAGGATGCTCGGTGCTGTCAAAATGG and GTCACAAGGTCCAAGAGAGTTTAGGAAG. The product
was cloned into the TOPO TA vector (Invitrogen) for sequence analysis.
Automated fluorescent sequencing was carried out using an ABI 373A sequencer.
Internal foxa2 primers were designed and 17
moltv53A and seven wild-type samples analysed. Sequence
analysis was also carried out on PCR products from single embryo genomic DNA
from five moltv53A, three wild-type and nine siblings. The
molst20 locus was mapped with a panel of SSLP markers
(Knapik et al., 1996
) using
progeny obtained from crosses of F2 founder fish heterozygous for
molst20. Initial mapping of the
molst20 locus to LG 17 was performed on mutant and
wild-type DNA pools obtained from 20 embryos per pool. Linkages were confirmed
and refined by genotyping single mutant and wild-type sibling embryos. The
mutation was identified by amplifying and sequencing foxa2 exons with
template DNA prepared from tail fins of heterozygous
molst20 fish. The part of the second exon containing the
mutation was amplified and sequenced from the 5' and 3' direction
using the primers CAGCACA-CCCTGACATTTCTTT and GTGATTGAACGAGTAGTGATGTT,
respectively. The presence of the mutation was confirmed in 108 single
molst20 embryos by PCR with the primers
TACCATGA-GCCCAATGGCAG and CGAGTGGCGGATAGAGTTT, and subsequent cleavage of the
PCR product with the restriction enzyme MseI.
Transplantation experiments
Mosaic analysis was carried out between wild-type and mutant embryos at
different stages. Biotin (1%)-injected donor cells were taken from dome stage
embryos and placed into mol-/- or wild-type hosts at the
shield stage. Cells were placed in the shield, some of the cells of which are
destined to form floorplate (Woo et al.,
1995
). Embryos were left to develop until 32 hours of development
and were then fixed for analysis. At this time point, it was possible to score
genotype of donor and host embryos by morphology. Embryos were stained for
foxa gene expression by in situ hybridisation and position of
transplanted cells was determined by revealing the biotin using the Vectastain
Elite kit. In some cases, embryos from these and other experiments were
embedded into JB4 medium (Polysciences) and sectioned at 10 µm for further
analysis.
| Results |
|---|
|
|
|---|
|
mol-/- embryos possess a floorplate that lacks lateral cells
Previous studies have suggested that Foxa2 mediates floorplate development
downstream of Hh signalling in amniotes
(Sasaki and Hogan, 1994
) and
downstream of Nodal signalling in fish
(Rastegar et al., 2002
). To
investigate if this is indeed the case, we assessed floorplate induction and
differentiation in mol-/- embryos. To our surprise,
slightly enlarged cells with typical cuboidal floorplate morphology
(Odenthal et al., 2000
;
Hatta et al., 1991
) were
evident along the entire axis of the CNS in moltv53a
embryos (Fig. 2A,B). We
therefore conclude that Foxa2 is not essential for induction of a
floorplate.
|
Expression of regulatory genes is not maintained in the floorplate of mol-/- embryos
Gene expression analysis revealed no obvious defects in induction of the
early floorplate markers tiggywinkle hedgehog (twhh;
Fig. 3A), her9
(Latimer et al., 2005
)
(Fig. 3B), ntn1
(Strähle et al., 1997b
)
(Fig. 3C), foxa1 and
shh (data not shown) in mol-/- embryos,
suggesting that by early somite stages, induction of floorplate has
occurred.
|
Development of floorplate in mol-/- embryos does not depend on Hh activity
We next performed experiments to assess whether mol-/-
floorplate shares features of wild-type MFP or LFP. Hh signalling is essential
for induction of LFP but is not required for development of MFP
(Odenthal et al., 2000
;
Schauerte et al., 1998
).
Therefore, if the floorplate remaining in mol-/- embryos
is LFP, abrogating Hh activity should abolish its development. To reduce Hh
activity, we treated wild-type and mol-/- embryos with the
Hh pathway inhibitor cyclopamine
(Incardona et al., 1998
). In
the trunk, mol-/- embryos still possessed a
morphologically distinct floorplate following cyclopamine treatment
(Fig. 4B).
|
The observations that a floorplate still forms in mol-/- embryos with compromised Hh signalling and, at early stages, expresses markers restricted to the MFP of wild-type embryos indicates that the floorplate of mol-/- embryos shares, at least at early stages, some features of the MFP of wild-type embryos.
The absence of markers that clearly and exclusively label the LFP of
wild-type embryos made it more difficult for us to assess if the residual
floorplate of mol-/- embryos shares features with
wild-type LFP. Markers of both MFP and LFP in wild-type embryos, such as
foxa, are expressed in a single row of midline cells in the trunk
spinal cord of mol-/- embryos
(Fig. 4K,L). Nkx2.2 genes may
initially be expressed throughout the ventral most spinal cord but over time,
expression is lost in midline floorplate cells. Both nk2.2a
(Barth and Wilson, 1995
) and
nkx2.2b (Schäfer et al.,
2004
) are expressed in a narrower band of cells in the spinal cord
of mol-/- embryos compared with wild-type embryos
(Fig. 4M-R). The absence of
midline expression evident in wild-type embryos was less apparent in
mol-/- embryos (Fig.
4O-R). This suggests that at late somite stages, the residual
floorplate in mol-/- embryos expresses markers that would
be localised to LFP in wild-type embryos. Together, these observations suggest
that at late somite stages, the expression profile of the residual floorplate
of mol-/- embryos matches neither MFP nor LFP of wild-type
embryos.
Floorplate fails to differentiate in mol-/- embryos
The results described above show that although medially positioned
floorplate cells with typical cuboidal morphology are present in
mol-/- embryos, these cells fail to maintain the
expression of several key regulatory signals and transcription factors. We
next asked what the consequences of these defects are upon the differentiated
character of the floorplate. Mature medial floorplate expresses the
extracellular matrix protein Col2a1 (Lele
and Krone, 1997
), the secreted proteins Mindin1 and Mindin2 (Min1,
Min2) (Higashijima et al.,
1997
), Connective tissue growth factor (Ctgf)
(Dickmeis et al., 2004
), and
the homeodomain protein Arx (Miura et al.,
1997
).
Expression of all these markers of floorplate differentiation is severely
reduced or absent in the spinal cords of mol-/- embryos
and reduced/patchy further rostrally (Fig.
5B,E,H,K,N; data not shown). Other sites of expression, such as
notochord or hypochord, are not obviously affected by the
mol-/- mutation. This failure in floorplate
differentiation is in striking contrast to the situation in
smu-/- embryos, which maintain MFP cells
(Chen et al., 2001
;
Varga et al., 2001
). In
smu-/- embryos, expression of all medial floorplate
differentiation markers is very similar to wild type
(Fig. 5C,F,I,L,O). As virtually
all Hh signalling is absent in smu-/- embryos, these data
indicate that Foxa2 mediates floorplate differentiation independent of the Hh
pathway.
|
Injection of shh RNA leads to ectopic dorsal expansion of the
MFP/LFP marker foxa in the midbrain of both wild-type and
mol-/- embryos (Fig.
6A,B) (Schauerte et al.,
1998
; Odenthal et al.,
2000
). However, in mol-/- embryos, exogenous
Shh failed to restore the normal width of the floorplate
(Fig. 6B). This suggests that
Foxa2 is required downstream of Shh to promote the expression of
foxa. As expected, shh injections had no effect upon the
differentiated MFP marker col2a1 in either wild-type or
mol-/- embryos
(Odenthal et al., 2000
) (data
not shown).
|
Altogether, these results provide evidence that Foxa2 functions both upstream of Hh signalling (in the regulation of Hh gene expression) and downstream of Hh activity (in the induction/maintenance of expression of various floorplate markers).
ntn1 and nk2.2a are ectopically expressed in the midbrain and hindbrain of mol-/- embryos
Consistent with other markers of floorplate maturation, reduced levels of
expression of ntn1 are retained in the spinal cord floorplate of
mol-/- embryos (Fig.
4F). However, with this marker, we found a more complex phenotype
in the midbrain and hindbrain. Transcripts are absent from the most ventral
CNS cells. However, ectopic patches of expression are observed in ventricular
zone cells positioned more dorsally (Fig.
7B,E). The extent of mis-expression varied from a few cells to
large clusters of cells. Similarly, analysis of the homeobox gene
nk2.2a showed that like ntn1, ventricular zone expression in
the hindbrain is more dorsally positioned in mol-/-
embryos than in wild type (Fig.
7H). Unlike other mol-/- phenotypes, the
dorsal expansion of nk2.2a and ntn1 expression shows highly
variable expressivity.
|
Foxa2 is required for formation of the trochlear nuclei and for bilateral separation of the facial and oculomotor nuclei
In order to analyse the induction and patterning of neurones adjacent to
the floorplate in mol-/- embryos, we crossed a GFP
transgene driven by isl1 regulatory elements into the
mol-/- line (Fig.
8B). This transgene labels cranial motoneurones from soon after
their birth (Higashijima et al.,
2000
).
|
Foxa2 is required for formation of the serotonergic raphé nucleus
The hindbrain raphé is the major location of serotonergic neurones
in the brain. Because these neurones differentiate close to the floorplate
(Ye et al., 1998
;
Pattyn et al., 2003
), we
examined their development and differentiation in mol-/-
embryos. To do this, we analysed expression of a tryptophan hydroxylase
encoding gene (tphR; tph2 - Zebrafish Information Network)
(Teraoka et al., 2004
) that
encodes a key enzyme in the synthetic pathway for serotonin production.
By 3 days of development in wild-type embryos, serotonergic raphé
neurones are positioned in anterior and posterior clusters that probably
correspond to the dorsal and ventral subdivisions of the mature nucleus
(Fig. 9A,C)
(Bellipanni et al., 2002
). By
contrast, mol-/- embryos are virtually devoid of
tphR-expressing cells with the few remaining neurones located
caudally within the raphé (Fig.
9B,D). tyrosine hydroxylase (th)-expressing
neurones in the diencephalon and other catecholaminergic neurones all appear
to differentiate as normal in mol-/- embryos
(Fig. 9E-H).
|
mol-/- embryos show defective oligodendrogenesis in the midbrain and hindbrain
In a screen for zebrafish mutants that show myelination defects (H.-M.P.,
B.D. and W.S.T., unpublished), a second allele of mol-/-
(molst20) was isolated. Olig2 is a basic helix-loop-helix
transcription factor expressed in precursors of both motoneurones and
oligodendrocytes (Park et al.,
2002
) and myelin basic protein (mbp) and
proteolipid protein (plp) both mark myelinating cells
(Brösamle and Halpern,
2002
). By 36 hours, there is a reduction of olig2
expression in the hindbrain (Fig.
9I,J) and during later development, there is a reduction of both
mbp (Fig. 9K,L) and
plp (Fig. 9M,N) in the
midbrain and hindbrain, suggesting a loss of myelin forming cells in these
areas.
| Discussion |
|---|
|
|
|---|
|
Foxa2 knockout mice fail to form a node and all its derivatives,
making it impossible to assess the requirement for Foxa2 in floorplate
formation (Ang and Rossant,
1994
; Weinstein et al.,
1994
). However, the observations that exogenous Foxa2 can induce
floorplate markers (Sasaki and Hogan,
1994
; Ruiz i Altaba,
1995
; Rastegar et al.,
2002
), and that Foxa2 binding sites are present in the regulatory
regions of floorplate specific genes such as shh and ntn1
(Chang et al., 1997
;
Epstein et al., 1999
;
Jeong and Epstein, 2003
) has
led to the suggestion that Foxa2 mediates floorplate induction (reviewed by
Strähle et al., 2004
).
However, all these data are also consistent with the primary role of Foxa2
being maintenance of expression of floorplate-specific markers and
differentiation of the floorplate.
If zebrafish Foxa2 mediates floorplate expansion and differentiation (see
below), then what might be the identity of the transcription factors required
for floorplate induction? Other Foxa family genes are clear candidates, but
morpholino knock-down of foxa or foxa1 alone produces no
obvious phenotype (Rastegar et al.,
2002
). Alternatively, there could be cooperation and redundancy
between related Fox family members. Although our data do not address this
issue with respect to floorplate induction, there is very little redundancy at
later stages. Foxa2 is required to maintain expression of other Foxa genes and
so all Foxa activity is severely compromised following loss of Foxa2 activity
alone.
In zebrafish, floorplate induction initially requires Nodal signalling.
Transcription factors directly downstream of this signalling cascade such as
Madh2/Smad2 and Foxh1/Sur/Fast1 induce floorplate markers cell autonomously
most probably by directly binding to the promoter/enhancer elements of
floorplate-specific genes (Müller et
al., 2002
). However, the widespread requirement for these
components of the Nodal pathway in the development of other cell types (e.g.
Kunwar et al., 2003
) indicates
that, alone, they are unlikely to confer specificity to the induction of
floorplate markers. Other transcription factor encoding genes may play a role
in the initial steps in induction of the floorplate, including her9
(Latimer et al., 2005
),
tbx (Amacher et al.,
2002
) and homeobox (Jeong and
Epstein, 2003
) genes. Indeed, given the complexity of the
regulatory regions of floorplate-specific genes (discussed in
Strähle et al., 2004
),
cooperation between many of these proteins may be required to induce
floorplate identity.
In contrast to mice lacking Foxa2 activity
(Ang and Rossant, 1994
;
Weinstein et al., 1994
;
Hallonet et al., 2002
)
mol-/- embryos do not appear to have any major mesodermal,
endodermal or anterior CNS defects. This may reflect significant differences
in the developmental cascades used in mice and fish. Alternatively, it may be
due to different Fox family genes mediating similar events in different
species. Zebrafish frequently have additional homologues of mammalian genes,
most probably owing to a genome duplication event in the lineage leading to
teleosts (Postlethwait et al.,
1998
; Woods et al.,
2000
). When such duplicated genes are retained, the original roles
of the ancestral gene are predicted, in some cases, to be divided between the
duplicates (Force et al.,
1999
). Although we do not know if this is the reason for the
difference in phenotypes between mice and fish lacking Foxa2 function, the
expression of other Foxa genes in mesendodermal derivatives in fish (Odenthal
et al., 1998) is consistent with the possibility that such genes play an
equivalent role to Foxa2 in mice.
Foxa2 is required for floorplate differentiation
Although cuboidally shaped cells with typical floorplate morphology are
present in mol-/- embryos, they fail to maintain
expression of Foxa and Hh family genes and lack expression of markers normally
restricted to the differentiated MFP of wild-type embryos. Our favoured
interpretation of this phenotype is that Foxa2 regulates floorplate
differentiation. The requirement of Foxa2 for maintained expression of
floorplate regulatory genes is unequivocal. However, our interpretation of a
requirement for Foxa2 during floorplate differentiation is based upon the
assumption that the floorplate of mol-/- embryos shares
identity with the MFP of wild-type embryos (and that loss of MFP
differentiation markers therefore reflects a failure in floorplate
differentiation). If instead, Foxa2 mediates induction of MFP, then the
absence of MFP differentiation markers would reflect the absence of the MFP
rather than a failure in differentiation.
There are two lines of evidence that make us favour the idea that Foxa2
mediates floorplate differentiation rather than MFP induction. The first is
the absence of severe floorplate defects in mol-/- embryos
until mid-somite stages (for example, the MFP markers twhh, her9 and
ntn1 are expressed as in wild type). This suggests that a structure
equivalent to the MFP of wild-type embryos is initially present in
mol-/- embryos. Second, disrupting Hh activity in
mol-/- embryos fails to completely abolish the floorplate
that remains. As LFP induction in zebrafish is reliant on Hh pathway
signalling (Odenthal et al.,
2000
; Etheridge et al.,
2001
), then if the residual floorplate in
mol-/- embryos was equivalent to LFP of wild-type embryos,
we would expect that abrogating Hh activity should result in complete loss of
floorplate identity. As this does not happen, then we think that the
mol-/- floorplate is more similar to the Nodal
pathway-induced MFP than the LFP of wild-type embryos. Together, these
observations support the conclusion that floorplate induction occurs in
mol-/- embryos but differentiation fails.
Although we suggest that the floorplate in mol-/-
derives from MFP precursors, it does appear to abnormally express markers
normally restricted to LFP. nk2.2a and nkx2.2b have both
been considered as LFP markers as their expression is excluded from MFP
(Strähle et al., 2004
;
Schäfer et al., 2004
) and
both genes show some patchy and/or reduced expression in the ventral midline
spinal cord of mol-/- embryos. Similarly, in late stage
cyc-/- mutant embryos, floorplate tissue expresses a
combination of MFP and LFP markers (Albert
et al., 2003
). Ventral CNS Nk2 genes are regulated between
thresholds of Hh activity (e.g. Jacob and
Briscoe, 2003
) and the altered spatial expression of
nk2.2a and nkx2.2b in mol-/- embryos may
reflect the lowered levels of Hh activity in the mutants. Taken together, our
results suggest that the floorplate in mol-/- embryos is
derived from MFP, but exhibits some gene expression characteristics of the LFP
of wild-type embryos.
The mechanisms by which Foxa2 regulates floorplate differentiation are
likely to be both directly through binding to the regulatory regions of
floorplate differentiation genes and indirectly through the transcriptional
control of regulatory genes (e.g. Chang et
al., 1997
; Müller et al.,
1999
; Rastegar et al.,
2002
; Epstein et al.,
1999
). For example, the reduction of foxa2 expression in
mol-/- mutants suggests that positive autoregulation by
Foxa2 activity is required to maintain foxa2 expression. Analysis of
the expression of other class 1 Fox family members (foxa, foxa1)
revealed a similar dependence on Foxa2 activity and so all these transcription
factors, and probably others, may mediate Foxa2-dependent floorplate
differentiation. Although Foxa2 regulates expression of Hh genes, these are
unlikely to play a significant role in MFP differentiation as this occurs
normally in embryos with severely reduced Hh signalling
(Etheridge et al., 2001
;
Chen et al., 2001
;
Varga et al., 2001
).
Foxa2 functions in the lateral expansion of the floorplate
Although a floorplate forms in mol-/- mutants, it never
expands laterally to acquire the full width of floorplate tissue of wild-type
embryos. The lateral expansion of the floorplate is a hh-dependent
process in zebrafish (Odenthal et al.,
2000
) and probably in chick
(Charrier et al., 2002
) and
other vertebrates. Various studies have suggested that Foxa2 (and/or highly
related genes) functions in a positive regulatory loop with Hh genes, whereby
Hh gene activity induces foxa2 expression and Foxa2 activity promotes
hh expression (reviewed by
Strähle et al., 2004
).
This model was originally proposed to explain how Hh signals from the
notochord could induce foxa2 in the floorplate that would in turn
induce hh expression in floorplate cells. In zebrafish, the initial
induction of foxa2 in the prospective floorplate is dependent upon
Nodal, rather than Hh, activity (discussed in
Strähle et al., 2004
),
but as we discuss below, the regulatory loop between Hh and Foxa2 proteins may
contribute to the failure of lateral expansion of floorplate tissue in
mol-/- embryos.
The absence of lateral cells with floorplate identity in
mol-/- suggests that Foxa2 usually has a role in both MFP
and in LFP precursors. We suggest that Nodal signals initially induce Foxa2
expression but in the absence of Foxa2 activity, there is a progressive loss
of Hh expression in the floorplate. As a consequence, the reduced levels of Hh
activity in the MFP may be insufficient to induce (or maintain) LFP identity.
However, the absence of laterally positioned floorplate cells in
mol-/- embryos is unlikely to be due solely to reduced Hh
activity within the floorplate. For example, at early stages, transcription of
hh genes appears to be normal in mol-/- embryos.
Indeed, LFP cells can still form in cyc mutant embryos that lack MFP,
suggesting that Hh signals from other sources are sufficient to induce LFP
(e.g. Albert et al., 2003
).
Furthermore, overexpression of shh fails to restore the full width of
the floorplate in mol-/- mutant embryos suggesting that
Foxa2 function is required within LFP cells for these cells to differentiate
with floorplate identity.
Foxa2 activity may limit the range of Hh activity
Within the midbrain and hindbrain, loss of Foxa2 activity leads to
reduction of ntn1 and nk2.2a expression in ventral CNS
cells, but surprisingly there is variable ectopic activation of both genes in
dorsal cells close to the ventricle. This implies that the normal activity of
Foxa2 is required to limit the activation of these genes to cells at, or close
to, the midline. Both nk2.2a (e.g.
Barth and Wilson, 1995
;
Varga et al., 2001
) and
ntn1 (e.g. Müller et al.,
2000
) are regulated by Hh activity and so we predict that the
ectopic expression of these genes is due to ectopic activation of the Hh
signalling pathway. This idea is supported by the observation that abrogation
of Shh activity in mol-/- embryos reduces the ectopic
nk2.2a and ntn1 expression. Although a dependence on Hh
signalling is evident, all our other analyses suggest that the level of Hh
signalling is considerably reduced in the ventral CNS. How, then, could
reduced levels of Hh activity ventrally lead to ectopic Hh signalling
dorsally?
Hh signalling can negatively regulate Hh target genes through the induction
of genes that limit the range/efficiency of Hh signalling. For example, the
transmembrane protein Patched is induced by Hh signalling and appears to
sequester Hh protein, thereby limiting its range of action. This was elegantly
demonstrated by showing that Hh signals spread more efficiently across clones
of cells expressing a modified form of Patched that fails to bind Hh proteins
(Briscoe et al., 2001
). Other
proteins such as the EXT family members, Tout-velu, Brother of tout-velu and
Sister of tout-velu also regulate the range of activity of Hh signals
(Han et al., 2004
;
Takei et al., 2004
). Therefore
one possibility is that Foxa2 is required to induce proteins that subsequently
limit the range of Hh activity (as expected, patched expression is
severely reduced in mol-/- embryos, data not shown).
Although this is an attractive possibility, the source of Hh proteins that
lead to ectopic activation of nk2.2a and ntn1 is not
obvious. There is very little hh transcription in floorplate cells of
older mol-/- embryos, and so one possibility is that Hh
proteins may come from underlying tissues such as the notochord or even gut
endoderm as has been proposed in other situations
(Wijgerde et al., 2002
). An
alternative possibility is that Hh proteins come from other cells in the CNS.
hh expression is unaffected in the diencephalon and anterior midbrain
of mol-/- embryos. Although these hh expressing
cells are some distance from the site of ectopic expression, the third
ventricle provides a route by which secreted Hh proteins could potentially
move along the AP axis of the CNS. Indeed, the ectopic expression of
nk2.2a and ntn1 is tightly restricted to cells adjacent to
the ventricles.
Foxa2 and Hh signalling regulates induction and patterning of ventral CNS cell populations
mol-/- embryos exhibit a variety of defects in
ventrally positioned cells adjacent to the floorplate, including a severe
reduction in the serotonergic raphé neurones and prospective
oligodendrocytes. There are two possible mechanisms by which Foxa2 could be
involved in the development of these cell types. Specification may be due
either to a direct requirement for Foxa2 within the precursors of the cell
groups or, alternatively/additionally, Foxa2 may regulate signals that
influence cell specification.
Overexpression of exogenous Shh restores some tphR-expressing
prospective raphé neurones in mol-/- embryos,
implying that there probably is not a cell-autonomous requirement for Foxa2 in
the specification of these neurones. Hh signalling is required for
specification of raphé neurones (Ye
et al., 1998
; Teraoko et al., 2004) and so the simplest
explanation of the serotonergic neurone phenotype of
mol-/- embryos is that the reduced levels of Hh activity
lead to a failure in induction of this cell type. It is perhaps surprising
that injection of shh RNA can rescue the raphé neurones given
the short lifetime of the injected RNA and the relatively late appearance of
serotonergic neurones. However, it is currently unknown when serotonergic
neurone precursors are first specified, nor is it known at what stage in the
specification/differentiation of these cells that Hh signalling is
required.
The reduction of expression of mbp, olig2 and plp expression in the hindbrain of mol-/- embryos provides the first evidence that Foxa2 is required for oligodendrocyte development and consequently myelin formation. It is not known if the oligodendrocyte precursors express Foxa2 and we have been unable to determine if the loss of these cells in mol-/- embryos is due to reduced Hh activity (data not shown). Further work will be required to determine how Foxa2 mediates the development of the oligodendrocyte lineage.
Unlike prospective oligodendrocytes and serotonergic neurones, most cranial motoneurones are specified normally in mol-/- embryos. This suggests that Foxa2 is not essential for specification of most motoneurones and that levels of Hh activity are still sufficiently high in mol-/- embryos at the stages at which the motoneurones are induced. The anterior motor nuclei, however, are reduced or absent in mol-/- mutants. We have not resolved whether there is a cell-autonomous requirement for Foxa2 in the specification of these cells.
A revised model of floorplate formation in zebrafish
Taken together, our analyses of the mol-/- mutant and
other studies allow us to revise existing models of floorplate formation in
zebrafish (