|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 16 March 2005
doi: 10.1242/dev.01734
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 Department of Biochemistry, Molecular Biology and Cell Biology; and Robert H.
Lurie Comprehensive Cancer Center, Northwestern University, Evanston, IL
60208, USA
2 Department of Neurology and Institute for Cancer Genetics, Columbia
University, New York, NY 10032, USA
Author for correspondence (e-mail:
clabonne{at}northwestern.edu)
Accepted 2 February 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Xenopus, Neural crest, Id3, Myc, Wnt, Slug, Stem cell
| Introduction |
|---|
|
|
|---|
Understanding how neural crest precursor cells are initially set aside in
the early ectoderm is a matter of profound importance, both because the
mechanisms involved may prove relevant to the development and maintenance of
other stem cell populations, and because the formation of neural crest cells
represents such a fundamental milestone in vertebrate evolution. During the
past few years, significant progress has been made towards understanding this
process. At the tissue level, induction of neural crest precursors at the
lateral edges of the neural plate is thought to be mediated by signals
emanating from the non-neural ectoderm, the non-axial mesoderm or both
(reviewed by LaBonne and Bronner-Fraser,
1999
). Although the precise molecular identities of these signals
have yet to be fully elucidated, evidence from a number of model organisms
suggests that members of the BMP, Wnt, FGF and Notch families all play
essential roles in this process (reviewed by
Heeg-Truesdell and LaBonne,
2004
; Huang and Saint-Jeannet,
2004
).
In particular, there is strong evidence that Wnt-family growth factors play
a direct role in the induction of neural crest progenitor cells. In
Xenopus, inhibition of Wnt signaling by a variety of means, including
overexpression of a dominant-negative Wnt ligand, overexpression of the Wnt
antagonist GSK3 or morpholino depletion of the Wnt receptor Frizzled7, blocks
the earliest steps in the formation of this stem cell population (Saint-Jennet
et al., 1997; LaBonne and Bronner-Fraser,
1998
; Deardorff et al.,
2001
). Moreover, nuclear mediators of the Wnt signaling pathway,
Lef/Tcf-family transcription factors, appear to bind to and directly regulate
the promoter of Slug, an early marker of neural crest progenitors
(Vallin et al., 2001
).
Importantly, although the requirement for Wnt signals during neural crest
induction was first demonstrated in Xenopus, recent reports have
provided strong evidence that Wnt proteins play an analogous role in both
avian and zebrafish embryos (Garcia-Castro
et al., 2002
; Lewis et al.,
2004
).
Expression of the proto-oncogene Myc is one of the earliest
responses to Wnt signaling at the neural plate border, and a recent report
demonstrated that Myc function is required downstream of Wnt signals for the
formation of neural crest precursor cells
(Bellmeyer et al., 2003
).
Interestingly, Myc is also a downstream target of Wnts in colorectal tumors
and embryonic carcinoma cells (He et al.,
1998
; Willert et al.,
2002
), suggesting that the relationship between Wnt and Myc may be
well conserved. Myc and the closely related proteins N-myc (Nmyc1) and L-myc
are basic helix-loop-helix-zipper (bHLHZ) transcription factors. Together, Myc
family proteins have been extensively studied for almost 25 years, and have
been implicated in a plethora of essential cellular processes, including cell
growth, cell proliferation, apoptosis and cellular differentiation
(Grandori et al., 2000
;
Eisenman, 2001
). The bHLHZ
domain possessed by Myc family proteins mediates both their dimerization and
DNA-binding activities, and Myc can bind to E box DNA sequences as a
heterodimer with the small bHLHZ protein Max in order to regulate
transcription. Because Myc misregulation is found in a high proportion of
epithelial cancers and is often associated with aggressive and poorly
differentiated tumors (Nesbit et al.,
1999
), a central focus of the Myc field of research is to
understand the key transcriptional targets that mediate the downstream effects
of this important regulatory protein.
One group of proteins that has been implicated as effectors of Myc-family
proteins in a variety of cell types and cancers are the Ids (inhibitor of DNA
binding). This family of small helix-loop-helix proteins comprises four
related factors (Id1, Id2, Id3 and Id4) that function primarily by negatively
regulating the DNA-binding ability of bHLH transcription factors
(Ruzinova and Benezra, 2003
).
In addition, a subset of Id proteins (Id2 and possibly Id4) can also bind to
Rb and the related pocket proteins p107 and p130 in a cell cycle-regulated
manner, inhibiting the growth suppressive activities of these factors, and
thus promoting entry into S phase
(Lasorella et al., 2000
).
Recently, Id2 has been shown to be an important N-myc effector in
neuroblastoma, a tumor that is derived from the neural crest stem cell
population (Lasorella et al.,
2002
). This important finding suggested that Id proteins might
also be key Myc targets during normal neural crest development.
In Xenopus, at least one Id family member, Id3, is expressed in
neural crest precursors at a time consistent with a role as a Myc effector
(Zhang et al., 1995
;
Liu and Harland, 2003
). Using
morpholino oligo-mediated depletion, we show here that Id3 is required
downstream of Myc for the formation of neural crest stem cells at the neural
plate border. In the absence of Id3, an excess of CNS progenitors forms in
place of neural crest cells. Moreover, we show that the continued expression
of Id proteins in the neural crest leads to the persistent expression of
markers characteristic of multipotent neural crest progenitors, and blocks the
differentiation of neural crest derivatives. These findings suggest that Id3
may play an important role in maintaining the neural crest stem cell
population until the appropriate time for these cells to respond to signals
directing their differentiation.
| Materials and methods |
|---|
|
|
|---|
Morpholino assays
Morpholino oligos designed to target the translation-initiation site of Id3
(5'-ACCGCACTGGGCTGATGGCTTTCAT) were obtained from Gene Tools. To
evaluate the effectiveness and specificity of these oligos in western blot
experiments, embryos were injected with mRNA encoding either XId3, XId2 or
H-Id3 at the two-cell stage and then subsequently re-injected with either Id3
MOs or with control MOs (5'-CCTCTTACCTCAGTTACAATTTATA) at dose of 5
ng/embryo. Embryos were collected at blastula or neurula stages, lysed in
PBS/1%NP40 and extracts resolved by SDS PAGE. Following immunoblotting using
-myc (9E10) antibodies, labeled proteins were detected using
HRP-conjugated secondary antibodies and enhanced chemiluminescence (Amersham).
For embryo experiments, 5 ng of Id3 MO or 5 ng of control MO was injected into
one animal blastomere at the eight-cell stage unless otherwise stated in the
text. No interference with neural crest formation was ever observed in control
MO-injected embryos, even at doses of up to 20 ng/embryo. MOs used to deplete
Myc protein were as previously described
(Bellmeyer et al., 2003
).
Proliferation and TUNEL assays
For phosphohistone H3 detection, Id3 MO-injected embryos were fixed in
formaldehyde at stage 13/14 and processed for ß-gal activity.
-Phosphohistone H3 antibody (Upstate Biotechnology) was used at a
concentration of 5 µg/ml;
-rabbit IgG-conjugated with alkaline
phosphatase (Boehringer Mannheim) was used at 1:1000 and detected with BM
Purple. For TUNEL assays, embryos injected with Id3 MOs or mRNA encoding Id3
were allowed to develop until stage 13/14. TUNEL staining was carried out
using a protocol adapted from Hensey and Gautier
(Hensey and Gautier, 1998
) as
described previously (Bellmeyer et al.,
2003
). Briefly, fixed embryos were rehydrated in PBT and washed in
TdT buffer (Gibco) for 30 minutes. End-labeling was carried out at room
temperature overnight in TdT buffer containing 0.5 µM digoxigenin-dUTP
(Boehringer Mannheim) and 150 U/ml TdT (Gibco). Embryos were washed at
65°C in PBS/1 mM EDTA and detection of the digoxigenin epitope was carried
out as for in situ hybridization. For Id3 depletion experiments, we calculated
the percent total TUNEL-positive nuclei on the injected and control side of
115 embryos from four independent experiments. A nonparametric sign test was
used to reject the null hypothesis that those values differed by more than 5%
(P=0.001).
Western blot and chromatin immunoprecipitation (ChIP) assays
Western blots of 100 µg of whole cell lysates prepared from either adult
human brain or the human glioma cell line T98G were developed using antibodies
against Myc (9E10, Santa Cruz Biotechnology), Id3 (C-20, Santa Cruz
Biotechnology) and
-tubulin (DM1A, Sigma-Aldrich). ChIP analysis was
performed on logarithmically growing T98G cells. Cells were crosslinked with
formaldehyde, chromatin was fragmented by sonication, and protein-DNA
complexes were immunoprecipitated with either 4 µg of polyclonal anti-Myc
antibody (N262, Santa Cruz Biotechnology) or 4 µg of normal rabbit
immunoglobulins. Protein extracts (4 mg), diluted in 600 µl of RIPA buffer,
were used for each immunoprecipitation. Precipitated DNA was analyzed by PCR
using primers flanking the E-box located at position 2895 in the human
Id3 promoter. As a control for the Myc ChIP, we also analyzed the
promoter of the LDL receptor gene (OLR1) that does not contain E-boxes and
does not bind Myc (Fernandez et al.,
2003
). The sequence of the primers used for PCR are: Id3
promoter up, AGAGCGGAGCCAGAGCTCAGACATC; Id3 promoter down,
TGCTTCCAAGGGCTCCACTCTG; LDL Receptor (OLR1) up, ACTGCACCTGGCCAACTTTT; LDL
Receptor (OLR1) down, TGCAAAGAAAAGAATACACAAAGGA.
| Results |
|---|
|
|
|---|
|
Id3 expression partially rescues neural crest formation in Myc-depleted embryos
If Id3 functions, at least in part, downstream of Myc, then it is important
to determine whether Id3 function can compensate for the loss of Myc. We have
previously demonstrated that Myc-depleted embryos can be rescued by injection
of Myc transcripts that cannot be targeted by the morpholino; however, no
rescue of neural crest formation can be achieved by Slug in this type of
experiment (Bellmeyer et al.,
2003
). We therefore asked if expression of Id3 could rescue neural
crest formation in Myc-depleted embryos. As previously reported, embryos
injected with Myc MOs display greatly diminished or absent expression of the
neural crest marker Slug at neural plate stages
(Fig. 1C). By contrast, when
such embryos were also injected with mRNA encoding Id3, a significant rescue
of Slug expression was noted (Fig.
1D). This rescue was not complete, however, as Slug
expression on the injected side was always weaker and more limited in expanse
than on the control side of the embryo. Consistent with this observation, the
later morphological development of Id3 rescued embryos was considerably less
perturbed than that of embryos injected with only Myc MOs, but was never fully
normal (not shown). These findings suggest that although Id3 can partially
compensate for the loss of Myc, there are likely to be other essential
downstream targets.
Id3 is a direct target of Myc
The rescue of Myc depletion by Id3 expression is a significant finding that
indicates that Id3 plays an important role in neural crest formation
downstream of Myc. Nevertheless, these findings do not conclusively
demonstrate that Id3 is a direct Myc target gene. We therefore wished to use
chromatin immunoprecipitation (ChIP) assays in order to determine if Myc
interacts directly with the Id3 promoter in a relevant cell line.
In mammals, the expression of both Myc and Id3 is high in embryonic cells,
typically extinguished in normal adult human tissues and frequently
deregulated in a variety of human neoplasms. With respect to human
neurectodermal tumors, malignant gliomas are among those most frequently
associated with elevated Myc levels (Orian
et al., 1992
; Hirvonen et al.,
1994
). We therefore asked if expression of Myc in the human glioma
cell line T98G might sustain elevated Id3 expression in these cells. Western
blot analysis demonstrates that both Myc and Id3 are expressed at detectable
levels in T98G cells, in contrast to adult human brain tissue
(Fig. 1E), confirming that this
is an appropriate cell line for ChIP analysis. Chromatin was extracted from
logarithmically growing T98G cells, and protein-DNA complexes were
immunoprecipitated using either a polyclonal antibody against Myc or Normal
Rabbit Serum. Precipitated DNA was analyzed by PCR using primers derived from
the Id3 promoter, or from a promoter that lacks E box sequences
(OLR1) as a negative control. Id3 promoter sequences were specifically
amplified from the samples immunoprecipitated with antibodies to Myc
(Fig. 1F), demonstrating that
Myc does directly bind the Id3 promoter in these cells.
Id3 is required for neural crest precursor formation
As ChIP analysis indicated that Id3 is a direct Myc target, we wished to
determine if Id3 function is required for proper neural crest development. To
this end, we designed morpholino oligos (MOs) to specifically deplete Id3
protein and demonstrated that these MOs effectively block translation of Id3
from exogenous mRNAs injected into early Xenopus embryos
(Fig. 2A,B). By contrast,
control MOs had no effect on Id3 translation
(Fig. 2A). Importantly,
although Id3 MOs were found to be strong inhibitors of Xenopus Id3
translation, they did not block the translation of human Id3 mRNAs, which lack
the MO target sequence (Fig.
2B).
|
Our previous findings have demonstrated that in the absence of Myc function, embryos form an excess of central nervous system (CNS) precursors at the expense of neural crest cells. Because Id3 appeared to be functioning downstream of Myc in neural crest formation, we next examined the expression of neural plate markers in Id3-depleted embryos. We found that the expression of both Sox3 and Opl (zic1) was greatly expanded on the injected side of these embryos (Fig. 3A,B). The expanded expression of Opl is noteworthy, as this factor is often described as a neural crest marker. In reality, however, Opl expression marks a region of the early ectoderm that includes both neural crest and dorsal CNS precursors, and in our hands Opl expression is consistently expanded under conditions where neural crest precursors are lost. The expression of Sox3, by contrast, marks all proliferating multipotent CNS progenitors. The expansion of Sox3 expression into neural crest-forming regions in Id3-depleted embryos indicates that, during normal development, Id3 plays a central role in the determination of neural plate versus neural plate border cell fates in the early embryonic ectoderm (Fig. 3A).
|
Id3 injected embryos show increased Slug expression
Given the clear importance of Id3 for neural crest precursor formation, we
next wished to examine the consequences for neural crest development following
upregulation of Id3. Although previous reports had suggested that Id3-, as
well as Id2- or Id4-, injected embryos develop normally with no aberrant
phenotype (Wilson and Mohun,
1995
; Liu and Harland,
2003
), the expression of neural crest markers was not specifically
examined in those studies. Moreover, a recent report has suggested that Id
family proteins are targets for N-terminal ubiquitination, and are rapidly
turned over by the proteasome (Fajerman et
al., 2004
). This same study found that fusion of an epitope tag to
the N terminus of Id2 was sufficient to stabilize that protein. Indeed,
stabilization by N-terminal epitope tags is common for targets of N-end rule
ubiquitination (Varshavsky et al.,
2000
). Based upon this information, we asked if an N-terminally
epitope-tagged form of Id3 would be stably expressed in Xenopus
embryos. We found that with multiple Myc tags fused to its N terminus, Id3
protein was indeed stably expressed, and could be detected by western blots
through at least tailbud stages (Fig.
4A). Furthermore, this degree of stability was in marked contrast
to that of an Id3 protein with multiple Myc tags fused to its C terminus
(Fig. 4A).
|
Because the amount of excess Slug expression on the Id3-injected side of the embryo was so much greater at stage 23 than at stage 13, it seemed highly unlikely that this change in phenotype could be explained by alterations in the rate of cell proliferation or survival. Nevertheless, to formally exclude these possibilities, we compared the numbers of mitotic and apoptotic cells on the control versus experimental side of embryos injected with mRNA encoding Id3. Injected embryos were reared to either stage 13 or stage 23 and then processed for whole-mount TUNEL labeling or anti-phospho-histone H3 immunocytochemistry. No significant differences in staining were observed at either of the stages examined (Fig. 4D,E; not shown). Taken together, these data led us to hypothesize that the excess Slug expression noted in Id3-injected embryos at stage 23 most probably reflected a failure to downregulate the expression of this gene after the onset of neural crest migration.
Id3 maintains expression of markers characteristic of multipotent neural crest progenitors
Slug is a zinc-finger-containing transcriptional repressor that plays a
required role in both the formation of neural crest precursor cells and in the
epithelial-mesenchymal transition that precedes the onset of neural crest
migration (reviewed by Heeg-Truesdell and
LaBonne, 2004
). It is unclear why Slug expression is
downregulated in neural crest cells soon after they become migratory or if
this downregulation is in fact required for normal neural crest development.
Indeed, a closely related and at least partially redundant factor,
Snail, continues to be expressed by neural crest precursors
throughout their migration.
In order to further explore the significance of the observed Id3-mediated
failure to downregulate Slug, we examined the effects of Id3 activity
on the expression of Sox10, a factor implicated in the regulation
neural crest stem cell maintenance
(Paratore et al., 2002
;
Kim et al., 2003
). This
HMG-family transcription factor is initially expressed in all multipotent
neural crest stem cells (Fig.
5A). However, a short time after the onset of migration, at
approximately stage 25, Sox10 expression is turned off in most neural
crest cells as they commit to form specific derivatives. Expression of
Sox10 persists only in the precursors of the peripheral glia and
melanocytes (Fig. 5B), and is
thought to play an instructive role in the development of those two neural
crest derivatives (Mollaaghababa and
Pavan, 2003
).
|
The formation of neural crest derivatives is blocked in Id3-expressing cells
If Id3 functions to maintain neural crest cells in a progenitor state then,
consequentially, it should have a significant inhibitory effect on the
formation of neural crest derivatives. We therefore characterized the effects
of Id3 on the differentiation of two neural crest-derived cell types,
melanocytes and cartilage. Embryos were injected in either one or both cells
at the two-cell stage with mRNA encoding the N-terminally tagged Id3, and then
reared to stages when melanocyte formation could be assessed. Embryos injected
unilaterally showed a significant decrease in the number of melanocytes on the
Id3 expressing side of the embryo (Fig.
6A). During normal development, a significant fraction of
melanoblasts migrate to the side of the embryo contralateral to where they
initially formed. This contralateral migration can make it difficult to assess
the full extent of the block to melanocyte formation in unilaterally injected
embryos. We therefore carried out experiments in which embryos were injected
bilaterally, and here we observed profound deficits in melanocyte number
relative to sibling control embryos (Fig.
6B,C). Moreover, these Id3-injected embryos also had reduced or
absent dorsal fins, a structure whose formation is neural crest-dependant
(Fig. 6B,C).
|
Promotion of neural crest progenitor fate is a conserved activity of Id family proteins
The ability of Id3 to maintain neural crest cells in a multipotent stem
cell-like fate has important implications for both normal neural crest
development and for the formation of neural crest-derived tumors. Indeed, one
Id family member, Id2, functions downstream of N-myc during the development of
neuroblastomas, which are cancers of neural crest progenitor cells
(Maris and Matthay, 1999
). Id2
has been more extensively studied than has Id3, and importantly, it is thought
to have some activities distinct from Id1 and Id3. All four Id family proteins
can act as naturally occurring dominant-negative transcription factors by
forming non-functional heterodimers with targeted proteins and prevent those
proteins from binding DNA. However, Id2, and possibly Id4, can also bind to
Rb-family pocket proteins and block their cell cycle-inhibitory activities,
thus promoting entry into S phase
(Lasorella et al., 2001
).
Because Id2, rather than Id3, has been closely linked to neuroblastoma, it was important to determine if the ability of Id3 to promote neural crest progenitor fate was a conserved function of Id-family proteins or was an activity unique to Id3. To this end, we asked if an N-terminally tagged form of Xenopus Id2 could phenocopy the effects of Id3. Indeed, we found that forced Id2 expression led to the persistent expression of Sox10 in later stage embryos in a manner indistinguishable from what we had observed for Id3 (Fig. 7A,B). Because the functional differences between Id2 and Id3 have only been examined for the mammalian proteins, we confirmed this finding by repeating the experiment with N-terminally epitope tagged forms of Human Id2 and Id3. Again, we found that forced expression of either of these proteins resulted in maintenance of a gene expression profile consistent with the persistence of a precursor state (Fig. 7C-F; not shown). Because Id3 is unable to bind Rb-related proteins, the general ability of Id family proteins to promote a neural crest progenitors fate is most probably due to their ability to inhibit the DNA binding activity of one or more proteins involved in neural crest cell fate diversification.
|
Significantly, we were able to identify a dose of Id3 that caused embryos to develop with a significant excess, rather than a deficit of melanocytes (Fig. 8C) relative to sibling control embryos (Fig. 8A) or those injected with higher doses of Id3 (Fig. 8B). Importantly, embryos injected with either a high or low dose of Id3 displayed persistent expression of Sox10 at stage 26 (not shown), indicating that in both cases the neural crest cells had retained expression of markers of the multipotent progenitor state for some period of time longer than would occur during normal development. Our interpretation of these findings is that once the ectopically provided Id3 protein had turned over to an extent sufficient to allow neural crest cell differentiation, these newly responsive progenitor cells responded to endogenous signals that dictated melanocyte formation. Moreover, because at earlier time points in their development neural crest progenitor cells had been blocked from responding to signals dictating alternative fates, a greater number of these cells were available to commit to a melanocyte fate than would be the case during normal development.
|
| Discussion |
|---|
|
|
|---|
We have previously suggested that Myc, which is strongly expressed at the
neural plate border from mid-gastrula stages, may play an essential role in
preventing premature cell fate decisions in this region of the embryonic
ectoderm. This hypothesis was based upon studies showing that
morpholino-mediated depletion of Myc leads to a loss of neural crest
precursors and derivatives via a mechanism independent of changes in cell
proliferation, apoptosis or growth
(Bellmeyer et al., 2003
). In
the absence of Myc, excess CNS progenitors form in place of the neural crest.
When considering the mechanisms by which Myc may act in eliciting these
effects, we took note of what was known about Myc targets in neural
crest-derived cancers.
Neuroblastomas, which are among the most common solid tumors of childhood,
are of particular significance to our studies because these tumors are derived
from the multipotent neural crest progenitor population, and because they are
frequently associated with misregulation of MYC. Significantly, recent studies
have implicated ID2 as an important MYC target. ID2 expression was found to be
upregulated in neuroblastoma-derived cell lines and tumors with N-myc
amplification (Lasorella et al.,
2000
; Lasorella et al.,
2002
; Raetz et al.,
2003
), while MYC was shown to bind directly to the ID2 promoter in
fibroblasts and epithelial cells using chromatin immunoprecipitation (ChIP)
assays (Lasorella et al.,
2000
; Siegel et al.,
2003
). Our findings that Myc can also bind directly to the Id3
promoter are consistent with the results of a recent genomic screen for high
affinity Myc targets (Fernandez et al.,
2003
). Moreover, it has been reported that viral misexpression of
Id2 leads to excess neural crest production in avian embryos
(Martinsen and Bronner-Fraser,
1998
), providing a link between Id proteins and the neural
crest.
Ids, a family of four (Id1-Id4) naturally occurring dominant-negative
transcription factors that mediate their effects primarily through their
highly conserved HLH domain (Benezra et
al., 1990
; Norton,
2000
), are thought to be important regulators of a range of
epithelial cell types (Coppe et al.,
2003
). These proteins have been shown to bind to, and prevent DNA
binding by, transcription factors of the bHLH, Pax and ETS families
(Benezra et al., 1990
;
Yates et al., 1999
;
Roberts et al., 2001
). In
addition Id2, and possibly Id4, can bind to and interfere with Rb-family tumor
suppressors (Rb, p107 and p130, referred to as `pocket proteins'), and in this
way are proposed to influence both cell cycle progression and tumorigenesis
(Lasorella et al., 2000
). Id2
has been shown to act as a substrate for cyclin A-dependent Cdk2 activity, and
phosphorylation of Id2 on serine 5 may alter its ability to bind and inhibit
specific target proteins (Hara et al.,
1997
).
Although in Xenopus expression of Id2 in neural crest
cells is not observed until migratory stages, another Id family member,
Id3, is expressed in the early ectoderm in a pattern roughly
reminiscent of the expression of Myc
(Wilson and Mohun, 1995
)
(Fig. 1A). We find here that
Id3 is a Myc target that plays an essential role in the formation and
maintenance of neural crest stem cells. Embryos in which Id3 has been depleted
develop without neural crest cells, and in their place an excess of CNS
progenitors form. These findings phenocopy the effects of Myc depletion
(Bellmeyer et al., 2003
).
Moreover, expression of Id3 can significantly rescue the expression of neural
crest markers in Myc-depleted embryos. Together, these findings suggest a
model in which Myc and Id3 may regulate cell fate decisions in the early
embryonic ectoderm by preventing neural plate border cells, such as the neural
crest, from prematurely responding to the signals that are patterning the
adjacent ectoderm.
Following their emigration from the neural tube, early migratory neural
crest cells initially retain their stem cell-like characteristics, including
the potential to contribute to the sensory neuronal, autonomic neuronal,
glial, smooth muscle and ectomesenchymal lineages
(Baroffio et al., 1991
;
Paratore et al., 2002
;
Kim et al., 2003
). However,
these cells soon begin responding to signals that direct their development
into specific neural crest derivatives, as evidenced by the downregulation of
pan-neural crest markers expressed by the early progenitor population, and the
expression of markers characteristic of specific differentiating lineages. We
find that enforced misexpression of Id3 in the migratory neural crest
population maintains the expression of markers characteristic of the
progenitor state, and delays or prevents the differentiation of neural crest
derivatives. For example, Id3-expressing cells sustain robust expression of
Sox10, a factor that has itself been implicated in the maintenance of
stem cell identity (Paratore et al.,
2002
; Kim et al.,
2003
), and Slug, an important regulatory protein
expressed by all neural crest precursor cells
(LaBonne and Bronner-Fraser,
2000
), long beyond the time that most neural crest cells on the
control side of the embryo have downregulated these factors. Importantly, Id3
expression does not appear to irreversibly alter the potential of these cells.
Once their pool of Id3 has turned over, neural crest cells are capable of
responding to signals that direct the formation of specific derivatives such
as melanocytes. These findings suggest a model in which Id family proteins
expressed in the neural crest progenitor pool help control the timing with
which these cells respond to differentiative signals during normal
development. We cannot formally rule out an alternative explanation of our
findings, however, in which Id3 dictates the outcome of neural crest cell fate
determination in a dose-dependant fashion. Future studies might profitably
explore whether controlling the timing of release from Id3 activity can lead
to excess recruitment of neural crest progenitors to fates other than
melanocytes.
Mechanistically, we find that the effects of up- or downregulating Id3 are
independent of changes in the rates of proliferation or apoptosis. Although Id
family members are known to have some divergent activities, we find that both
Id2 and Id3 can maintain neural crest cells in a multipotent progenitor state.
In contrast to Id2 and Id4, Id3 is unable to bind to Rb-family tumor
suppressors (Lasorella et al.,
2001
), making it unlikely that Rb-related mechanisms can explain
the effects of forced Id3 expression. Instead, Id3 probably exerts its effects
by binding to, and inhibiting the activity of, one or more bHLH, Pax or
Ets-family transcription factors necessary for neural crest diversification. A
key challenge for the future will be to identify the physiologically relevant
Id3 targets in normally developing neural crest cells. Moreover, determining
if such factors are also Id targets in neuroblastomas will be an important
avenue of investigation.
Beyond neuroblastomas, a number of other clinically significant cancers,
including melanomas and neuro-epitheliomas, are neural crest derived. In light
of these links, it is noteworthy that, in addition to Myc and Id proteins,
other regulators of early neural crest development, including Slug, Snail,
Twist and Sip1, are also misregulated in human cancers
(Batlle et al., 2000
; Rosivatz
et al., 2000; Yang et al.,
2004
) (reviewed by
Heeg-Truesdell and LaBonne,
2004
). These striking molecular parallels suggest that by
determining the mechanisms by which factors such as Id3 regulate the normal
development of neural crest cells, we will also gain important insight into
their related roles in tumorigenesis.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Baroffio, A., Dupin, E. and le Douarin, N. M. (1991). Common precursors for neural and mesectodermal derivatives in the cephalic neural crest. Development 112,301 -305.[Abstract]
Batlle, E., Sacho, E., Franci, C., Dominguez, D., Monfar, M., Baulide, A. and Garcia de Herreros, A. (2000). The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumour cells. Nat. Cell Biol. 2, 84-89.[CrossRef][Medline]
Bellmeyer, A., Krase, J., Lindgren, J. and LaBonne, C. (2003). The protooncogene c-Myc is an essential regulator of neural crest formation in Xenopus. Dev. Cell 4, 827-839.[CrossRef][Medline]
Benezra, R., Davis, R. L., Lockshon, D., Turner, D. L. and Weintraub, H. (1990). The protein Id: a negative regulator of helixloophelix DNA binding proteins. Cell 61,49 -59.[CrossRef][Medline]
Coppe, J. P., Smith, A. P. and Desprez, P. Y. (2003). Id proteins in epithelial cells. Exp. Cell Res. 285,131 -145.[CrossRef][Medline]
Deardorff, M. A., Tan, C., Saint-Jeannet, J. P. and Klein, P. S. (2001). A role for frizzled 3 in neural crest development. Development 12,3655 -3663.
Eisenman, R. N. (2001). Deconstructing myc.
Genes Dev. 15,2023
-2030.
Fajerman, I., Schwartz, A. L. and Ciechanover, A. (2004). Degradation of the Id2 developmental regulator: targeting via N-terminal ubiquitination. Biochem. Biophys. Res. Commun. 314,505 -512.[CrossRef][Medline]
Fernandez, P. C., Frank, S. R., Wang, L., Schroeder, M., Liu,
S., Greene, J., Cocito, A. and Amati, B. (2003). Genomic
targets of the human c-Myc protein. Genes Dev.
17,1115
-1129.
Garcia-Castro, M. I., Marcelle, C. and Bronner-Fraser, M. (2002). Ectodermal Wnt function as a neural crest inducer. Science 29,848 -851.
Grandori, C., Cowley, S. M., James, L. P. and Eisenman, R. N. (2000). The Myc/Max/Mad network and the transcriptional control of cell behavior. Annu. Rev. Cell Dev. Biol. 16,653 -699.[CrossRef][Medline]
Hall, B. K. and Hörstadius, S. (1988). The Neural Crest. Oxford, UK: Oxford University Press.
Hara, E., Hall, M. and Peters, G. (1997). Cdk2-dependent phosphorylation of Id2 modulates activity of E2A-related transcription factors. EMBO J. 16,332 -342.[CrossRef][Medline]
He, T. C., Sparks, A., Rago, C., Hermeking, H., Zawel, L., da
Costa, L., Morin, P., Vogelstein, B. and Kinzler, K. W.
(1998). Identification of c-MYC as a target of the APC pathway.
Science 281,1509
-1512.
Heeg-Truesdell, E. and LaBonne, C. (2004). A slug, a fox, a pair of sox: transcriptional responses to neural crest inducing signals. Birth Defects Res. Part C 72,124 -139.
Hensey, C. and Gautier, J. (1998). Programmed cell death during Xenopus development: a spatio-temporal analysis. Dev. Biol. 203,36 -48.[CrossRef][Medline]
Hirvonen, H. E., Salonen, R., Sandberg, M. M., Vuorio, E., Västrik, I., Kotilainen, E. and Kalimo, H. (1994). Differential expression of myc, max and RB1 genes in human gliomas and glioma cell lines. Br. J. Cancer 69, 16-25.[Medline]
Huang, X. and Saint-Jeannet, J. P (2004). Induction of the neural crest and the opportunities of life on the edge. Dev. Biol. 275,1 -11.[CrossRef][Medline]
Kim, J., Lo, L., Dormand, E. and Anderson, D. J. (2003). SOX10 maintains multipotency and inhibits neuronal differentiation of neural crest stem cells. Neuron 38, 17.[CrossRef][Medline]
Knecht, A. K. and Bronner-Fraser, M. (2002). Induction of the neural crest: a multigene process. Nat. Rev. Genet. 3,453 -461.[CrossRef][Medline]
LaBonne, C. and Bronner-Fraser, M. (1998). Neural crest induction in Xenopus: evidence for a two signal model. Development 125,2403 -2411.[Abstract]
LaBonne, C. and Bronner-Fraser, M. (1999). Molecular mechanisms of neural crest formation. Annu. Rev. Cell Dev. Biol. 15,81 -112.[CrossRef][Medline]
LaBonne, C. and Bronner-Fraser, M. (2000). Snail-related transcriptional repressors are required in Xenopus for both the induction of the neural crest and its subsequent migration. Dev. Biol. 221,195 -205.[CrossRef][Medline]
Lasorella, A., Noseda, M., Beyna, M., Yokota, Y. and Iavarone, A. (2000). Id2 is a retinoblastoma protein target and mediates signalling by Myc oncoproteins. Nature 407,592 -598.[CrossRef][Medline]
Lasorella, A., Uo, T. and Iavarone, A. (2001). Id proteins at the cross-road of development and cancer. Oncogene 20,8326 -8333.[CrossRef][Medline]
Lasorella, A., Boldrini, R., Dominici, C., Donfrancesco, A.,
Yokota, Y., Inserra, A. and Iavarone, A. (2002). Id2 is
critical for cellular proliferation and is the oncogenic effector of N-myc in
human neuroblastoma. Cancer Res.
62,301
-306.
Le Douarin, N. and Kalcheim, C. (1999).The Neural Crest, 2nd edn. Cambridge, UK: Cambridge University Press.
Lee, H. Y., Kleber, M., Hari, L., Brault, V., Suter, U., Taketo,
M. M., Kemler, R. and Sommer, L. (2004). Instructive role of
Wnt/beta-catenin in sensory fate specification in neural crest stem cells.
Science 303,1020
-1023.
Lewis, J. L., Bonner, J., Modrell, M., Ragland, J. W., Moon, R.
T., Dorsky, R. I. and Raible, D. W. (2004). Reiterated Wnt
signaling during zebrafish neural crest development.Development 131,1299
-1308.
Liu, K. J. and Harland, R. M. (2003). Cloning and characterization of Xenopus Id4 reveals differing roles for Id genes. Dev Biol. 264,339 -351.[CrossRef][Medline]
Maris, J. M. and Matthay, K. K. (1999).
Molecular biology of neuroblastoma. J. Clin. Oncol.
17,2264
-2279.
Martinsen, B. J. and Bronner-Fraser, M. (1998).
Neural crest specification regulated by the helix-loop-helix repressor Id2.
Science 281,988
-991.
Mollaaghababa, R. and Pavan, W. J. (2003). The importance of having your SOX on: role of SOX10 in the development of neural crest-derived melanocytes and glia. Oncogene 22,3024 -3034.[CrossRef][Medline]
Nesbit, C. E., Tersak, J. M. and Prochownik, E. V. (1999). MYC oncogenes and human neoplastic disease. Oncogene 118,3004 -3016.
Norton, J. D. (2000). ID helixloophelix proteins in cell growth, differentiation and tumorigenesis. J. Cell Sci. 113,3897 -3905.[Abstract]
Orian, J. M., Vasilopoulos, K., Yoshida, S., Kaye, A., Chow, C. W. and Gonzales, M. F. (1992). Overexpression of multiple oncogenes related to histological grade of astrocytic glioma. Br. J. Cancer 66,106 -112.[Medline]
Paratore, C., Eichenberger, C., Suter, U. and Sommer, L.
(2002). Sox10 haploinsufficiency affects maintenance of
progenitor cells in a mouse model of Hirschsprung disease. Hum.
Mol. Genet. 11,3075
-3085.
Raetz, E. A., Kim, M. K., Moos, P., Carlson, M., Bruggers, C., Hooper, D. K., Foot, L., Liu, T., Seeger, R. and Carroll, W. L. (2003). Identification of genes that are regulated transcriptionally by Myc in childhood tumors. Cancer 98,841 -853.[CrossRef][Medline]
Roberts, E. C., Deed, R. W., Inoue, T., Norton, J. D. and
Sharrocks, A. D. (2001). Id helix-loop-helix proteins
antagonize pax transcription factor activity by inhibiting DNA binding.
Mol. Cell. Biol. 21,524
-533.
Rosivatz, E., Becker, I., Specht, K., Fricke, E., Luber, B.,
Busch, R., Hofler, H. and Becker, K. F. (2002). Differential
expression of the epithelial-mesenchymal transition regulators snail, SIP1,
and twist in gastric cancer. Am. J. Pathol.
161,1881
-1891.
Ruzinova, M. B. and Benezra, R. (2003). Id proteins in development, cell cycle and cancer. Trends Cell Biol. 113,410 -418.
Saint-Jeannet, J., He, X., Varmus, H. E. and Dawid, I. B.
(1997). Regulation of dorsal fate in the neuraxis by Wnt-1 and
Wnt-3a. Proc. Natl. Acad. Sci. USA
94,13713
-13718.
Shah, N. M., Groves, A. K. and Anderson, D. J. (1996). Alternative neural crest cell fates are instructively promoted by TGFbeta superfamily members. Cell 85,331 -343.[CrossRef][Medline]
Siegel, P. M., Shu, W. and Massague, J. (2003).
Mad upregulation and Id2 repression accompany transforming growth factor
(TGF)-beta-mediated epithelial cell growth suppression. J. Biol.
Chem. 278,35444
-35450.
Vallin, J., Thuret, R., Giacomello, E., Faraldo, M. M., Thiery, J. P. and Broders, F. (2001). Cloning and characterization of three Xenopus slug promoters revea