|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 30 November 2005
doi: 10.1242/dev.02160
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DCBM Group, Biology Department, Duke University, Durham, NC 27708, USA
* Author for correspondence (e-mail: dmcclay{at}duke.edu)
Accepted 12 October 2005
| SUMMARY |
|---|
|
|
|---|
Key words: p38, Embryonic axis, Nodal, Gsc
| INTRODUCTION |
|---|
|
|
|---|
The sea urchin embryo develops into a bilaterally symmetric pluteus larva
with a three-part gut and a skeleton. The animal-vegetal axis is maternally
established, and consequent post-fertilization events lead to asymmetrical
ß-catenin nuclearization in the vegetal territory. ß-catenin in turn
initiates an endomesodermal gene regulatory network (GRN) that establishes the
vegetal embryonic territories (Logan et
al., 1999
; Davidson et al.,
2002
). By contrast, the oral/aboral (OA) axis is not maternally
determined, as isolated blastomeres from 2- or 4-cell embryos develop into
small but otherwise normal larvae
(Driesch, 1892
;
Cameron et al., 1996
).
Specification of the OA axis also depends on ß-catenin nuclearization
(Wikramanayake et al., 1998
;
Logan et al., 1999
), although
this is might be an indirect requirement, reflecting a need for prior
induction of the endomesodermal GRN to initiate OA specification.
Nodal is the earliest known protein capable of inducing oral specification.
Nodal is upstream from the transcriptional repressor Gsc, which is
functionally implicated as regulator of oral specification
(Angerer et al., 2001
). Gsc is
upstream from the oral transcriptional activator Deadringer (Dri), and
represses the aboral transcription factor Tbx2/3
(Amore et al., 2003
;
Croce et al., 2003
;
Duboc et al., 2004
). The
initial asymmetry that eventually induces Nodal expression in the oral
territory is unknown, although the asymmetrical distribution of mitochondria
along the OA axis is a strong candidate
(Coffman et al., 2004
). Nodal
is expressed on the oral side of the embryo, which is enriched in
mitochondria; furthermore, embryos cultured under hypoxic conditions fail to
express Nodal (Coffman et al.,
2004
), suggesting a causal role for redox potential.
Mitochondrial-derived reactive oxygen intermediates have been previously shown
to activate p38 MAPK (Ushio-Fukai et al.,
1998
; Kulisz et al.,
2002
; Lee et al.,
2002
), a protein kinase known to participate in axis specification
or tissue polarization in various organisms
(Suzanne et al., 1999
;
Fujii et al., 2000
;
Goswami et al., 2001
).
MAPKs are divided into two families: growth factor-activated (ERK) and
stress-activated kinases (JNK and p38). Although identified as a stress
responder, p38 conveys a variety of signals, including conventional growth,
migratory and death signals, as well as responding to environmental and
mechanical stimuli, such as UV light, hyperosmolarity and redox changes
(Shi and Gaestel, 2002
). These
signals induce phosphorylation of p38, which triggers both its translocation
to the nucleus and the activation of its catalytic function. This transduction
mechanism is distinct from that of other signaling pathways, in which
transcription factors rather than kinases relocate from the cytoplasm to the
nucleus, for example ß-catenin, SMADs, and NF
B. This is clearly an
ancient and important means of signaling, as MAPKs are well conserved from
yeast to mammals. The purpose of this study was to determine the role of p38
MAPK in sea urchin development. The results show that p38 is required for both
OA specification and Nodal expression.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Macroarray, subtractive hybridization and LvGsc cloning
A Lytechinus variegatus midgastrula cDNA phage library was excised
in bulk to provide bacterial colonies for the macroarray, which was produced
using the QBOT robot at the Beckman Institute (Caltech, Pasadena, CA), as
described previously (Rast et al.,
2000
). PolyA-selected RNA from mesenchyme blastula-stage control
and SB-treated embryos was used for the subtractive hybridization, which was
performed as described previously (Rast et
al., 2000
). Macroarray filters were probed before and after
subtraction. Clones enriched after subtraction were sequenced and subjected to
BLAST searching for identification. A full-length clone of LvGsc was
identified (Accession Number AY445030), and the ORF was subcloned for mRNA
synthesis.
LvNodal cloning
Low degeneracy primers obtained by comparison of the ORFs for
Paracentrotus lividus Nodal (PlNodal)
(Duboc et al., 2004
) and
Strongylocentrotus purpuratus Nodal (SpNodal) (provided by T. Lepage)
were used to amplify a 1 kb fragment of L. variegatus Nodal
(LvNodal). The full-length LvNodal (Accession Number DQ017963) was obtained by
5' and 3' RACE (Ambion).
Other constructs
A partial clone of LvDri was identified in the subtraction screen. A
plasmid encoding human MKK6E was provided by Dr P. Scherer, and the insert was
subcloned into pCS2 for mRNA synthesis.
Animals, injections and drug treatments
L. variegatus adults were obtained from Susan Decker (Hollywood,
FL), Sea Life (Tavernier, FL), or from the Duke University Marine Laboratory
at Beaufort, NC. Gametes were harvested, cultured and injected by standard
methods. For 2-cell stage injections, rhodamine-conjugated dextran was
co-injected to label the injected cell. mRNA was transcribed in vitro using
the mMessage mMachine Kit (Ambion). LvNodal-specific MASO (sequence
TGCATGGTTAAAAGTCCTTAGAGAT) was obtained from Gene Tools. SB203580 (SB) was
obtained from Calbiochem. SB (20 µM) was added to cultures during early
cleavage stages, unless otherwise noted. Treatment with DMSO vehicle had no
effect (not shown). Doses for these reagents were determined by dose-response
experiments.
In situ hybridization
In situ hybridization was performed using standard methods, with
DIG-labeled full-length RNA probes and NBT/BCIP or BM purple colorization
(Roche). Hybridizations and washes were carried out at 65°C.
Immunostaining
Embryos were fixed, stained and imaged as described
(Gross et al., 2003
), using
CY3-labeled secondary antibodies (Jackson Laboratories) and PBS+0.1% Tween 20
throughout.
Western blotting
Total cell lysate (100 µg) was separated by electrophoresis on 10%
SDS-PAGE gels, then transferred to nitrocellulose membranes and probed, as
described previously (Bradham et al.,
1998
).
P-p38 staining
Embryos were fixed in 2% paraformaldehyde, 25 mg/ml sodium periodate, 135
mg/ml lysine, 18 mM Na2HPO4, 20 µM
ß-glycerophosphate, 10 µM 2-nitrophenylphosphate and 50 µM sodium
orthovanadate in sea water, then permeablized in PBS+0.1% Triton X-100.
Staining was performed as described (Gross
et al., 2003
). Embryos were incubated in primary antibody at a
dilution of 1:10 (P-p38, Cell Signaling Technology), and PBS+0.1% Triton X-100
was used throughout. Hoechst's dye (Molecular Probes) was included in the
final wash at 10 µg/ml.
DiI labeling and live confocal microscopy
DiI (C18, Molecular Probes) was transferred to blastomeres at the 4-cell
stage by iontophoresis, as described previously
(Logan and McClay, 1997
). For
live imaging, embryos were sealed between protamine sulfate-coated glass
slides and coverslips filled with sea water, then imaged using confocal
microscopy with z-series images collected at 10-minute intervals.
QPCR analysis
Total RNA was prepared from 10 embryos using Trizol (Invitrogen) and
glycogen carrier (Ambion). The sample was used for reverse transcriptase (RT)
reactions with Taqman RT-PCR kits (Applied Biosystems) after pretreatment with
DNase I (DNA-free, Ambion). QPCRs were performed using a LightCycler
Instrument and a Fast Start SYBR Green PCR Kit (Roche). Results were
calculated by subtracting the sample CT (crossing point threshold)
from the control CT to determine
CT, then
normalizing to ubiquitin.
| RESULTS |
|---|
|
|
|---|
and
ß subtypes, rather than the
and
subtypes (not shown). MAPKs are typically regulated not by transcriptional control, but rather by phosphorylation. Not surprisingly, QPCR analysis of Lvp38 indicated that relative p38 mRNA levels vary by less than twofold from the egg to the hatched blastula stage, with moderately higher levels expressed at later stages (data not shown). Overexpression of wild-type p38 had no effect on development (not shown), as expected for a protein regulated by post-translational mechanisms.
Inhibition of p38 activity blocks oral-aboral but not endomesodermal specification
Like all MAPKs, p38 is activated by phosphorylation on conserved T and Y
residues. Dominant-negative Lvp38 was generated by mutating the
phosphoacceptor motif TGY to AGF to produce kinase-inactive (KI) p38. These
mutations effectively block mammalian p38 activation
(Raingeaud et al., 1995
). In
parallel, the well-established, highly specific p38 inhibitor SB203580 (SB)
(Tong et al., 1997
;
Davies et al., 2000
) was used
to inhibit p38 activity. Extensive characterization has shown that SB is among
the most specific of the kinase inhibitors currently available
(Davies et al., 2000
); this
specificity is illustrated by the fact that mammalian p38 was independently
identified on the basis of binding to SB
(Lee et al., 1994
).
SB binds to the ATP-binding pocket of human p38
(Young et al., 1997
). The
crystal structure of human p38 complexed with SB shows that nine residues
specifically interact with SB (Wang et
al., 1998
). Of those nine residues, seven are identical in Lvp38,
while an additional residue is similar
(Fig. 1A, green boxes). The
dissimilar residue (His 107) forms only secondary contacts with SB
(Wang et al., 1998
). SB also
makes non-specific contacts (i.e. hydrophobic and van der Waal's contacts)
with five ß-sheets and one
-helix in human p38
(Wang et al., 1998
). The
alignment shows that these elements are 80% identical and 83% similar in Lvp38
(Fig. 1A, gray boxes),
suggesting that SB is likely to interact similarly with Lvp38 and human
p38.
Activating mutants of p38 have not been described; in tissue culture
systems, constitutive activation of the p38 pathway is often accomplished by
the expression of activated MKK6, a kinase immediately upstream from p38
(Raingeaud et al., 1996
).
Unfortunately, attempts to inject mRNA encoding activated MKK6 resulted in the
rapid death of embryos across a wide range of mRNA doses (ranging to 0.001
pg/pl, not shown). This suggests that precocious activation of p38 is not
compatible with survival.
|
PMC ingression is followed by the invagination of the archenteron. Morphological assessment shows that invagination was delayed in SB-treated embryos (Fig. 1C3,C4), but was completed at the pluteus stage (Fig. 1C5,C6), at which point the SB-treated embryos resembled normal late-gastrula stage embryos (Fig. 1C3). Both control and SB-treated embryos expressed FoxA in the endodermal compartment (Fig. 1D3,D4), indicating that p38 is not required for endoderm specification or invagination movements. Secondary mesenchyme cells (SMCs) are localized at the invaginating tip of the archenteron and delaminate from the archenteron during gastrulation, giving rise to various cell types including pigment cells. KI-injected (not shown) and SB-treated embryos were pigmented (see Fig. 2A2), indicating that p38 is not required for SMC specification and differentiation. Together, these results indicate the p38 does not play a role in endomesoderm specification or differentiation.
To assess the ectoderm, embryos were labeled with the aboral marker 1c10 (Fig. 1E). Both KI-overexpressing (Fig. 1E2) and SB-treated embryos (Fig. 1E3) expressed the 1c10 antigen uniformly and robustly, suggesting that such embryos are aboralized. This contention is strengthened by the observation that the oral stomadeal component of FoxA expression is absent in SB-treated embryos (Fig. 1D3,D4). Together, these data suggest that p38 activity is specifically required for skeletogenesis and for the establishment of the oral territory.
p38 activity is required for expression of oral-specific genes
Because p38 inhibition resulted in aboralization, the relationship between
p38 and known oral-specific genes was assessed
(Fig. 2). L.
variegatus clones of Nodal (LvNod) and Goosecoid (LvGsc) were obtained.
The Tgfß family member LvNod encoded a protein 71.6% and 74.6% identical
to PlNod and SpNod proteins, respectively, whereas the mature cleaved form is
86.9% and 82.5% identical, respectively, to PlNod and SpNod. LvGsc was
independently identified in a subtraction screen as a p38 target gene. LvGsc
protein is 83% identical to SpGsc.
Overexpression of LvNod (Fig.
2A3) and LvGsc (Fig.
2A4) produced phenotypes consistent with those previously
published in other sea urchin species
(Angerer et al., 2001
;
Duboc et al., 2004
;
Flowers et al., 2004
).
Whole-mount in situ analysis showed no expression of LvNod or LvGsc in
SB-treated embryos (Fig. 2B).
KI-p38 expression also significantly inhibited both Nodal and Gsc expression,
as assessed by QPCR analysis (not shown). Thus, p38 activity is required for
the expression of both Nodal and Gsc at late embryonic stages.
|
Late blastula stage is the end point of the p38 requirement for oral specification
To evaluate the timing of p38 activation, embryos were treated with SB at
different stages, then cultured to the pluteus larva stage and assessed
(Fig. 3A). These experiments
are based on the logic that once p38 has activated its targets, addition of
the inhibitor will have no further effect. Addition of SB up to hatched
blastula stage (7 hpf) blocked skeletogenesis
(Fig. 3B1,B2), whereas later
addition of SB had no effect (Fig.
3B3,B4). These results indicate that the requirement for p38
activity extends to the hatched blastula stage with respect to
skeletogenesis.
Comparison of embryos inhibited at early blastula and hatched blastula shows a subtle difference in morphology, as embryos treated at early blastula display a completely radialized phenotype (Fig. 3B1), whereas embryos treated at hatched blastula (Fig. 3B2) show some OA character, as indicated by the asymmetrical appearance of both skeletal initiations and arm buds. This suggested that p38 inhibition at early blastula blocked OA axis specification, whereas inhibition at hatched blastula did not.
|
SB removal reveals a patterning defect
To test the reversibility of p38 inhibition, SB-treated embryos were washed
from the inhibitor at different timepoints and the embryos were cultured to
the pluteus stage (Fig. 4A).
When SB was removed prior to the mesenchyme blastula stage, normal pluteus
larvae were produced, demonstrating that SB treatment is reversible. However,
washouts at or after the mesenchyme blastula stage (`SB-wash') resulted in
embryos with abnormal skeletal patterning
(Fig. 4B). The patterning
defects were dramatic, with each embryo showing a unique pattern
(Fig. 4B2,B3, compare with
Fig. 1A1). Such skeletal
patterning defects are characteristic of OA axial defects
(Hardin et al., 1992
;
Croce et al., 2003
;
Gross et al., 2003
), because,
although the skeleton is secreted by the PMCs, the skeletal pattern arises in
response to spatial cues within the ectoderm
(Armstrong et al., 1993
;
Malinda and Ettensohn, 1994
).
Thus, the patterning defects are again consistent with p38 functioning in OA
axis specification. Quantitation of the washout experiments demonstrates that
the change from normal to abnormal recovery occurred abruptly at the
mesenchyme blastula stage (Fig.
4B1). At first glance, these results might suggest that p38
activity is still important for OA specification at mesenchyme blastula stage;
however, the timecourse data in Fig.
3 show that addition of SB at mesenchyme blastula has no effect,
indicating that p38 activity is unnecessary at this stage
(Fig. 3B4). Thus, although the
consequences of p38 inhibition become irreversible at mesenchyme blastula, p38
activity itself is no longer required at this stage.
One explanation for these observations is that Nodal and Gsc expression
recover once SB is removed, but with removal at and after mesenchyme blastula,
the recovery is too slow to restore normal axial patterning. Accordingly, the
recovery of Nodal and Gsc expression in SB-wash embryos was assessed by QPCR
analysis (Fig. 4C). Nodal
expression in controls is biphasic, with reduced levels at late gastrula
stage, consistent with results in P. lividus embryos
(Duboc et al., 2004
)
(Fig. 4C1). Gsc expression
increases steadily from hatched blastula to pluteus stage in control embryos
(Fig. 4C2). SB treatment
significantly inhibited both Nodal and Gsc expression
(Fig. 4C1,C2), consistent with
the in situ results. Nodal recovered quickly to control levels in SB-wash
embryos (Fig. 4C1), but Gsc
recovered more slowly, and did not return to control levels until the pluteus
stage (Fig. 4C2). This is
consistent with the explanation that in SB-wash embryos, the recovery of Gsc
expression is too late to restore normal OA specification and the consequent
skeletal patterning.
|
The phospho-specific antibody was next used to assess the spatial localization of activated p38 (Fig. 5B). Uniform nuclear P-p38 staining was observed as early as the 60-cell stage, consistent with the western blot data (not shown). Prior to 5.5 hpf (late blastula stage), P-p38 was present in all nuclei (Fig. 5B1). At 5.5 hpf, P-p38 was cleared from nuclei on one side of the embryo (Fig. 5B2). Forty-five minutes later, P-p38 had recovered its ubiquitous distribution (Fig. 5B3). Nuclear staining with Hoechst's dye (Fig. 5B4-B6) confirmed that the P-p38 nuclear clearance did not reflect a nuclear disruption or a visualization artifact. The cleared area arose at late blastula stage and persisted for less than one hour. Thus, p38 activity is spatially asymmetric for a brief interval corresponding to the late blastula stage.
To independently corroborate this observation, a Lvp38-EGFP fusion construct (p38-GFP) was employed to permit the live imaging of p38 activity in the embryo as a function of nuclear localization, as the activated kinase is nuclear, whereas the inactive kinase is cytoplasmic. Embryos expressing p38-GFP developed normally (not shown). Live confocal timecourse experiments showed that p38-GFP was transiently cleared from nuclei on one side of the embryo, confirming the staining results above (n=8/10, Fig. 5C). In these experiments, the cleared area persisted for an interval ranging from 30 to 50 minutes. The difference in timing for the onset of clearance in panels B and C reflects the developmental delay caused by microinjection. In both cases, the cleared area arose at 90 minutes prior to hatching.
|
Nodal and Gsc oralize embryos downstream from p38
LvNod expression begins at late blastula stage, which is the same stage
that the asymmetric p38 clearance was observed. Although the evidence
suggested that p38 is upstream from Nodal, it was also possible that Nodal
participates in regulating the clearance of p38 in a feedback loop. If true,
oral Nodal would provide an inducing function to maintain oral p38 activation,
and in the absence of Nodal, p38 would be expected to be cleared uniformly. To
test this possibility, a morpholino-substituted antisense oligonucleotide
(MASO) directed against LvNod (Nod MASO) was employed
(Fig. 6A). Injection of Nod
MASO induced morphological perturbations and skeletal abnormalities at pluteus
stage (Fig. 6A2), consistent
with the effects of anti-Nod MASO in other urchin species
(Duboc et al., 2004
;
Flowers et al., 2004
). To test
whether Nodal participates in establishing the asymmetry of activated p38, Nod
MASO and p38-GFP were co-injected and the embryos were evaluated using live
confocal timecourses, as in Fig.
5. Asymmetric p38 clearance occurred normally
(Fig. 6A3), demonstrating that
Nodal is not involved in maintaining oral p38 activity. The aboral clearance
appears to be somewhat more pronounced in comparison with the results in
Fig. 5; however, this variation
is within the range observed for these experiments. Thus p38 is required for
Nodal expression, but Nodal is not involved in regulating the transient
asymmetry of p38 activity.
|
A similar whole-mount in situ analysis was performed with Gsc injections
(Fig. 7A-C). The results show
that Gsc induced uniform expression of Dri
(Fig. 7B3) and inhibited Tbx2/3
expression (Fig. 7C3), which is
consistent with previous results in other sea urchin species
(Amore et al., 2003
;
Croce et al., 2003
). Gsc did
not affect Nodal expression (Fig.
7A3), which is consistent with previous evidence that Gsc
functions downstream from Nodal (Duboc et
al., 2004
). Embryos that were both Gsc-injected and SB-treated
showed uniform Dri expression (Fig.
7B4) and no Tbx2/3 expression
(Fig. 7C4). These data show
that Gsc functions downstream from p38 with respect to these genes. These
embryos showed no Nodal expression (Fig.
7A4), indicating that Gsc could not rescue Nodal expression
downstream from p38, consistent with the relationship
p38>Nodal>Gsc>Dri.
Embryos were stained for the aboral marker 1c10, which strongly labels SB-treated embryos (Fig. 7D2, see also Fig. 2B3), but does not label Gsc-injected embryos (Fig. 7D3), reflecting their aboralized and oralized phenotypes, respectively. If SB treatment aboralizes the embryo and Gsc drives oral specification downstream from p38, then one prediction is that in the presence of SB, Gsc expression in half of the embryo should oralize that half. Accordingly, one blastomere at the 2-cell stage was injected with Gsc mRNA, and the embryos were treated with SB. In such embryos, 1c10 labeled only the uninjected side of the embryo (Fig. 7D4), consistent with this prediction. These results confirm that Gsc oralizes downstream from p38, and indicate that, when expressed asymmetrically, Gsc restores OA polarization in SB-treated embryos.
|
Injection of dye alone into one cell at the 2-cell stage did not restore patterning in SB-wash embryos (Fig. 8A). A similar 2-cell injection of Gsc mRNA in the absence of SB induced autonomous mispatterning on the injected side (Fig. 8B), whereas the uninjected side was patterned normally (compare with Fig. 3B4).
When LvGsc was injected at the 2-cell stage with SB-wash treatment, normal bilaterally symmetric patterning was produced in 69% of the resultant embryos (Fig. 8C), of which 100% expressed Gsc in the oral region (Fig. 8C3). Thus, asymmetrically expressed Gsc is functionally sufficient to restore both specification of the oral territory and patterning of the OA axis downstream from p38. This result also supports the hypothesis that the phenotype of SB-wash embryos (Fig. 4B) results from the delayed recovery of Gsc expression (Fig. 4C2), as spatially and temporally appropriate Gsc expression rescued that phenotype.
Because Gsc is downstream from Nodal, Nodal would be expected to also
rescue axial patterning in this context. Indeed, 2-cell injection of LvNod
followed by SB-wash treatment resulted in normally patterned skeletons with
the same penetrance as LvGsc (Fig.
8D). In these embryos, the oral territory appeared to be expanded.
This effect might be expected, as Nodal is a secreted protein that functions
non-autonomously (Duboc et al.,
2004
). The 70% penetrance of rescue for both Nodal and Gsc may
reflect a differential rescue depending on the orientation of the first
cleavage plane, reported to divide left-right in about 70% of embryos
(McCain and McClay, 1994
;
Summers et al., 1996
).
However, it is just as likely that the 70% rescue simply reflects the nominal
success rate for this experimental system. In either case, these results
indicate that the pathway Nodal>Gsc that operates in the oral ectoderm is
sufficient to specify the oral territory and pattern the OA axis downstream
from p38.
| DISCUSSION |
|---|
|
|
|---|
B homolog, initiates specification of
that territory, whereas in Xenopus and zebrafish, ß-catenin
nuclearization activates dorsal territory specification
(Roth et al., 1989
The results of this study suggest that the specification of the OA axis in
sea urchin embryos relies instead on the asymmetric nuclearization of a
kinase, which, rather than being activated asymmetrically, is instead
inactivated asymmetrically. In other organisms, p38 also plays asymmetric or
polarizing roles during development. In Drosophila, blockade of the
p38 pathway interferes with polarization of the egg through affects on both
oskar localization and gurken expression, resulting in axial defects
(Suzanne et al., 1999
). In
Xenopus, p38 is required for ventral specification of the ectoderm
(Goswami et al., 2001
),
whereas in early zebrafish embryos, p38 is activated asymmetrically on the
future dorsal side of the embryo (Fujii et
al., 2000
). Thus, p38 appears to function broadly in the animal
kingdom in processes that define axial asymmetries.
This study relies extensively on the use of the p38 inhibitor SB, and
therefore the specificity of this reagent is a crucial concern. Although we
cannot rule out that SB interacts with other kinases in the sea urchin,
several lines of evidence indicate that SB specifically inhibits Lvp38.
Fig. 1A shows that the residues
and secondary structural elements of human p38 that interact with SB are well
conserved in Lvp38, suggesting that SB binds Lvp38 in a similar manner.
Furthermore, the optimal dose of SB used in this study (20 µM) is
consistent with doses used in mammalian systems
(Rousseau et al., 2000
;
Takekawa et al., 2000
),
suggesting that SB binds to mammalian and L. variegatus p38 with
similar affinities. In addition, there is a strong temporal agreement between
the effects of SB treatment (Fig.
3) and the measures of p38 activity, particularly for the period
of asymmetry (Fig. 5). Finally,
and most importantly, dominant-negative p38 (KI-p38) phenocopies the effects
of SB treatment with respect to morphology, aboralization, and the inhibition
of Nodal and Gsc expression. Together, these data strongly suggest that SB
inhibits Lvp38 in a specific manner.
|
The discrepancy between the timing of the onset of expression for Nodal in
L. variegatus (late blastula) and P. lividus (60-cell stage)
(Duboc et al., 2004
) is most
likely to be a species difference. Given the striking similarity of LvNodal
and PlNodal function and morphology, this heterochronic difference seems
relatively minor. In P. lividus embryos, it remains to be determined
whether Nodal expression is p38 dependent at an earlier stage, or whether
Nodal is activated by a different mechanism not involving p38. However, in
S. purpuratus embryos, Nodal expression is abrogated by SB treatment,
as it is in L. variegatus embryos (A. Poustka, personal
communication), indicating that the relationship between p38 and Nodal
described herein can be extended to at least one other cold-water urchin
species.
The data indicate that p38 activity is required for Nodal transcription during the period of p38 asymmetric activation, as the asymmetry arises at 5.5 hpf as does the initiation of Nodal expression. This hypothesis is strengthened by the timecourse data in Fig. 3, which show that oral specification becomes p38 independent at approximately 6 hpf, consistent with the end of the period of asymmetric p38 activity. If this is the case, then p38 must activate Nodal through at least one intermediate transcription factor that is a direct target of p38. Given the temporal proximity, a single intermediate factor is plausible. The expression of Nodal must additionally require a temporal cofactor, as p38 is active both before and during the period of asymmetry, whereas Nodal is not expressed before the asymmetry arises. The temporal factor need not be restricted spatially, as activated p38 provides spatial input. The intermediate transcription factor could also serve as the temporal factor if it were expressed only after the clearance of p38 had occurred, perhaps in response to the clearance-inducing event.
|
Several unresolved issues remain. One is the imperfect spatial congruence
of P-p38 and Nodal expression at the time of clearance, as the domain of Nodal
expression is coincident with, but smaller than, the region containing
activated p38. This issue will likely be resolved by the identification of
additional components in the OA gene regulatory network that function to
refine the boundary of Nodal expression. A second issue is the mechanism
underlying the clearance of p38. Resolving this will require learning how p38
is inactivated, whether by a phosphatase, degradation, or the modulation of
nuclear import/export, as well as how that process is controlled both
spatially and temporally. In addition, learning how p38 activity is maintained
in the oral field will be of interest. The asymmetrically distributed
mitochondria are suitably located to serve in this capacity, and, given the
precedent of p38 activation in response to mitochondria
(Ushio-Fukai et al., 1998
;
Kulisz et al., 2002
;
Lee et al., 2002
), this will
be an intriguing line of questioning to pursue.
The results of this study have supplied a molecular framework for OA specification and axial patterning. This will serve as a foundation for continued investigation into the molecular basis of these fundamental developmental events.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Amore, G., Yavrouian, R. G., Peterson, K. J., Ransick, A., McClay, D. R. and Davidson, E. H. (2003). Spdeadringer, a sea urchin embryo gene required separately in skeletogenic and oral ectoderm gene regulatory networks. Dev. Biol. 261, 55-81.[CrossRef][Medline]
Angerer, L. M., Oleksyn, D. W., Levine, A. M., Li, X., Klein, W. H. and Angerer, R. C. (2001). Sea urchin goosecoid function links fate specification along the animal-vegetal and oral-aboral embryonic axes. Development 128,4393 -4404.
Armstrong, N., Hardin, J. and McClay, D. R. (1993). Cell-cell interactions regulate skeleton formation in the sea urchin embryo. Development 119,833 -840.[Abstract]
Bradham, C. A., Qian, T., Streetz, K., Brenner, D. A. and
Lemasters, J. J. (1998). The mitochondrial permeability
transition is required for TNF
-mediated apoptosis and cytochrome
c release. Mol. Cell. Biol.
18,6353
-6364.
Cameron, R. A., Leahy, P. S. and Davidson, E. H. (1996). Twins raised from separated blastomeres develop into sexually mature Strongylocentrotus purpuratus. Dev. Biol. 178,514 -519.[CrossRef][Medline]
Coffman, J. A., McCarthy, J. J., Dickey-Sims, C. and Robertson, A. J. (2004). Oral-aboral axis specification in the sea urchin embryo II. Mitochondrial distribution and redox state contribute to establishing polarity in Strongylocentrotus purpuratus. Dev. Biol. 273,160 -171.[CrossRef][Medline]
Corpet, F. (1988). Multiple sequence alignment
with hierarchical clustering. Nucl. Acids Res.
16,10881
-10890.
Croce, J., Lhomond, G. and Gache, C. (2001). Expression pattern of Brachyury in the embryo of the sea urchin Paracentrotus lividus. Dev. Genes Evol. 211,617 -619.[CrossRef][Medline]
Croce, J., Lhomond, G. and Gache, C. (2003). Coquillette, a sea urchin T-box gene of the Tbx2 subfamily, is expressed asymmetrically along the oral-aboral axis of the embryo and is involved in skeletogenesis. Mech. Dev. 120,561 -572.[CrossRef][Medline]
Davidson, E. H., Rast, J. P., Oliveri, P., Ransick, A.,
Calestani, C., Yuh, C. H., Minokawa, T., Amore, G., Hinman, V., Arenas-Mena,
C. et al. (2002). A genomic regulatory network for
development. Science
295,1669
-1678.
Davies, S. P., Reddy, H., Caivano, M. and Cohen, P. (2000). Specificity and mechanism of action of some commonly used protein kinase inhibitors. Biochem J. 351,95 -105.[CrossRef][Medline]
Driesch, H. (1892). Entwicklungmechanische Studien III-VI. Z. Wiss. Zool. 55,160 -184.
Duboc, V., Rottinger, E., Besnardeau, L. and Lepage, T. (2004). Nodal and BMP2/4 signaling organizes the oral-aboral axis of the sea urchin embryo. Dev. Cell 6, 397-410.[CrossRef][Medline]
Duboc, V., Rottinger, E., Lapraz, F., Besnardeau, L. and Lepage, T. (2005). Left-right asymmetry in the sea urchin embryo is regulated by nodal signaling on the right side. Dev. Cell 9,147 -158.[CrossRef][Medline]
Flowers, V. L., Courteau, G. R., Poustka, A. J., Weng, W. and Venuti, J. M. (2004). Nodal/activin signaling establishes oral-aboral polarity in the early sea urchin embryo. Dev. Dyn. 231,727 -740.[CrossRef][Medline]
Fujii, R., Yamashita, S., Hibi, M. and Hirano, T.
(2000). Asymmetric p38 activation in zebrafish: its possible role
in symmetric and synchronous cleavage. J. Cell Biol.
150,1335
-1348.
Goswami, M., Uzgare, A. R. and Sater, A. K. (2001). Regulation of map kinase by the BMP-4/TAK1 pathway in Xenopus ectoderm. Dev. Biol. 236,259 -270.[CrossRef][Medline]
Gross, J. M. and McClay, D. R. (2001). The role of Brachyury (T) during gastrulation movements in the sea urchin Lytechinus variegatus. Dev. Biol. 239,132 -147.[CrossRef][Medline]
Gross, J. M., Peterson, R. E., Wu, S.-Y. and McClay, D. R.
(2003). LvTbx2/3, a T-box family transcription factor involved in
formation of the oral/aboral axis of the sea urchin embryo.
Development 130,1989
-1999.
Hardin, J., Coffman, J. A., Black, S. D. and McClay, D. R. (1992). Commitment along the dorsoventral axis of the sea urchin embryo is altered in response to NiCl2. Development 116,671 -685.[Abstract]
Kulisz, A., Chen, N., Chandel, N. S., Shao, Z. and Schumacker,
P. T. (2002). Mitochondrial ROS initiate phosphorylation of
p38 MAP kinase during hypoxia in cardiomyocytes. Am. J. Physiol.
Lung Cell. Mol. Physiol. 282,L1324
-L1329.
Lee, J. C., Laydon, J. T., McDonnell, P. C., Gallagher, T. F., Kumar, S., Green, D., McNulty, D., Blumenthal, M. J., Heys, J. R., Landvatter, S. W. et al. (1994). A protein kinase involved in the regulation of inflammatory cytokine biosynthesis. Nature 372,739 -746.[CrossRef][Medline]
Lee, M. W., Park, S. C., Yang, Y. G., Yim, S. O., Chae, H. S., Bach, J. H., Lee, H. J., Kim, K. Y., Lee, W. B. and Kim, S. S. (2002). The involvement of reactive oxygen species (ROS) and p38 mitogen-activated protein (MAP) kinase in TRAIL/Apo2L-induced apoptosis. FEBS Lett. 512,313 -318.[CrossRef][Medline]
Li, X., Wikramanayake, A. H. and Klein, W. H. (1999). Requirement of SpOtx in cell fate decisions in the sea urchin embryo and possible role as a mediator of ß-catenin signaling. Dev. Biol. 212,425 -439.[CrossRef][Medline]
Logan, C. Y. and McClay, D. R. (1997). The allocation of early blastomeres to the ectoderm and endoderm is variable in the sea urchin embryo. Development 124,2213 -2223.[Abstract]
Logan, C. Y., Miller, J. R., Ferkowicz, M. J. and McClay, D. R. (1999). Nuclear ß-catenin is required to specify vegetal cell fates in the sea urchin embryo. Development 126,345 -357.[Abstract]
Malinda, K. M. and Ettensohn, C. A. (1994). Primary mesenchyme cell migration in the sea urchin embryo: distribution of directional cues. Dev. Biol. 164,562 -578.[CrossRef][Medline]
Mao, C. A., Wikramanayake, A. H., Gan, L., Chuang, C. K., Summers, R. G. and Klein, W. H. (1996). Altering cell fates in sea urchin embryos by overexpressing SpOtx, an orthodenticle-related protein. Development 122,1489 -1498.[Abstract]
McCain, E. R. and McClay, D. R. (1994). The establishment of bilateral asymmetry in sea urchin embryos. Development 120,395 -404.[Abstract]
Oliveri, P., Carrick, D. M. and Davidson, E. H. (2002). A regulatory gene network that directs micromere specification in the sea urchin embryo. Dev. Biol. 246,209 -228.[CrossRef][Medline]
Raingeaud, J., Gupta, S., Rogers, J. S., Dickens, M., Han, J.,
Ulevitch, R. J. and Davis, R. J. (1995). Pro-inflammatory
cytokines and environmental stress cause p38 mitogen-activated protein kinase
activation by dual phosphorylation on tyrosine and threonine. J.
Biol. Chem. 270,7420
-7426.
Raingeaud, J., Whitmarch, A. J., Barrett, T., Derigard, B. and Davis, R. (1996). MKK3- and MKK6-regulated gene expression is mediated by the p38 mitogen-activated protein kinase signal transduction pathway. Mol. Cell. Biol. 16,1247 -1255.[Abstract]
Rast, J. P., Amore, G., Calestani, C., Livi, C. B., Ransick, A. and Davidson, E. H. (2000). Recovery of developmentally defined gene sets from high-density cDNA macroarrays. Dev. Biol. 228,270 -286.[CrossRef][Medline]
Roth, S., Stein, D. and Nusslein-Volhard, C. (1989). A gradient of nuclear localization of the dorsal protein determines dorsoventral pattern in the Drosophila embryo. Cell 59,1189 -1202.[CrossRef][Medline]
Rousseau, S., Houle, F., Kotanides, H., Witte, L., Waltenberger,
J., Landry, J. and Huot, J. (2000). Vascular endothelial
growth factor (VEGF)-driven actin-based motility is mediated by VEGFR2 and
requires concerted activation of stress-activated protein kinase 2 (SAPK2/p38)
and geldanamycin-sensitive phosphorylation of focal adhesion kinase.
J. Biol. Chem. 275,10661
-10672.
Rushlow, C. A., Han, K., Manley, J. L. and Levine, M. (1989). The graded distribution of the dorsal morphogen is initiated by selective nuclear transport in Drosophila. Cell 59,1165 -1177.[CrossRef][Medline]
Schier, A. F. and Shen, M. M. (2000). Nodal signalling in vertebrate development. Nature 403,385 -389.[CrossRef][Medline]
Schneider, S., Steinbeisser, H., Warga, R. M. and Hausen, P. (1996). Beta-catenin translocation into nuclei demarcates the dorsalizing centers in frog and fish embryos. Mech. Dev. 57,191 -198.[CrossRef][Medline]
Shi, Y. and Gaestel, M. (2002). In the cellular garden of forking paths: how p38 MAPKs signal for downstream assistance. Biol. Chem. 383,1519 -1536.[CrossRef][Medline]
Steward, R. (1989). Relocalization of the dorsal protein from the cytoplasm to the nucleus correlates with its function. Cell 59,1179 -1188.[CrossRef][Medline]
Summers, R. G., Piston, D. W., Harris, K. M. and Morrill, J. B. (1996). The orientation of first cleavage in the sea urchin embryo, Lytechinus variegatus, does not specify the axes of bilateral symmetry. Dev. Biol. 175,177 -183.[CrossRef][Medline]
Suzanne, M., Irie, K., Glise, B., Agnes, F., Mori, E.,
Matsumoto, K. and Noselli, S. (1999). The Drosophila p38 MAPK
pathway is required during oogenesis for egg asymmetric development.
Genes Dev. 13,1464
-1474.
Takekawa, M., Adachi, M., Nakahata, A., Nakayama, I., Itoh, F., Tsukuda, H., Taya, Y. and Imai, K. (2000). p53-inducible wip1 phosphatase mediates a negative feedback regulation of p38 MAPK-p53 signaling in response to UV radiation. EMBO J. 19,6517 -6526.[CrossRef][Medline]
Tong, L., Pav, S., White, D. M., Rogers, S., Crane, K. M., Cywin, C. L., Brown, M. L. and Pargellis, C. A. (1997). A highly specific inhibitor of human p38 MAP kinase binds in the ATP pocket. Nat. Struct. Biol. 4,311 -316.[CrossRef][Medline]
Ushio-Fukai, M., Alexander, R. W., Akers, M. and Griendling, K.
K. (1998). p38 Mitogen-activated protein kinase is a critical
component of the redox-sensitive signaling pathways activated by angiotensin
II. Role in vascular smooth muscle cell hypertrophy. J. Biol.
Chem. 273,15022
-15029.
Wang, Z., Canagarajah, B. J., Boehm, J. C., Kassisa, S., Cobb, M. H., Young, P. R., Abdel-Meguid, S., Adams, J. L. and Goldsmith, E. J. (1998). Structural basis of inhibitor selectivity in MAP kinases. Structure 6,1117 -1128.[Medline]
Wikramanayake, A. H., Brandhorst, B. P. and Klein, W. H. (1995). Autonomous and non-autonomous differentiation of ectoderm in different sea urchin species. Development 121,1497 -1505.[Abstract]
Wikramanayake, A. H., Huang, L. and Klein, W. H.
(1998). ß-Catenin is essential for patterning the maternally
specified animal-vegetal axis in the sea urchin embryo. Proc. Natl.
Acad. Sci. USA 95,9343
-9348.
Young, P. R., McLaughlin, M. M., Kumar, S., Kassis, S., Doyle,
M. L., McNulty, D., Gallagher, T. F., Fisher, S., McDonnell, P. C., Carr, S.
A. et al. (1997). Pyridinyl imidazole inhibitors of p38
mitogen-activated protein kinase bind in the ATP site. J. Biol.
Chem. 272,12116
-12121.
This article has been cited by other articles: