spacer gif spacer gif spacer gif spacer gif ARCHIVE ANNOUNCEMENT! spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 12 April 2006
doi: 10.1242/dev.02350


Development 133, 1881-1890 (2006)
Published by The Company of Biologists 2006


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow All Versions of this Article:
dev.02350v1
133/10/1881    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thermes, V.
Right arrow Articles by Joly, J.-S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thermes, V.
Right arrow Articles by Joly, J.-S.

Medaka simplet (FAM53B) belongs to a family of novel vertebrate genes controlling cell proliferation

Violette Thermes1, Eva Candal1, Alessandro Alunni1, Guillaume Serin2, Franck Bourrat1 and Jean-Stéphane Joly1,*

1 INRA MSNC Group, DEPSN, Institut A. Fessard, CNRS, 1 avenue de la Terrasse, 91198 Gif-sur-Yvette, France.
2 Oncodesign, 20 rue Jean Mazen, 21000 Dijon, France.

* Author for correspondence (e-mail: joly{at}iaf.cnrs-gif.fr)

Accepted 8 March 2006


    SUMMARY
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
The identification of genes that regulate proliferation is of great importance to developmental biology, regenerative medicine and cancer research. Using an in situ screen on a cortical structure of the medaka fish brain, we identified the simplet gene (smp), which is homologous to the human FAM53B gene. smp was expressed in actively proliferating cells of the CNS throughout embryogenesis. It belongs to a family of vertebrate-specific genes with no characterized biochemical domains. We showed that FAM53B bound 14-3-3 chaperones, as well as SKIIP proteins, adaptor proteins connecting DNA-binding proteins to modulators of transcription. smp inactivation with morpholinos led to delayed epiboly and reduced embryonic size. Absence of Smp activity did not induce apoptosis, but resulted in a reduced cell proliferation rate and enlarged blastomeres. Moreover, smp was shown to control the expression of the pluripotency-associated oct4/pou5f1 gene. We propose that smp is a novel vertebrate-specific gene needed for cell proliferation and that it is probably associated with the maintenance of a pluripotent state.

Key words: Fish, Zebrafish, Oct4, Pou2, Ol-pou5f1, Epiboly, Pluripotency


    INTRODUCTION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Although much progress has been accomplished in recent years towards understanding cell proliferation at the genetic level, many key genes involved in this process still remain to be discovered. A combinatorial network of cell cycle regulators, signaling and metabolic pathways, and also, probably, of uncharacterized genes, underlies the biogenesis of proliferating neural progenitors (Karsten et al., 2003Go). Novel genes involved in the proliferation machinery will likely be discovered among the 41% of predicted human genes corresponding to proteins with unknown function (Venter et al., 2001Go).

Our experimental model is the Japanese medaka Oryzias latipes, a currently emerging vertebrate model (Wittbrodt et al., 2002Go) with features similar to those of the zebrafish Danio rerio (high fecundity, small size and external development of transparent embryos). The teleost optic tectum (ot) is a cortical structure of the dorsal midbrain (Nguyen et al., 1999Go), which grows by the successive addition of open rings of progenitor cells originating from a population of stem cells located at the periphery of the organ. In this structure, mitotic cells are located at the margin, differentiating cells at the center, and in between lies an `arrest zone', where cell cycle-exit genes are expressed (Nguyen et al., 2001aGo). We took advantage of this topographically oriented growth mode to undertake a systematic whole-mount in situ hybridization (WMISH) screen on the medaka CNS (Deyts et al., 2005Go; Nguyen et al., 2001bGo), aimed at identifying novel molecules linked to cell proliferation in the CNS and, potentially, in other tissues. These studies demonstrated the predictive value of this approach, at least for the genes expressed in the arrest zone; there is a very strong correlation between the expression pattern and gene function (in that case, downregulation of the cell cycle). Among the candidate genes isolated in the course of our screen, a previously uncharacterized gene was called simplet (smp). Although Smp has no characterized biochemical domains, it binds to the 14-3-3 adaptor proteins. In addition, the human homolog FAM53B binds to the SKIIP protein, known to modulate the activity of transcriptional regulators implicated in cell proliferation. Based on smp expression patterns during embryonic development, and on gain- or loss-of-function experiments, we propose that smp is involved in the regulation of cell proliferation and, possibly, in the maintenance of pluripotency.


    MATERIALS AND METHODS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Fish strain
Medaka embryos of the Carbio strain (kindly provided by Jochen Wittbrodt, EMBL, Heidelberg) were raised at 26°C under a reproduction regime (14 hour light/10 hour dark). Fertilized eggs were collected after spawning (at the onset of the light) and incubated in Yamamoto's embryo rearing medium (Yamamoto, 1975Go). In all experiments, embryos were placed at 26°C and staged according to Iwamatsu (Iwamatsu, 1994Go; Iwamatsu, 2004Go) and Furutani-Seiki (Furutani-Seiki and Wittbrodt, 2004Go).

Cloning and sequence analysis
A 1025 bp fragment of simplet 3' cDNA end was isolated from a library of medaka anterior brain (35-somite, stage 30-31) in the course of the in situ hybridization screen (Nguyen et al., 2001bGo). To isolate the 5' cDNA sequence, total RNA was extracted from medaka anterior brain at 18-19 somites (stage 25) and RT-PCR was further performed, following the SMART RACE cDNA Amplification Kit instructions (Clontech, CA, USA). Synthesized cDNA was used as template for PCR amplification of the full-length simplet coding region using the following primers: forward, 5'-CATGCCATGGCCCAGTTGGAGCAACTTGGAAGGAG-3'; and reverse, 5'-ATAGTTTAGCGGCCGCTTTCATATGAGCTCCTCAAGACATTGG-3'. A fragment (~1.5 kb) was purified with the QIAEX II Gel Extraction Kit (QIAGEN) and subcloned into pCRII-TOPO (InVitrogen). The simplet sequence was compared with the GenBank and SwissProt databases using BLAST (National Center for Biotechnology Information, USA). Homologous protein sequences of fugu were downloaded from the JGI website (http://genome.jgi-psf.org/Takru4/Takru4.home.html). Alignments were created using MultAlign (http://prodes.toulouse.inra.fr/multalin/multalin.html) (Corpet, 1988Go). For phylogenetic analyses, we used the CLUSTAL X Multiple Sequence Alignment Program (Thompson et al., 1997Go) and MEGA version 2.1 (Kumar et al., 2001Go). To isolate medaka Ol-pou5f1, we blasted the medaka genome sequence using the NIG DNA sequencing center website (http://dolphin.lab.nig.ac.jp/medaka) to identify the closest medaka relative to zebrafish Pou2. Ol-pou5f1 PCR primers were: forward, 5'-CTGTGGGGCCAGAAGCTCAGATGAT-3'; and reverse, 5'-TGCAGTTGAGGTGGGTCTCAGC-3'. A 162 bp fragment containing the whole ORF was cloned; the medaka protein is 56% identical to the zebrafish protein.

Yeast two-hybrid screen
Yeast two-hybrid screen using the entire ORF of the human smp related gene FAM53B was carried out by Dualsystems Biotech AG (Zurich, Switzerland). For the screen using the mutated FAM53B ORF, the underlined serine of each 14-3-3 binding domain was changed into alanine to generate mutations sites (RSXPSXP). Library plasmids were isolated from positive clones and assayed in a FAM53B dependency test with (1) the bait plasmid and (2) a control bait encoding a LexA-laminC fusion using a mating strategy (Kolonin et al., 2000Go). Bait dependent interactors were further analyzed for homologies with BLASTp.

Plasmids
For immunoprecipitation, the smp cDNA insert was excised from the pCRII-TOPO plasmid and inserted into a pTracer plasmid (InVitrogen). A FLAG epitope was fused to the N-terminal protein extremity by insertion between the KpnI and PpuMI restriction sites of the PCR amplified product obtained with a 5' primer containing the FLAG sequence, CGGGTACCGGCGCGCCGCCACCATGGACTACAAAGACGATGACGACAAGTCCAACGTCGAGTTATCGAGCAGC and a 3' primer, TGTGGAGAGGAAAGGTCCTGCG, using pTracer/Ol-smp as template. To amplify human FLAG/FAM53B, we used a cDNA library from MCF-7 cells. PCR product was obtained with the FLAG-containing 5' primer GGGTACCGGCGCGCCGCCACCATGGACTACAAAGACGATGACGACAAGGTGATGGTCCTAGTGAAAGCC and a 3' primer, GAATTCCTCAGTTCTTCTCTATCTGCTCAATGTCC, cut by KpnI and EcoRI restriction enzymes and inserted into the pTracer plasmid in the same restriction sites.

Immunoprecipitation
HCT-116 cells were transfected with empty pTracer, pTracer/FLAG/Ol-smp and pTracer/FLAG/FAM53B with lipofectamine 2000 (Invitrogen). After 72 hours, cells were lyzed by RIPA buffer [50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.5% Deoxycholate, 1% Triton, 0.2% SDS] with a proteinase inhibitor cocktail tablet (Roche), and immunoprecipitated with M2 EzView beads (Sigma). After protein denaturation, immunoprecipitated complexes were separated by 15% SDS-PAGE and transferred onto a nitrocellulose membrane. FLAG/Ol-Smp and FLAG/FAM53B proteins were revealed with anti-FLAG M5 antibody (Sigma), and 14-3-3 proteins with polyclonal antibody (Upstate), followed by HRP-coupled secondary antibodies, before ECL treatment (Amersham). EGF-stimulated A431 cell lysate was loaded as a positive control for 14-3-3 proteins. Detection of SKIIP proteins was performed using an anti-human SKIIP antibody (a gift of Dr L. Banks) (Prathapam et al., 2002Go).

Whole-mount in situ hybridization (WMISH)
WMISH were performed with an Intavis automat. Embryos from the one-cell stage to the late gastrula stage (stage 17) were fixed overnight in 4% paraformaldehyde (PFA) and 0.05% glutaraldehyde in 0.12 M phosphate buffer (PBS, pH 7.4); from the late gastrula stage onwards, embryos were fixed overnight in 4% PFA. Sense and antisense digoxigenin-UTP RNA probes were prepared according to Joly et al. (Joly et al., 1997Go). From the 256/512-cell stage (stage 9), embryos were subjected to Proteinase K treatment (25 µg/ml) for the following times: 1 minute for embryos at the 512-cell stage, 3 minutes for later stages until mid gastrula (stage 15), 5 minutes for 2-somite embryos (stage 19), 10 minutes for 16-somite embryos (stage 24) and 30 minutes for 35-somite embryos (stage 30). Control sense probe did not lead to any detectable signal. Embryos were cleared in glycerol and mounted in 1% methylcellulose (Sigma). Alternatively, specimens were dehydrated in methanol and mounted in a 2:1 mixture of benzylbenzoate:benzylalcohol. For sectioning, stained embryos were dehydrated, embedded in paraffin wax and microtome sectioned (8 µm thickness).

Morpholino (MO) and RNA microinjections
For knockdown and clonal analyses, individual blastomeres of two- or 32-cell stage medaka embryos were microinjected with specific MOs. Dead embryos (5%) were discarded 2 hours after injection and not considered in subsequent counting. MOs were designed and synthesized by Gene-Tools, LLC (Corvallis). The sequence of the smp-morpholino I (smpMOI) was: 5'-CATGGCAACACACATCCTCCTTCCA-3'. The sequence of the smp-morpholino II (smpMOII) was: 5'-GTTGCTCCAACTGGGACAATCTACA-3'. Underlined bases were changed to generate mis-paired control morpholinos (smpMOIC and -IIC). To use them as in vivo dyes, 3'-end modifications of morpholinos with carboxyfluorescein or lissamine were performed. Morpholinos were resuspended to 20 mg/ml (about 2 mM) in sterile RNase-free water. Knockdown experiments were performed with 2 to 10 mg/ml of smpMO, and clonal and rescue experiments with 8 mg/ml of smpMO. Embryos injected with RNase-free water or a balanced salt solution gave the same results.

For overexpression, capped mRNAs encoding Smp or EGFP were in vitro synthesized (Ambion mMessage mMachine kit). EGFP RNA was injected either alone or together with smpRNA. For rescue experiments, five independent experiments were performed with more than 50 embryos in each batch.

TUNEL assay
The development of smpMOI- or smpMOIC-injected embryos (6 mg/ml) was arrested with 4% PFA, 0.05% glutaraldehyde (for 48 hours at 4°C). Fixed-embryos were mechanically dechorionated, permeabilised (0.1% sodium citrate) and labelled for DNA strand breaks using the In Situ Cell Death Detection Kit (TUNEL, Roche). Staining substrate was Fast-Red (Roche).

DAPI staining
Following MO injection into two- or 32-cell-stage embryos (8 mg/ml), development was arrested in 4% PFA, 0.05% glutaraldehyde (2 hours). Embryos were dechorionated and incubated for 30 minutes with DAPI fluorochrome (300 nM in PBS/Tween 1%). Blastoderms were detached from the yolk and mounted on PPD-glycerol (1,2-Phenylendiamin, Merck) for microscopy observation. For clonal analyses, nuclear morphology was analyzed under a laser scanning confocal microscope.

Flow cytometry
smpMOI-injected (10 mg/ml) and uninjected embryos were frozen in liquid nitrogen at early gastrula stage (13 hours post fertilization, hpf) and dechorionated in Galbraith buffer (Galbraith et al., 1983Go). Nuclei were separated from debris by filtration through a 50-µm nylon mesh. Filtrates were treated with RNase A (100 µg/ml) and stained with 300 µl propidium iodide (50 µg/ml). Nuclei (10,000) were analyzed with an EPICS Elite ESP flow cytometer. Nuclei from adult medaka liver cells (G1 arrested) were used for calibration. Histograms were obtained using MultiCycle AV software.


    RESULTS AND DISCUSSION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
smp belongs to a small family of vertebrate genes
Sequence analysis indicated that simplet contains a putative 407 amino acid ORF. Alignment with databases revealed the existence of several potential homologous genes in fish (zebrafish, fugu, burmese pufferfish) and tetrapods (human, mouse, chicken, frog). It is noteworthy that the smp sequences did not reveal any significant homologous genes in invertebrate genomes, including non-vertebrate chordates. Thus, simplet-related genes may have arisen during vertebrate evolution. In this respect, it has already been documented that some cell cycle regulators are restricted to vertebrate genomes (for a review, see Roberts, 1999Go), despite the conservation of fundamental cell division processes in eukaryotes. For example, cyclin F (Bai et al., 1994Go) has a specific role in coordinating crucial cell cycle events in vertebrates (Kong et al., 2000Go; Tetzlaff et al., 2004Go).

Two conserved domains [named homology regions I and II (HRI and II)] were found in Smp proteins (Fig. 1A). The HRII domain was shown to contain a putative nuclear localization signal (NLS). We used HRI and HRII to construct a phylogenetic tree with the identified set of smp-related genes (Fig. 1B). These genes appeared to be organized into two main groups. A first group (A) contains two human predicted proteins (Hs XP094066 and Hs AAF63766) and the previously identified chicken DNTNP [Dorsal Neural Tube Nuclear Protein, Gg AAL76115 (Jun et al., 2002Go)]. Globally, two genes are found in mammals, whereas a single member was identified in amphibians and chicken, suggesting that an additional duplication event may have occurred in the mammalian lineage. In the other group (B), which contains smp, we identified only one gene in each tetrapod species. The human gene (Hs Q14153) was successively named KIAA0140, by the Kazusa DNA Research Institute, and FAM53B by HUGO Gene Nomenclature Committee after its identification by systematic genome data mining. By contrast, medaka, fugu, and tetraodon have two genes in this group. This probably results from the well-known increase in gene number in fish following a major duplication event that occurred in the teleostean lineage. Zebrafish presents only one gene, either as a result of a later loss of one of the paralogs, or because the sequence of a second gene is not present in the current release of the zebrafish genome.

smp is expressed predominantly in proliferating cells throughout embryonic development Maternal expression
The smp expression pattern was examined by WMISH. Maternal transcripts were detected at the one-cell stage and were found to be evenly distributed among all undifferentiated blastomeres during the first five cleavages (Fig. 2A,B). In teleost embryos, three individual cell layers are progressively determined before the mid-blastula transition (MBT), which corresponds to the onset of zygotic transcription and which begins around the 1000-cell stage (stage 10) (Aizawa et al., 2003Go; Iwamatsu, 2004Go). The central blastomeres, which produce the embryo proper, are not specified [except for the germinal precursors (Yoon et al., 1997Go)] and proliferate actively until MBT. By contrast, the marginal blastomeres, which constitute the future extra-embryonic tissues [the enveloping layer (EVL) and the yolk syncytial layer (YSL) (Kimmel and Law, 1985Go)], are specified early, although they are not irreversibly committed to their fate (Ho, 1992Go; Kane et al., 1992Go; Kimmel et al., 1990Go). Strikingly, by the seventh cell cleavage (64/128-cell stage, stage 8), smp transcripts were no longer detected in peripheral blastomeres, but only in central ones (Fig. 2C-E). The maternal smp expression suggests that it is associated with a cellular undifferentiated state and/or with an active cell proliferation.


Figure 1
View larger version (29K):
[in this window]
[in a new window]
 
Fig. 1. Medaka smp belongs to a novel family of vertebrate genes. (A) Smp bears two highly conserved regions (HRI and HRII), two 14-3-3 consensus-binding domains and a nuclear-localization signal (NLS). (B) A phylogenetic tree of the smp family showing two smp groups: A and B. Hs, Homo sapiens; Mm, Mus musculus; Gg, Gallus gallus; Xl, Xenopus laevis; Dr, Danio rerio; Fr, Fugu rubripes; Tn, Tetraodon negroviridis; Ol, Oryzias latipes. (C) Western blot after co-immunoprecipitation of 14-3-3 or SKIIP with Ol-Smp and FAM53B. Co-immunoprecipitation reveals an interaction of SKIIP with human FAM53B, but not with Ol-Smp.

 
To our knowledge, few genes exhibit such a restricted expression to the central blastomeres. One of these is the zebrafish pou2 gene (Hauptmann and Gerster, 1995Go; Takeda et al., 1994Go), which is related to the mammalian transcription factor Pou5f1 (formally Oct3/4) (Okamoto et al., 1990Go; Rosner et al., 1990Go; Scholer et al., 1989Go; Scholer et al., 1990Go). Numerous studies showed that pou2 is implicated in the maintenance of an active proliferation state and in the maintenance of cell pluripotency (Burgess et al., 2002Go; Takeda et al., 1994Go). Moreover, mice Pou5f1 regulatory regions are activated in blastulae and embryonic stem cells of the medaka (Hong et al., 2004Go). We cloned a medaka homolog (Ol-pou5f1) by searching the genome database and performing RT-PCR (see Materials and methods). WMISH confirmed that Ol-pou5f1 is expressed maternally in embryo deep cells (Fig. 2F), with an unexpected additional expression in the EVL, not found in zebrafish (Hauptmann and Gerster, 1995Go; Takeda et al., 1994Go). With the exception of EVL cells, Ol-pou5f1 and smp seem to be associated with both pluripotent and proliferating cells in the medaka embryo.

Zygotic expression
Although WMISH was not sensitive enough to detect smp expression after MBT in the thin cells layers of the gastrula, real-time PCR experiments allowed us to clearly detect zygotic smp transcripts at MBT and later (data not shown). WMISH on 2-somite (stage 19) and 16-somite (stage 24) embryos revealed that zygotic smp transcripts are restricted to the anterior midline of the telencephalon and to the prospective midbrain-hindbrain boundary (mhb, Fig. 2G,H). In 35-somite embryos (stage 30), transcripts were detected in retinal progenitor cells and other parts of the CNS, particularly in proliferative zones of the forebrain, the optic tectum, the mhb and the hindbrain rhombic lips (Fig. 2I). At these stages, WMISH also revealed an expression in the developing somites, but we focused subsequent analysis on the neural expression. In the CNS, we carefully compared the areas of smp expression with proliferative zones, as revealed by WMISH with a PCNA probe (Proliferating Cell Nuclear Antigen, Fig. 3). Transversal sections in the CNS after WMISH at the 34/35-somite stage (stage 29-30) showed that smp and PCNA expression domains are similar in the forebrain (Fig. 3B-E) and in the midbrain (Fig. 3F,G). In the hindbrain, such comparisons were difficult: the smp expression pattern is highly dynamic and differentiation events take place very early. Overall, our results suggest that smp is expressed in CNS mitotic cells.


Figure 2
View larger version (67K):
[in this window]
[in a new window]
 
Fig. 2. smp expression pattern throughout medaka embryonic development. WMISH at different embryonic stages. (A,B) Maternal smp transcripts were detected at the one-cell stage (A) and the four-cell stage (B). (C,D) At the 512-cell stage, transcripts were detected in central blastomeres but not in peripheral ones (D, arrow). (E,F) Transverse sections confirm that smp expression is not present in peripheral blastomeres (arrow), and that Ol-pou5f1 is expressed in both inner and marginal ones. (G,H) From 2-somite stage to 16-somite stage, smp is expressed at the anterior midline of the telencephalon (t), at the prospective midbrain-hindbrain boundary (mhb) and in the recently formed somites (s). (I) In 35-somite embryos, smp is detected in the progenitor region of the retina (r, arrow) and in a large portion of the CNS, including the forebrain (f), optic tectum (ot), mhb and rhombic lips (rl).

 
smp expression in the CNS is reminiscent of that of the chick DNTNP gene, which belongs to the same family. DNTNP has been described as a dorsal CNS-specific gene (Jun et al., 2002Go). smp expression appears likewise to be predominantly dorsal (Fig. 2), but we feel that this mostly reflects the dorsal position of most CNS proliferative zones (Wullimann and Knipp, 2000Go). Assuming that the smp mRNA pattern reflects protein distribution, smp expression appears indeed to be correlated with cell proliferation zones rather than with `dorsalness', as shown by its strong expression in the (proliferative) ciliary marginal zone of the retina (a ventrally derived region).

FAM53B interacts with 14-3-3 and SKIIP proteins
To identify molecular partners of Smp proteins, a yeast two-hybrid screen was performed. We used the human smp gene (FAM53B) as bait to screen a human adult brain cDNA library. Among the clones analyzed, the majority (14 out of 17) corresponded to 14-3-3 chaperone proteins, which represent a large and highly conserved family [from yeast to mammals (Fu et al., 2000Go; Kultz et al., 2001Go; Wang and Shakes, 1996Go)] of sequence-specific phosphoserine-binding proteins. These proteins are ubiquitously expressed and are especially abundant in the CNS (Takahashi, 2003Go). To confirm that both medaka and human Smp interact with 14-3-3 proteins, we performed an immunoprecipitation experiment using FLAG-tagged medaka and human Smp proteins (Fig. 1C). Analysis of the complex clearly showed that 14-3-3 proteins were co-immunoprecipitated only when Ol-Smp or FAM53B are produced in cells. We also observed a degradation profile of medaka Smp, probably indicating a protein instability in human cells. However, the functional property to interact with 14-3-3 was conserved between fish and human. A closer analysis of the Smp sequence identified a conserved consensus 14-3-3 recognition motif (RSXPSXP) (Muslin et al., 1996Go) in both HRI and HRII conserved domains (Fig. 1A), further strengthening the hypothesis that 14-3-3 interaction is important for Smp function. This motif has been demonstrated to mediate interactions between 14-3-3{zeta} and the yeast Raf-1 kinase (Clark et al., 1997Go). Recently, in vivo analysis in Drosophila showed that 14-3-3 proteins are involved in the correct timing and progression of normal cell cycle through the regulation of sub-cellular protein localization (Su et al., 2001Go). In addition, studies in Xenopus showed that 14-3-3 proteins are important in vertebrate embryonic development (Wu and Muslin, 2002Go). Therefore, Smp represents a new partner of 14-3-3 proteins, which are involved in the control of cell signaling, cell division and apoptosis (Fu et al., 2000Go; Hermeking, 2003Go).

To identify other Smp partners, a second yeast two-hybrid screen was performed using the human FAM53B bait with an inactivating mutation in each 14-3-3 binding domain (see Materials and methods). Of the 34 clones showing a specific interaction with the bait, 29 corresponded to known human proteins (see Table S1 in the supplementary material). Among them, 20 still corresponded to the previously characterized 14-3-3 ß, {zeta} and {epsilon} interactors. The presence of these prey, despite the fact that their canonical binding domains were mutated, indicated that their interaction with FAM53B is not only mediated by the canonical phosphoserine-containing motif. Recent work has demonstrated that 14-3-3 can indeed bind to other motifs, including unphosphorylated sites (Aitken, 2002Go; Fuglsang et al., 2003Go). Two clones were identified as unknown genes (KIAA hypothetical proteins), while three others presented no significant similarity with sequences in public protein databases. These latter three clones corresponded to human cDNA 3' regions. We focused our attention on one clone corresponding to the Ski-interacting protein (SKIIP). Co-immunoprecipitation experiments confirmed that the human SKIIP and FAM53B proteins (but not the medaka Smp) interact with each other (Fig. 1C, see also Materials and methods). Interactions between these two families of proteins are potentially important, as SKIIP is involved in signaling pathways controlling cell proliferation along with vitamin D, retinoic acid, oestrogens, glucocorticoids, Notch1-IC and TGFß (Prathapam et al., 2002Go). For example, Ski binds to the DNA-binding protein Smad and recruits a repression complex including HDAC. The Ski/SKIIP complex was also shown to overcome pRb-mediated cell cycle arrest in G1 (Prathapam et al., 2002Go). SKIIP proteins are part of the spliceosome and can have either an activator or a repressor role in transcription, as an adaptor that connects DNA-binding proteins to other transcriptional regulators (Prathapam et al., 2002Go). FAM53B might therefore be a new component in this complex that was undetected in screens for proliferation regulators performed in protostome models because of its vertebrate-specific occurrence. It will be interesting to test whether Smp, and/or the protein encoded by the other medaka ortholog to FAM53B (Ol 11143), interact with medaka Ski/SKIIP. This is necessary to establish whether Smp function can be mediated by an interaction with SKIIP. Because Ski is a muscular proto-oncogene and smp is expressed in somites, it would be interesting to analyze their functional relationships in mesodermal tissue.


Figure 3
View larger version (121K):
[in this window]
[in a new window]
 
Fig. 3. smp and PCNA transcript distributions showing that smp is expressed in CNS proliferating cells. (A) Drawing indicating section plans. (B-G) 34/35-somite embryos were sectioned after WMISH with a smp (B,D,F) or a PCNA (C,E,G) probe. smp and PCNA expression domains in the CNS were compared in the telencephalon (Tel), the diencephalon (Di) and the mesencephalon. Telencephalic (B,C) and diencephalic (D,E) sections show that the dorsal and peri-ventricular domains are positive for smp and PCNA. On diencephalic sections, eyes show ciliary marginal zones positive for both smp and PCNA. (F,G) Sections through the mesencephalon with smp and PCNA staining at the margin of the optic tectum (ot). Scale bars: 60 µm.

 
smp loss-of-function leads to epiboly delays and smaller embryos
To investigate the role of smp during medaka embryogenesis, we performed loss-of-function experiments by microinjecting antisense MOs to inhibit translation (Nasevicius and Ekker, 2000Go). After microinjection of smpMOI into one blastomere of two-cell embryos (leading to a ubiquitous MOs distribution within the two blastomeres), dose-dependant developmental defects were observed at different times of development (hpf). smpMOI-injected embryos (smp-morphants) displayed no apparent morphological defects before the onset of epiboly, at the early gastrula stage (stage 13, 13 hpf). However, about one third of injected embryos displayed a phenotype consisting of fewer, but enlarged, nuclei (as shown by DAPI staining) just after MBT in the late blastula (stage 11-12, 9 hpf; Fig. 5A,B), but not before MBT in 512-cell embryos (stage 9, 6 hpf; data not shown). The lack of pre-MBT detectable defects might be due to an absence of Smp protein activity at this stage of development (for example, if Smp belongs to a transcriptional complex but transcription is not yet active), or to a previous accumulation of sufficient amounts of maternal Smp protein, or to the presence of a related protein with redundant functions (the product of the smp paralog being a likely candidate).


Figure 4
View larger version (80K):
[in this window]
[in a new window]
 
Fig. 4. smp loss of function. Embryos were injected with smpMOI coupled with carboxyfluorescein. Dose-dependant phenotypes were observed at two developmental stages. (A-C) Lateral views of embryos at 25 hpf (corresponding to late gastrula stage). (D-F) Dorsal views of embryos at 44 hpf (corresponding to the 16-somite stage). (A,D) Control embryos. (B) A class II embryo displaying a strong delay of epiboly and abnormally large blastomeres (inset, arrowheads). (C) A class I embryo. Development is arrested at the beginning of epiboly. (D-F) Images shown at the same magnification to demonstrate the reduced size of abnormal embryos. (E) Mildly affected embryos that display 16 somites but have small eyes and poorly developed midbrain-hindbrain regions. (F) A severely affected embryo that lacks any diagnostic feature of the developmental stage. (G) Percentage of embryos of each type determined at 44 hpf, after sorting at 25 hpf into class I, II or III. Percentages were calculated from an average of eight independent experiments (smpMOI at 6-8 mg/ml, 190 embryos in total). Scale bars: 100 µm.

 
Two categories of gastrulation defects were distinguishable at 25 hpf, corresponding to the late gastrula stage (stage 17; Fig. 4A-C and Table 1). The most strongly affected embryos (class I: strong) were characterized by arrested development at the onset of epiboly (Fig. 4C). Mildly affected embryos (class II: weak) developed up to the 50%-70% epiboly stage (Fig. 4B). These embryos, in addition to the epiboly effects, also displayed a dorso-vegetal accumulation of abnormally large cells (Fig. 4B, inset). A third class (class III: wild type) included embryos that completed epiboly normally (Fig. 4A). Additional observations of all of these injected embryos at 44 hpf, corresponding to the 16-somite stage (stage 24), showed important subsequent developmental abnormalities (Fig. 4D-F, Table 1). Moderate developmental defects ranged from a smaller cerebellum to complete deletion of the ot, mhb and hindbrain regions (Fig. 4E). In extreme cases, severely affected embryos were much smaller than controls and so abnormal that their developmental stage could not be determined (Fig. 4F).


View this table:
[in this window]
[in a new window]
 
Table 1. Dose-dependent phenotypes in response to smpMO injections

 
Because gastrulation delays often lead to axial embryonic defects, we checked whether delays of epiboly observed at 25 hpf (in class I or class II embryos) were responsible for late defects at 44 hpf (Fig. 4G). Strongly delayed embryos (class I) failed to gastrulate, did not survive until 44 hpf or gave rise to severely affected neurulae. Class II and class III embryos continued to develop. Among class II embryos (mildly delayed), nearly half displayed moderate midbrain-hindbrain defects (48%) and about half exhibited severely affected neurulae (44%). By contrast, among class III embryos (wild type), half developed normally (48%) and half displayed moderate midbrain-hindbrain defects (52%). Because this late phenotype also appeared in embryos that had successfully gastrulated (class III embryos), we concluded that it is a direct consequence of smpMO-injection, occurring independently of earlier gastrulation defects. Because of the similarity of these phenotypes to that of the zebrafish spiele ohne grenzen mutant (Belting et al., 2001Go; Burgess et al., 2002Go), which bears mutations in the oct4/pou2/pou5f1 gene, the name simplet was given, the French name for Dopey, the foolish dwarf in Snow White.

Phenotype specificity was assessed by injecting a second non-overlapping morpholino (smpMOII) and the corresponding control containing base-pair mismatches (smpMOIC and smpMOIIC; Table 1). Phenotypes similar to those observed with smpMOI were obtained with smpMOII (with reduced efficiency). No defects were observed following injection of control MOs, indicating a high specificity of both smpMO.

Rescue experiments were performed by co-injecting smpMOI (8 mg/ml) and mRNA (50 and 100 µg/ml) encoding Smp but devoid of the 5'UTR. The resulting numbers of wild-type embryos at 25 hpf (late gastrulation) were significantly larger (55%) than when injecting MO alone (37%, P<0.003 by Student's paired t-test). These data indicated a partial rescue of epiboly delay, and confirmed that the defects are a specific consequence of smp knockdown. At greater smpRNA concentrations (150 to 500 µg/ml) no rescue was observed. At such concentrations, smpRNA injections led to specific defects, including epiboly delays (see below), which may mask the rescue effect.

smp does not interfere with embryonic patterning and does not induce apoptosis
To determine whether smpMO injections produce abnormal patterning events during neurogenesis, we examined the expression patterns of several brain markers (fgf8, wnt1, pax2 and otx2) along the anteroposterior and dorsoventral axis of mhb-affected embryos at the 18-somite stage (stage 25, data not shown). For these markers, no major patterning defects were detected and we thus focused our subsequent analysis on cell proliferation, apoptosis and cell pluripotency.

We first analyzed the effect of smpMO injection on apoptosis, when the smp knockdown effect becomes detectable, e.g. at the late blastula stage (stage 11-12, 9 hpf, post-MBT), when apoptotic pathways become active (Carter and Sible, 2003Go; Hensey and Gautier, 1997Go) (Fig. 5). Two-cell-injected embryos were allowed to develop until late blastula stage and were stained with DAPI to detect apoptotic bodies (Huynh and Teel, 2000Go; Zong et al., 2003Go). Nuclear morphology analysis revealed no sign of apoptosis, not at this stage (Fig. 5A,B) nor during early gastrulation (data not shown). We then analyzed the effect of the smpMO on apoptosis during neurulation (Fig. 5C-G). MO-injected embryos were allowed to develop until late gastrula and 18-somite stage [stage 17 (24 hpf) and stage 25 (49 hpf), respectively], and were analyzed for apoptosis by the TUNEL method. No apoptosis above basal levels was detected either at late gastrula stage (in class II embryos, Fig. 5D) or at 18-somite stage (in mhb-defective embryos), although the level of apoptosis was slightly increased in extra-embryonic tissues (Fig. 5G). A slight increase in apoptotic cell number was observed in a few class II embryos (Fig. 5E). However, this was probably not a direct effect of the smpMO on apoptosis, but rather a secondary phenomenon due to earlier developmental defects initiated during gastrulation.


Figure 5
View larger version (121K):
[in this window]
[in a new window]
 
Fig. 5. smp knockdown does not induce apoptosis. (A,B) At late blastula, the nuclear morphology of injected embryos was analyzed by DAPI staining (n=12 for injected-embryos, n=5 for control embryos). Flat-mounts of blastula displayed no evidence of apoptosis, although smpMOI-injected embryos have fewer nuclei. (C-G) TUNEL assay at later stages (dorsal views). No massive induction of apoptosis was detected in smpMOI-injected embryos at late gastrula (D, n=18) or at the 18-somite (G, n=23) stage, when compared with controls (C,F; n=7 and 6, respectively). (E) A few class II embryos displayed an increase in apoptosis, probably resulting from a secondary phenomenon due to epiboly delays. Scale bars: 100 µm.

 
These results indicate that smpMO-induced defects do not result from patterning modifications or from a massive induction of apoptosis. Therefore, we investigated whether smp phenotypes could be the result of an impairment in cell proliferation, and/or in cell specification.

smp-morphant cells have a reduced cell proliferation but a normal cell cycle pattern
DAPI staining of two-cell stage smpMO-injected embryos suggested that smp knockdown does not affect cell division before MBT (Fig. 5A,B; data not shown). To analyze the cycling properties of smp-morphant cells after MBT, smp-morphant and control embryos were subjected to flow cytometry at early gastrula stage (stage 13, Fig. 6). Whole-embryo DNA content was almost identical in both injected and uninjected embryos, indicating no phase-specific cell block. In addition, no endo-duplication phenomenon was observed (i.e. no cells with a DNA content higher than 4N; data not shown).

To determine whether smp knockdown affects the cell proliferation rate, we performed a clonal analysis: we microinjected a single central blastomere of 32-cell stage embryos with a fluorescent smpMO or its corresponding control. In all cases, fluorescence remained confined to the injected blastomere and to its progeny, thus allowing us to follow proliferation activity in a wild-type context. Progeny of the injected blastomere was followed under a dissecting microscope until the end of gastrulation (Fig. 7). From the time of injection to MBT, both smpMO-injected and control-injected blastomeres would be expected to divide about five times and thus would display about 32 fluorescent descendent cells. A quantitative analysis was performed after MBT, at early gastrula stage (stage 14). Control embryos exhibited from 50 to 150 distinct fluorescent cells, indicating that about two or three additional rounds of division occurred after MBT (Fig. 7A,B,G). Within a single batch of embryos injected with smpMOI or smpMOII, embryos typically displayed a correct timing of epiboly but less fluorescent cells, indicating fewer divisions (Fig. 7D,E,G). This was confirmed in six independent experiments, in which 50% of the smpMO-injected embryos showed less than 50 isolated labelled cells (Fig. 7H). Among these embryos, the most affected showed about 10 isolated labelled cells and a single cluster of about 20 cells, bringing the total number of fluorescent cells to about 30. Because the total number of cells in these embryos is not far from that expected around MBT (32), and as we observed no delay in cell proliferation before MBT, we conclude that smp knockdown results in a dramatic reduction of cell proliferation, starting at MBT, in a cell-autonomous manner.


Figure 6
View larger version (23K):
[in this window]
[in a new window]
 
Fig. 6. DNA content at early gastrula stage. (A) Uninjected embryos (n=14). (B) smpMOI-injected embryos (n=14). The proportions of cells in each phase of the cell cycle are similar in A and B.

 


Figure 7
View larger version (74K):
[in this window]
[in a new window]
 
Fig. 7. smp is involved in cell proliferation from MBT onwards. Clonal injections with either control MOs (smpMOIC and smpMOIIC) or specific MOs (smpMOI and smpMOII), coupled with carboxyfluorescein (-F) or lissamine (-L), respectively. (A-H) Injected embryos observed at early gastrula (A,D), mid gastrula (B,E) or late gastrula (C,F) stages. (A,B) Animal and dorsal views of control-injected embryos. (D,E) Animal and dorsal views of smpMO-injected embryos, showing smp-morphant cells that derived from the injected blastomere. Some of them remain aggregated during gastrulation (white dotted lines indicate the margin of the blastoderm). (C,F) At late gastrula stage, smpMO-containing cells are excluded from the embryonic axis (white dotted lines delimit both sides of the body axes). (G) Number of fluorescent cells per embryo, at early gastrula stage, within a single experiment (n, number of embryos). The average number of fluorescent cells is 67.3±4.3 for control embryos and 42.2±9.8 for smpMO-injected embryos. These values are significantly different (P<0.02). (H) Half of the smpMOII-L-injected embryos display a reduced number of isolated fluorescent cells (<50), always associated with a single cluster of cells. (I-N) Confocal microscope observation of flat mounts of early gastrula embryos after clonal injection with smpMOIIC-L (I-K, n=3) or smpMOII-L (L-N, n=5). The nuclear morphology of smpMO-containing cells (red) was analyzed by DAPI staining (blue). Control-injected cells showed normal mitotic (arrowhead) and interphasic (arrow and inset) nuclei (I-K). By contrast, smpMOII-L-injected blastomeres have descendants with abnormally large nuclei (L-N, arrows and inset).

 


Figure 8
View larger version (52K):
[in this window]
[in a new window]
 
Fig. 8. smp regulates Ol-pou5f1 expression. (A,B) Transverse sections, after WMISH, showing Ol-pou5f1 expression in early gastrula embryos after smpMO injection (8 mg/ml). Decreased expression was observed in deep cells, but not in the EVL of injected embryos (arrowhead). (C-F) Embryos injected at the 32-cell stage with EGFP RNA (100 µg/ml), either alone (C,E) or together with smpRNA (500 µg/ml, D,F). At mid-gastrulation (C,D, dorsal view), no apparent modifications can be observed (white dotted lines indicate the blastoderm margin). At the 2-somite stage (E,F, dorsal view), fluorescent cells are excluded from the embryo axis and are found near the anterior body axis. (G) Lateral view of a 2-somite stage control embryo showing Ol-pou5f1 expression in telencephalon (t) and tailbud (tb). (H,I) Ol-pou5f1 expression at the 2-somite stage after smpRNA injection into two-cell stage embryos. (H) Ectopic expression is visible in the telencephalon (t), ventral mhb and rhombencephalic domains (rb). (I) A more widespread expression is observed in strongly affected embryos. (J-O) Tranverse sections of WMISH embryos. (J-L) Control embryos. Ol-pou5f1 CNS expression is restricted to the dorsal telencephalon (arrowhead). (M-O) After injection of smpRNA, ectopic Ol-pou5f1 expression was observed in telencephalon (M, arrowhead), and in the ventral mhb (N, arrowhead) and rhombencephalon (O). Scale bars: 30 µm.

 
smp knockdown leads to enlarged cells and to altered cell motility
The nuclear morphology after clonal injections was examined by DAPI staining at early gastrula stage (stage 14; Fig. 7I,N). Control labelled cells (smpMOC-containing cells) and non-labelled cells both displayed interphasic (Fig. 7I-K, arrow and inset) or mitotic nuclei (Fig. 7I-K, arrowhead). By contrast, smp morphant cells displayed abnormally large blastomeres and large nuclei (Fig. 7L-N, arrow; see also Fig. 4B and Fig. 5B) containing decondensed chromatin (Fig. 7M, inset). It is unlikely that the reduced cell number results from mitosis arrest, as no mitotic nuclei were observed. As flow cytometry revealed no specific modification of the cell cycle pattern, we propose that smp knockdown slows down cell proliferation by increasing the length of the G1, S and G2 (but not M) phases. This is not an unusual situation: other cell cycle regulators that do not control a particular step of the cell cycle have recently been identified in Drosophila. For example, shar-pei and hippo mutant cells both show an even acceleration of cell cycle progression (Kango-Singh et al., 2002Go; Tapon et al., 2002Go). Finally, analysis of the integrity of nuclear DNA (Fig. 7J,M), cell death analysis by TUNEL (data not shown) and flow cytometry profiles (Fig. 6) confirmed that smp-morphant cells do not present apoptotic characteristics.

In clonal experiments, we noticed the presence of clusters of cells in smpMO-injected embryos (Fig. 7D,E). Eventually, at the end of gastrulation, their descendants were excluded from the embryonic axis (Fig. 7F), whereas smpMOC cells were found all along the embryonic axis (Fig. 7C). Thus, smpMO-containing cells also exhibit altered cell movements, which might be linked to modified adhesion properties, and/or to the large size of blastomeres. This could be one of the main factors causing delayed epiboly. Indeed, in the course of a Tübingen screen for new zebrafish mutants (Haffter and Nusslein-Volhard, 1996Go), several mutants identified as affecting the cell cycle also displayed an early epiboly arrest phenotype (Early Arrest Group Class I mutants) (Kane et al., 1996Go). Furthermore, overexpression of the XCS1 (Xenopus cleavage signal protein) gene in Xenopus embryos disturbs mitosis and leads to abnormal gastrulation due to cell enlargement (Nakamura et al., 2000Go), and the mouse Rnf2 (Ring1b) (Ring finger protein) null mutant causes cell cycle inhibition together with gastrulation arrest (Voncken et al., 2003Go). Our results thus provide an additional illustration of the tight link between cell proliferation and the morphogenetic movements of epiboly: in absence of Smp, the cycling activity of cells slows down and cells fail to move normally over the yolk sphere, precluding further morphogenetic movements at gastrulation.

smp regulates expression of Ol-pou5f1, homologous to pou2/oct4
Because early smp expression has features reminiscent of Ol-pou5f1 (Fig. 2E,F), we tested whether smp regulates Ol-pou5f1 expression. We first examined its expression in smpMO-injected embryos. Decreased expression of Ol-pou5f1 was observed after MBT in deep cells of early gastrula stage embryos (stage 13; 10 out of 14 embryos), but not in the enveloping cells (not expressing smp, Fig. 8A,B). Later during gastrulation, no difference could be detected (data not shown). These data suggest that smp might be part of a network triggering the activation of Ol-pou5f1 zygotic expression soon after MBT, whereas, at later stages, the expression of Ol-pou5f1 might be under the control of other factors, including redundant proteins.

Another cue for the link between smp and Ol-pou5f1 was provided by smp gain-of-function experiments. When smpRNA (500 µg/ml) was injected at the two-cell stage, most embryos displayed a perturbed and sometimes delayed gastrulation, as well as abnormal body axes during early somitogenesis; they eventually recovered, but showed midbrain and hindbrain defects (data not shown). When smpRNA (500 µg/ml) was injected at the 32-cell stage, gastrulation movements were not affected (Fig. 8C,D). In injected embryos (54 out of 109), the cell progeny was excluded from the embryo axis at the 2-somite stage (Fig. 8E,F), but it revealed no apparent modification of the cell number (Fig. 8C,D). Ol-pou5f1 expression was further analyzed into smp-overexpressing embryos at the 2-somite stage (stage 19) after two-cell stage injections (Fig. 8G-O). In control embryos, Ol-pou5f1 is predominantly expressed in the pluripotent cells of the tailbud and in the telencephalon (Fig. 8G). A massive ectopic expression of Ol-pou5f1 could be observed in the forebrain, in the mhb and in the hindbrain in about 60% of injected embryos (n=28, Fig. 8H). WMISH followed by transversal sections revealed an expansion of the expression domain in the telencephalon, and ectopic expression in the ventral mhb and rhombencephalic domains in smpRNA injected embryos (Fig. 8M-O), when compared with controls (Fig. 8J-L). In all embryos exhibiting strongly affected body axes, a more widespread expression was observed (n=14, Fig. 8I). smp and Ol-pou5f1 are not expressed in equivalent cells of normal embryos at this stage, with the putative exception of the telencephalon. Therefore, they may have similar functions in this latter domain, as well as in deep cells of late blastula and early gastrula. It would be interesting to examine whether smp directly activates Ol-pou5f1 transcription, and whether they cooperate to maintain cell pluripotency by activating known targets of Oct4 family proteins.

The discovery of a new vertebrate gene important for cell proliferation, and possibly for cell pluripotency, provides further support of an increase in the complexity of proliferation control in vertebrates. It will be of interest to investigate the possible role of smp genes (FAM53B) in tumorigenesis, and to examine their potential value as new targets for anti-cancer drugs.


    ACKNOWLEDGMENTS
 
Lawrence Banks is acknowledged for the kind gift of human anti-SKIIP anti-serum, and Dualsystems Biotech AG (Zurich, Switzerland) for the two-hybrid screens. We thank Bill Jeffery and Françoise Jamen for careful reading and helpful comments, Carole Deyts for her major contribution to WMISH, Laurent Legendre for skillful maintenance of fish and Philippe Vernier for support. We are grateful to Spencer Brown, Christel Talbot and Olivier Catrice for assistance in confocal and flow cytometry analyses. This work was supported by ARC, the European Commission (EaC key action QLK3-CT-2001-01890 and Plurigenes STREP project LSHG-CT-2005-018673), INRA, CNRS and INSERM.


    Footnotes
 
Supplementary material

Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/133/10/1881/DC1


    REFERENCES
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 

Aitken, A. (2002). Functional specificity in 14-3-3 isoform interactions through dimer formation and phosphorylation. Chromosome location of mammalian isoforms and variants. Plant Mol. Biol. 50,993 -1010.[CrossRef][Medline]

Aizawa, K., Shimada, A., Naruse, K., Mitani, H. and Shima, A. (2003). The medaka midblastula transition as revealed by the expression of the paternal genome. Gene Expr. Patterns 3,43 -47.[CrossRef][Medline]

Bai, C., Richman, R. and Elledge, S. J. (1994). Human cyclin F. EMBO J. 13,6087 -6098.[Medline]

Belting, H. G., Hauptmann, G., Meyer, D., Abdelilah-Seyfried, S., Chitnis, A., Eschbach, C., Soll, I., Thisse, C., Thisse, B., Artinger, K. B. et al. (2001). spiel ohne grenzen/pou2 is required during establishment of the zebrafish midbrain-hindbrain boundary organizer. Development 128,4165 -4176.[Abstract/Free Full Text]

Burgess, S., Reim, G., Chen, W., Hopkins, N. and Brand, M. (2002). The zebrafish spiel-ohne-grenzen (spg) gene encodes the POU domain protein Pou2 related to mammalian Oct4 and is essential for formation of the midbrain and hindbrain, and for pre-gastrula morphogenesis. Development 129,905 -916.[Medline]

Carter, A. D. and Sible, J. C. (2003). Loss of XChk1 function triggers apoptosis after the midblastula transition in Xenopus laevis embryos. Mech. Dev. 120,315 -323.[CrossRef][Medline]

Clark, G. J., Drugan, J. K., Rossman, K. L., Carpenter, J. W., Rogers-Graham, K., Fu, H., Der, C. J. and Campbell, S. L. (1997). 14-3-3 zeta negatively regulates raf-1 activity by interactions with the Raf-1 cysteine-rich domain. J. Biol. Chem. 272,20990 -20993.[Abstract/Free Full Text]

Corpet, F. (1988). Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res. 16,10881 -10890.[Abstract/Free Full Text]

Deyts, C., Candal, E., Joly, J. and Bourrat, F. (2005). An automated in situ hybridization screen in the medaka to identify unknown neural genes. Dev. Dyn. 234,698 -708.[CrossRef][Medline]

Fu, H., Subramanian, R. R. and Masters, S. C. (2000). 14-3-3 proteins: structure, function, and regulation. Annu. Rev. Pharmacol. Toxicol. 40,617 -647.[CrossRef][Medline]

Fuglsang, A. T., Borch, J., Bych, K., Jahn, T. P., Roepstorff, P. and Palmgren, M. G. (2003). The binding site for regulatory 14-3-3 protein in plant plasma membrane H+-ATPase: involvement of a region promoting phosphorylation-independent interaction in addition to the phosphorylation-dependent C-terminal end. J. Biol. Chem. 278,42266 -42272.[Abstract/Free Full Text]

Furutani-Seiki, M. and Wittbrodt, J. (2004). Medaka and zebrafish, an evolutionary twin study. Mech. Dev. 121,629 -637.[CrossRef][Medline]

Galbraith, D. W., Harkins, K. R., Maddox, J. M., Ayres, N. M., Sharma, D. P. and Firoozabady, E. (1983). Rapid flow cytometric analysis of the cell cycle in intact plant tissues. Science 220,1049 -1051.[Abstract/Free Full Text]

Haffter, P. and Nusslein-Volhard, C. (1996). Large scale genetics in a small vertebrate, the zebrafish. Int. J. Dev. Biol. 40,221 -227.[Medline]

Hauptmann, G. and Gerster, T. (1995). Pou-2-a zebrafish gene active during cleavage stages and in the early hindbrain. Mech. Dev. 51,127 -138.[CrossRef][Medline]

Hensey, C. and Gautier, J. (1997). A developmental timer that regulates apoptosis at the onset of gastrulation. Mech. Dev. 69,183 -195.[CrossRef][Medline]

Hermeking, H. (2003). The 14-3-3 cancer connection. Nat. Rev. Cancer 3, 931-943.[CrossRef][Medline]

Ho, R. K. (1992). Cell movements and cell fate during zebrafish gastrulation. Dev. Suppl.65 -73.

Hong, Y., Winkler, C., Liu, T., Chai, G. and Schartl, M. (2004). Activation of the mouse Oct4 promoter in medaka embryonic stem cells and its use for ablation of spontaneous differentiation. Mech. Dev. 121,933 -943.[CrossRef][Medline]

Huynh, H. T. and Teel, R. W. (2000). Selective induction of apoptosis in human mammary cancer cells (MCF-7) by pycnogenol. Anticancer Res. 20,2417 -2420.[Medline]

Iwamatsu, T. (1994). Stages of normal development in the medaka Oryzias latipes. Zool. Sci. 11,825 -839.

Iwamatsu, T. (2004). Stages of normal development in the medaka Oryzias latipes. Mech. Dev. 121,605 -618.[CrossRef][Medline]

Joly, J. S., Bourrat, F., Nguyen, V. and Chourrout, D. (1997). Ol-Prx 3, a member of an additional class of homeobox genes, is unimodally expressed in several domains of the developing and adult central nervous system of the medaka (Oryzias latipes). Proc. Natl. Acad. Sci. USA 94,12987 -12992.[Abstract/Free Full Text]

Jun, L., Balboni, A. L., Laitman, J. T. and Bergemann, A. D. (2002). Isolation of DNTNP, which encodes a potential nuclear protein that is expressed in the developing, dorsal neural tube. Dev. Dyn. 224,116 -123.[CrossRef][Medline]

Kane, D. A., Warga, R. M. and Kimmel, C. B. (1992). Mitotic domains in the early embryo of the zebrafish. Nature 360,735 -737.[CrossRef][Medline]

Kane, D. A., Maischein, H. M., Brand, M., van Eeden, F. J., Furutani-Seiki, M., Granato, M., Haffter, P., Hammerschmidt, M., Heisenberg, C. P., Jiang, Y. J. et al. (1996). The zebrafish early arrest mutants. Development 123, 57-66.[Abstract]

Kango-Singh, M., Nolo, R., Tao, C., Verstreken, P., Hiesinger, P. R., Bellen, H. J. and Halder, G. (2002). Shar-pei mediates cell proliferation arrest during imaginal disc growth in Drosophila. Development 129,5719 -5730.[CrossRef][Medline]

Karsten, S. L., Kudo, L. C., Jackson, R., Sabatti, C., Kornblum, H. I. and Geschwind, D. H. (2003). Global analysis of gene expression in neural progenitors reveals specific cell-cycle, signaling, and metabolic networks. Dev. Biol. 261,165 -182.[CrossRef][Medline]

Kimmel, C. B. and Law, R. D. (1985). Cell lineage of zebrafish blastomeres. II. Formation of the yolk syncytial layer. Dev. Biol. 108,86 -93.[CrossRef][Medline]

Kimmel, C. B., Warga, R. M. and Schilling, T. F. (1990). Origin and organization of the zebrafish fate map. Development 108,581 -594.[Abstract/Free Full Text]

Kolonin, M. G., Zhong, J. and Finley, R. L. (2000). Interaction mating methods in two-hybrid systems. Methods Enzymol. 328,26 -46.[Medline]

Kong, M., Barnes, E. A., Ollendorff, V. and Donoghue, D. J. (2000). Cyclin F regulates the nuclear localization of cyclin B1 through a cyclin-cyclin interaction. EMBO J. 19,1378 -1388.[CrossRef][Medline]

Kultz, D., Chakravarty, D. and Adilakshmi, T. (2001). A novel 14-3-3 gene is osmoregulated in gill epithelium of the euryhaline teleost Fundulus heteroclitus. J. Exp. Biol. 204,2975 -2985.[Abstract/Free Full Text]

Kumar, S., Tamura, K., Jakobsen, I. B. and Nei, M. (2001). MEGA2: molecular evolutionary genetics analysis software. Bioinformatics 17,1244 -1245.[Abstract/Free Full Text]

Muslin, A. J., Tanner, J. W., Allen, P. M. and Shaw, A. S. (1996). Interaction of 14-3-3 with signaling proteins is mediated by the recognition of phosphoserine. Cell 84,889 -897.[CrossRef][Medline]

Nakamura, H., Wu, C., Kuang, J., Larabell, C. and Etkin, L. D. (2000). XCS-1, a maternally expressed gene product involved in regulating mitosis in Xenopus. J. Cell Sci. 113,2497 -2505.[Abstract]

Nasevicius, A. and Ekker, S. C. (2000). Effective targeted gene `knockdown' in zebrafish. Nat. Genet. 26,216 -220.[CrossRef][Medline]

Nguyen, V., Deschet, K., Henrich, T., Godet, E., Joly, J. S., Wittbrodt, J., Chourrout, D. and Bourrat, F. (1999). Morphogenesis of the optic tectum in the medaka (Oryzias latipes): a morphological and molecular study, with special emphasis on cell proliferation. J. Comp. Neurol. 413,385 -404.[CrossRef][Medline]

Nguyen, V., Candal Suarez, E. M., Sharif, A., Joly, J. S. and Bourrat, F. (2001a). Expression of Ol-KIP, a cyclin-dependent kinase inhibitor, in embryonic and adult medaka (Oryzias latipes) central nervous system. Dev. Dyn. 222,439 -449.[CrossRef][Medline]

Nguyen, V., Joly, J. and Bourrat, F. (2001b). An in situ screen for genes controlling cell proliferation in the optic tectum of the medaka (Oryzias latipes). Mech. Dev. 107, 55-67.[CrossRef][Medline]

Okamoto, K., Okazawa, H., Okuda, A., Sakai, M., Muramatsu, M. and Hamada, H. (1990). A novel octamer binding transcription factor is differentially expressed in mouse embryonic cells. Cell 60,461 -472.[CrossRef][Medline]

Prathapam, T., Kuhne, C. and Banks, L. (2002). Skip interacts with the retinoblastoma tumor suppressor and inhibits its transcriptional activity. Nucleic Acids Res. 30,5261 -5268.[Abstract/Free Full Text]

Roberts, J. M. (1999). Evolving ideas about cyclins. Cell 98,129 -132.[CrossRef][Medline]

Rosner, M. H., Vigano, M. A., Ozato, K., Timmons, P. M., Poirier, F., Rigby, P. W. and Staudt, L. M. (1990). A POU-domain transcription factor in early stem cells and germ cells of the mammalian embryo. Nature 345,686 -692.[CrossRef][Medline]

Scholer, H. R., Balling, R., Hatzopoulos, A. K., Suzuki, N. and Gruss, P. (1989). Octamer binding proteins confer transcriptional activity in early mouse embryogenesis. EMBO J. 8,2551 -2557.[Medline]

Scholer, H. R., Ruppert, S., Suzuki, N., Chowdhury, K. and Gruss, P. (1990). New type of POU domain in germ line-specific protein Oct-4. Nature 344,435 -439.[CrossRef][Medline]

Su, T. T., Parry, D. H., Donahoe, B., Chien, C. T., O'Farrell, P. H. and Purdy, A. (2001). Cell cycle roles for two 14-3-3 proteins during Drosophila development. J. Cell Sci. 114,3445 -3454.[Abstract/Free Full Text]

Takahashi, Y. (2003). The 14-3-3 proteins: gene, gene expression, and function. Neurochem. Res. 28,1265 -1273.[CrossRef][Medline]

Takeda, H., Matsuzaki, T., Oki, T., Miyagawa, T. and Amanuma, H. (1994). A novel POU domain gene, zebrafish pou2: expression and roles of two alternatively spliced twin products in early development. Genes Dev. 8, 45-59.[Abstract/Free Full Text]

Tapon, N., Harvey, K. F., Bell, D. W., Wahrer, D. C., Schiripo, T. A., Haber, D. A. and Hariharan, I. K. (2002). salvador Promotes both cell cycle exit and apoptosis in Drosophila and is mutated in human cancer cell lines. Cell 110,467 -478.[CrossRef][Medline]

Tetzlaff, M. T., Bai, C., Finegold, M., Wilson, J., Harper, J. W., Mahon, K. A. and Elledge, S. J. (2004). Cyclin F disruption compromises placental development and affects normal cell cycle execution. Mol. Cell. Biol. 24,2487 -2498.[Abstract/Free Full Text]

Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. and Higgins, D. G. (1997). The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25,4876 -4882.[Abstract/Free Full Text]

Venter, J. C., Adams, M. D., Myers, E. W., Li, P. W., Mural, R. J., Sutton, G. G., Smith, H. O., Yandell, M., Evans, C. A., Holt, R. A. et al. (2001). The sequence of the human genome. Science 291,1304 -1351.[Abstract/Free Full Text]

Voncken, J. W., Roelen, B. A., Roefs, M., de Vries, S., Verhoeven, E., Marino, S., Deschamps, J. and van Lohuizen, M. (2003). Rnf2 (Ring1b) deficiency causes gastrulation arrest and cell cycle inhibition. Proc. Natl. Acad. Sci. USA 100,2468 -2473.[Abstract/Free Full Text]

Wang, W. and Shakes, D. C. (1996). Molecular evolution of the 14-3-3 protein family. J. Mol. Evol. 43,384 -398.[Medline]

Wittbrodt, J., Shima, A. and Schartl, M. (2002). Medaka - a model organism from the far East. Nat. Rev. Genet. 3,53 -64.[CrossRef][Medline]

Wu, C. and Muslin, A. J. (2002). Role of 14-3-3 proteins in early Xenopus development. Mech. Dev. 119, 45-54.[CrossRef][Medline]

Wullimann, M. F. and Knipp, S. (2000). Proliferation pattern changes in the zebrafish brain from embryonic through early postembryonic stages. Anat. Embryol. 202,385 -400.[CrossRef][Medline]

Yamamoto, T. (1975). Medaka (killifish) Biology and Strains. Tokyo: Keigaku.

Yoon, C., Kawakami, K. and Hopkins, N. (1997). Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells. Development 124,3157 -3165.[Abstract]

Zong, W. X., Li, C., Hatzivassiliou, G., Lindsten, T., Yu, Q. C., Yuan, J. and Thompson, C. B. (2003). Bax and Bak can localize to the endoplasmic reticulum to initiate apoptosis. J. Cell Biol. 162,59 -69.[Abstract/Free Full Text]





</
This Article