|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 19 July 2006
doi: 10.1242/dev.02493
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Departamento de Neurobiología del Desarrollo, Instituto Cajal, CSIC, Dr
Arce 37, Madrid 28002, Spain.
2 Developmental Biology Unit, Institute of Child Health, 30 Guilford Street,
University College London, London WC1N 1EH, UK.
Author for correspondence (e-mail:
bovolenta{at}cajal.csic.es)
Accepted 14 June 2006
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONSupplementary materialREFERENCES |
|---|
Key words: Mouse, Optic fissure, BMP, SHH
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONSupplementary materialREFERENCES |
|---|
). Soon after
these cells have migrated in, the fissure closes beginning from its central
region and proceeding posteriorly and anteriorly. As the RF seals, the first
retinal axons egress from the eye, occupying a small crescent just dorsal to
the hyaloid artery (Silver and Robb,
1979). As a result of these morphogenetic events, both axons and
artery at the nascent OD become encircled by a ring of compact neuroepithelial
cells, characterised by the expression of the paired-boxed transcription
factor Pax2 (Otteson et al.,
1998) (Fig. 2A).
These neuroepithelial cells have a long-standing recognised role in retina
ganglion cell (RGC) axon guidance (Ramon y
Cajal, 1892) and are the source of different cell surface and
secreted axon guidance cues, including laminin, NCAM or netrin 1, which are
known to orient the growth of RGC axons towards the disc and then into the
optic nerve (Stuermer and Bastmeyer,
2000). In spite of the importance of the OD, many of the basic questions relating to its development still remain unanswered. For example, it is unclear if the PAX2-positive OD precursors have a unique identity that distinguishes them from the remaining PAX2-positive cells of the optic stalk and/or if they share characteristics with cells of the remaining neural retina. Equally unclear is whether there are specific cellular and molecular determinants that control its formation, as most of our fragmentary knowledge is related to the development of the optic fissure in general.
An increased proliferation rate
(Calvente et al., 1988) and an
extensive programmed cell death in the ventral optic vesicle
(Cuadros and Rios, 1988;
Ozeki et al., 2000) are two
events that specifically accompany optic fissure formation. The asymmetric
expression of several regulatory genes seems also at the basis of ventral
optic vesicle specification (Peters,
2002) and hence of optic fissure formation. Among these, the
homeodomain-containing transcription factors Pax2
(Torres et al., 1996),
Vax1 (Bertuzzi et al.,
1999) and the related Vax2
(Barbieri et al., 1999) appear
particularly important. Genetic inactivation of either Pax2 or
Vax1 strongly interferes with optic stalk development, although the
initial formation of the optic fissure is unperturbed
(Torres et al., 1996;
Bertuzzi et al., 1999). The
effects of Vax2 inactivation are instead more closely related to the
establishment of dorsoventral polarity of the optic cup
(Barbieri et al., 2002;
Mui et al., 2002). However, a
common feature of the three mouse lines is the presence of an eye coloboma or
failure of optic fissure closure (Torres
et al., 1996; Bertuzzi et al.,
1999; Barbieri et al.,
2002), indicating that both ventral retina and optic stalk
specific genes contribute to the proper development of the fissure.
Furthermore, the activity of Pax2, Vax1 and Vax2 contribute
to the segregation of the optic stalk from the optic cup domain, at least in
part, via repression of the Pax6 gene, an optic cup determinant
(Schwarz et al., 2000;
Mui et al., 2005).
Besides these cell-autonomous regulators, embryological studies, based on
transplantations of 180° rotated optic vesicles in amphibian and chick,
postulate the existence of `inducers' of optic fissure formation
(Sato, 1933;
Silver, 1977;
Uemonsa et al., 2002). These
`inductive' signals appear to act gradually in the early optic vesicle with a
crucial activity at the 10-somite stage, when transplantations of rotated
vesicles result in no fissure formation
(Uemonsa et al., 2002) and the
development of embryos with a microphthalmic eye and no optic nerve
(Silver, 1977). It has been
proposed that sonic hedgehog (SHH), a member of the hedgehog family of
secreted glycoproteins (Martí and
Bovolenta, 2002), and bone morphogenetic protein 7 (BMP7), a
member of the TGFß superfamily of signalling factors
(Chen et al., 2004), emanating
from the prechordal mesoderm, might be likely candidates as fissure `inducers'
(Uemonsa et al., 2002), as
both factors interact to specify other prosecephalic ventral structures
(Dale et al., 1997).
Midline-derived SHH is generally involved in the early specification of
ventral eye structures by controlling the expression of Pax2 and Vax
genes (reviewed by Yang,
2004), but there is no evidence that its signalling is
specifically needed for optic fissure formation. Only later in development,
when the OD has already formed, is SHH, derived from differentiated RGC,
reported to control the development of the OD PAX2-positive cells
(Dakubo et al., 2003). Here,
we have analysed whether BMP7, the other possible fissure `inducer', might be
relevant for early OD development.
BMP genes, particularly Bmp4 and Bmp7, have been
implicated at different step of eye development. BMP4, which is expressed in
the dorsal retina, has a fundamental role in establishing dorsoventral
polarity of the eye cup and controls local proliferation and programmed cell
death (Koshiba-Takeuchi et al.,
2000; Sakuta el al.,
2001; Trousse et al.,
2001). Different lines of Bmp7-null mice present
microphthalmia or a variably penetrant anophthalmic phenotype owing to the
requirement of BMP7 at early steps of lens induction
(Dudley et al., 1995;
Luo et al., 1995;
Wawersik et al., 1999), a
limiting step in the progression of eye development. Reduction of BMP receptor
activity indicates that BMP signalling is also involved in the growth and
differentiation of the neural retina
(Murali et al., 2005).
Overexpression of the BMP antagonist noggin in the ventral part of the chick
optic cup causes coloboma, pecten agenesis and ectopic expression of optic
stalk markers in the ventral retina (Adler
and Belecky-Adams, 2002), suggesting that BMP signalling does
contribute also to ventral eye development.
Consistent with this idea, we show that Bmp7 is necessary at early steps of eye development to initiate RF formation through the activation of cell proliferation and apoptosis in the proximoventral quadrant of the optic cup. In Bmp7-null mice affected by a microphthalmic phenotype, failure of initiating RF morphogenesis leads to the absence of the hyaloid artery, agenesis of the optic nerve and defects in RGC axon growth. Addition of BMP7 to organotypic cultures of Bmp7-/- optic vesicles rescues the expression of Pax2, a marker for RF precursors. Conversely, the BMP7 inhibitor follistatin abrogates it in early but not late optic vesicle cultures, when instead SHH is required. On the basis of these results, we propose that BMP7 is necessary for RF (and hence optic nerve) formation and that its activity is needed, before that of SHH, for the generation of PAX2-positive cells at the OD.
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONSupplementary materialREFERENCES |
|---|
), were
kindly provided by Prof. E. Robertson (University of Oxford) and maintained in
a C57/Bl6 genetic background. Although the hindlimb polydactyly was fully
penetrant, the incidence of microphthalmia and anophthalmia in the homozygous
embryos of our colony was of 58% and 42%, respectively (n=90). This
anophthalmia incidence is lower than that reported for the 129/sv (60%)
(Dudley et al., 1995) or
C3H/He background (90%) (Wawersik et al.,
1999).
In situ hybridisation
Whole-mount in situ hybridisation using digoxigenin-labelled riboprobes
were carried out as described (Bovolenta
et al., 1998). In some cases embryos were sectioned at 40 µm
with a vibratome (Leica) and floating sections were hybridised as above. The
probes used in this study are for: Pax6
(Walther and Gruss, 1991),
Rx (Mathers et al.,
1997); Vax1 (Bertuzzi
et al., 1999), Vax2
(Barbieri et al., 1999), netrin
1 (Serafini et al., 1996),
Pax2 (Nornes et al., 1995), Raldh3
(Li et al., 2000a),
Bmp4 (Graham et al.,
1994), Tbx5 (Chapman
et al., 1996), ephrin B2, Ephb2
(Birgbauer et al., 2000),
Shh (Echelard et al.,
1993), Fgf8 (Crossley
and Martin, 1995), Mitf
(Hodgkinson et al., 1993) and
Chx10. The last probe was amplified from an E15.5 mouse retina cDNA
library using the following primers 5'TCCAAAGAACCGGGAGATGAC3'
(forward) and 5'TGGAGAAGAGCAGTTCCGAG 3' (reverse).
Histochemical and immunohistochemical procedures
Immunostaining on cryostat or vibratome sections was performed as described
previously (Martínez-Morales et
al., 2001). The primary antibodies used in this study are:
antiserum anti-PAX2 (1:2000, Zymed), monoclonal antibody anti-ß-tubulin
III (TuJ1; 1:5000, Promega), monoclonal anti-BrdU and 5A5 monoclonal anti-NCAM
(Developmental Studies Hybridoma Bank,), guinea-pig antiserum against islet 1
(provided by Prof. T. Jessell, 1:8000) and anti-laminin (Sigma). Cy3-(Jackson
ImmunoResearch) or biotin-conjugated (Chemicon) secondary antibodies followed
by incubation with either streptavidin-Alexa 488 (Molecular Probes) or
streptavidin-peroxidase (Jackson ImmunoResearch) were used for antigen
detection. The presence of the developing vasculature was determined by
labelling with biotinylated IsolectinB4 (1:200, Sigma) followed by
streptavidin-peroxidase. Histological examination of the tissue was performed
using Cresyl Violet-stained paraffin sections.
BrdU incorporation analysis
Pregnant mice at 9.5-10.5 days of gestation were injected intraperitoneally
with BrdU (50 µg/g body weight) in PBS and sacrificed 40 minutes later.
Embryos were embedded in paraffin and sectioned at 6 µm for
immunohistochemical detection of BrdU incorporation. The number of
BrdU-positive cells in the ventral and dorsal halves of the optic cup was
counted using the Vax2 expression domain as a landmark for the
ventral region (see insets in Fig.
6A,B). BrdU incorporation index was calculated as the number of
BrdU-positive cells over the total number of cells in each area.
Detection of apoptotic cell death
The extent and distribution of apoptotic cell death was determined by
TdT-mediated dUTP nick end labelling (TUNEL), using the In Situ Cell Death
Detection Kit, POD (Roche) following the manufacturer's directions. The number
of pyknotic nuclei present in E17.5 retinas was determined using Cresyl Violet
staining.
Retinal explant cultures
The dorsal halves of E14.5 retinas were dissected from C57/BL6 wild-type
embryos and stored in cold L15 medium (Gibco BRL). The dorsal halves were cut
in smaller explants, embedded in collagen matrices (Collaborative Biomedical
Products) and cultured for 24/48 hours in DMEM/F12 medium supplemented with N2
(Gibco BRL) with or without human-recombinant BMP7 (100 ng/µl; R&D). In
some cases, the explants were co-cultured with heparin-acrylic beads soaked in
either BMP7 (100 ng/µl) or PBS. Explants were fixed in 4% paraformaldehyde
in phosphate buffer (0.2 M, pH 7.3) for 20 minutes and immunostained with anti
tubulinß-III to visualize neurite outgrowth. The extent of neurite
outgrowth was quantified with the AIS software (Imaging Research).
Optic cup organotypic cultures
Slices of E9.5-E10 embryonic heads containing the optic primordia were
obtained by manual dissection and stored in cold DMEM/F12. The tissue slices
were layered on polycarbonate-membrane inserts (Falcon) and cultured in
DMEM/F12 supplemented with N2 for 48 hours in the presence or absence of the
following reagents used at 1 µg/ml: BMP7 (R&D), Follistatin (R&D),
N-SHH (Biogen) and the anti-Shh blocking monoclonal antibody 5E1
(Developmental Studies Hybridoma Bank). Isolated optic cups freed from the RPE
were dissected from E12.5 embryos, layered on polycarbonate membranes with the
lens upwards and cultured as above. In all conditions, the development of the
OD was assessed by whole-mount in situ hybridisation with a
Pax2-specific probe.
Retinoic acid administration
Pregnant Bmp7-deficient mice were fed with 100 µg of all-trans
retinoic acid (Sigma) dissolved in corn oil (200 µl) every 12 hours
starting from the E8.5 day of gestation and for the following 3-4 days, as
described (Dickman et al.,
1997). Animals were thereafter sacrificed and the embryos were
scored for RF and optic nerve development by histological and
immunohistochemical examination.
|
RESULTS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONSupplementary materialREFERENCES |
|---|
). Bmp7 is expressed in the ventral midline and in
the proximal region of the developing optic vesicle and then optic cup,
particularly associated with the periocular mesenchyme forming the hyaloid
artery (Dudley and Robertson,
1997) (see Fig. S1 in the supplementary material). The expression
of different BMP receptors is abundant in RF precursors
(Belecky-Adams and Adler, 2001;
Trousse et al., 2001;
Mishina, 2003), strongly
suggesting that Bmp signalling activation may be relevant for RF development.
Furthermore, genetic inactivation of Bmp7 leads to eye defects that,
in the milder cases, are characterised by microphthalmia
(Dudley et al., 1995;
Luo et al., 1995), a phenotype
also reported in association with the absence of the optic fissure
(Silver, 1977). Many of the
developmental defects present in Bmp7-null mice have been previously
described (Dudley et al.,
1995; Luo et al.,
1995; Wawersik et al.,
1999) but the microphthalmic phenotype has not been analysed in
detail, leaving open the possibility of its link with defects in fissure
formation.
|
) maintained in a C57/Bl6 genetic background, where
the incidence of microphthalmia versus anophthalmia was higher (58%) than that
reported in other backgrounds (Dudley et
al., 1995; Wawersik et al.,
1999). In all Bmp7-/- embryos analysed, eye
development was normally initiated (see Fig. S3A,B in the supplementary
material) (see also Dudley et al.,
1995; Luo et al.,
1995), but in 42% of the embryos it did not proceed beyond optic
vesicle stage (Fig. 1B,E,H),
presumably owing to the failure in lens placode induction and hence
lens-vesicle interaction, as already reported
(Dudley et al., 1995;
Luo et al., 1995;
Wawersik et al., 1999).
Lens-derived signalling is also crucial for the initial regionalization of the
optic vesicle into neural retina and retina pigmented epithelium (RPE)
(reviewed by Martínez-Morales et
al., 2004). Consistent with this idea, in the optic primordium of
these embryos the lens placode was rudimentary (see Fig. S2 in the
supplementary material) or absent (Fig.
1E) and the expression of neural retina markers was strongly
downregulated, while that of RPE specific genes expanded (see Fig. S2 in the
supplementary material), explaining the all-pigmented remnants observed at
later stages (Fig. 1E). These
features probably account for the anophthalmic phenotype already described in
these mice (Dudley et al.,
1995; Luo et al.,
1995). In the remaining Bmp7-/- embryos (58%, the only ones considered from now on in this study), these defects were not observed. The lens, neural retina and RPE developed normally although the entire optic cup was smaller (1Fig. 1C,F,I; Fig. 4B) when compared with wild-type embryos (Fig. 1A,D,G; Fig. 4A). Similarly, in the mutants Pax6 expression was restricted to its normal domain but the signal appeared more uniformly distributed than in wild type (see Fig. S3B,C in the supplementary material). Notably, this microphthalmic phenotype was always associated with the absence of a morphologically visible RF (compare Fig. 1I, Fig. 2J with Fig. 1G, Fig. 2G) and OD (compare Fig. 2K,L and Fig. 4B with Fig. 2H,I and Fig. 4A). There were no morphological signs of a RF even at earlier stages of gestation (compare Fig. 2D-F with 2A-C; see Fig. S3E,H in the supplementary material), suggesting that its premature closure was an unlikely explanation for this phenotype and, instead, indicating that Bmp7 activity is required for the initial phases of optic fissure development.
|
Previous studies have shown that Pax2 is expressed with a
ventral-to-dorsal gradient in the mouse optic vesicle and stalk (see Fig. S3A
in the supplementary material) (Nornes et
al., 1990; Torres et al.,
1996; Otteson et al.,
1998). As the optic cup forms, PAX2 becomes restricted to the
ventral retina (Otteson et al.,
1998) (Fig. 2A) in
invaginating RF precursors (Fig.
2C; see Fig. S3E in the supplementary material) and then to a
small group of neuroepithelial cells that encircle the pioneer RGC axons and
hyaloid artery at the OD (Otteson et al.,
1998) (Fig. 2G-I;
Fig. 3A). Thus, by E12.5, PAX2
expression distinguishes the cells that compose the OD from the remaining
cells of the optic cup (Fig.
2G-I; Fig. 3A). In
Bmp7-/- optic vesicles, PAX2 expression was initially
undistinguishable from that of wild-type littermates (see Fig. S3B in the
supplementary material) but it was reduced in the distoventral region of the
optic cup from E10.5, where the RF was undetectable (see Fig. S3F in the
supplementary material; Fig.
2D-F). The reduction of invaginating, PAX2-positive ventral
precursors was progressively more evident in proximal regions of the cup
(Fig. 2E,F) and PAX2-positive
cells were observed only in ventral prospective RPE and not in neural retina
(Fig. 2E) in the region
bordering the optic stalk. Two days later, PAX2 was completely absent from the
optic cup of Bmp7-/- embryos
(Fig. 2J-L;
Fig. 3B) but still localised to
optic stalk precursors (Fig. 2L
inset; Fig. 3B) as observed in
wild-type embryos (Fig. 2I,
inset; Fig. 3A).
|
;
Hopker et al., 1999), appears
mostly confined to RF precursors from E10.5 (see Fig. S3G in the supplementary
material; Fig. 3C). Thus, cells
of the RF/OD can be distinguished by the expression of netrin 1 and by the
overlapping distribution of both optic stalk and ventral neural retina
markers, the combination of which gives them a unique identity within the eye
cup (Fig. 3I). Supporting our
conclusion, Pax2 and netrin 1 expression was clearly diminished in
the ventral optic cup of E10.5-Bmp7-null embryos (see Fig. S3E-H in
the supplementary material), and by E12.5, Pax2, netrin 1,
Raldh3 and Vax1 were not detected in the region where the RF
should form (Fig. 3B,D,F,H) but
were still present in the initial region of the optic stalk (arrows in
Fig. 3B,D,H) or in the cup
periphery (Fig. 3F).
Failure in OD formation in microphthalmic Bmp7-/- is associated with aplasia of the optic nerve, intra-retinal misrouting of RGC axons and absence of the hyaloid artery
The RF/OD enables the ingression of mesenchymal cells that form the hyaloid
artery and the egression of RGC axons into the optic nerve. Therefore, failure
in RF formation should also impair these processes. To test this assumption,
we labelled E12.5 optic cup sections with Isolectin B4 that selectively binds
to blood vessels. In wild-type embryos, a presumptive IB4-positive hyaloid
artery was easily detectable in the proximal region of the optic cup
(Fig. 2N), while there was no
trace of it in equivalent sections from Bmp7-/- embryos
(Fig. 2P). By contrast, the
distal region of the optic cup was normally nourished by branches of the
annular vessels in both wild-type and Bmp7-null embryos
(Fig. 2M,O).
In wild-type embryos, many Tuj1-positive RGC axons have already grown through the OD into the optic nerve by E14.5 (Fig. 4C). By contrast, retinal axons of mutant embryos do not leave the eye but instead take aberrant trajectories within the retina, gathering either onto the vitreal surface or in the subretinal space (Fig. 4D,D'). As a consequence of these alterations, in those homozygous mutants that reach birth, the eye globes lack the OD and show several hypo-pigmented areas that may correspond to aberrant accumulations of axons (Fig. 4B,B' when compared with A,A'). Bmp7-null mice generally die soon after birth. However, in our colony, a few animals (1% of the homozygous) developed to the second and third postnatal weeks. Among these, the vast majority presented complete aplasia and one bilateral hypoplasia of the optic nerves.
The strong alterations in the RGC axon trajectory can be easily explained
as a consequence secondary to the physical absence of the OD and of the
reduced expression of netrin 1 (Fig.
3C,D). Additional explanations could include the altered
expression of other axon guidance cues [such as laminin or NCAM, which are
known to participate in RGC axon pathfinding at the optic disk
(Stuermer and Bastmeyer,
2000)], an abnormal generation of RGC or a direct effect of BMP7
on the outgrowth or directionality of RGC growth cones. The latter possibility
was supported by the observation that BMPs can provide directionality to
commissural axons of the spinal cord
(Butler and Dodd, 2003) and by
Bmp7 expression in the mesenchyme abutting the outgrowing axons (see
Fig. S1G,H in the supplementary material). Nevertheless, none of these
processes appeared to contribute to these guidance defects: laminin and NCAM
appeared expressed at normal levels (data not shown) and RGC differentiated at
a normal density in the Bmp7-/- retinas (see Fig. S4A-C in
the supplementary material); addition of BMP7 to retinal explant cultures did
not modify the extent of neurite outgrowth observed in control conditions (see
Fig. S4D,E in the supplementary material) or its directionality, when explants
where exposed to a focalised source of the protein (data not shown). Thus,
navigation errors of the retinal axons `en route' to the disc seem to be
related to the loss of the OD and of the guidance cues derived from it.
|
),
suggesting a link between the two events. We therefore asked whether absence
of Bmp7 could alter dorsoventral polarity of the early optic cup and
thus impair RF formation. However, the expression of ventral eye markers such
as Vax2 (Fig. 5A,B) or
Ephb (Yang, 2004)
(data not shown), was initially normal. Similarly, the distribution of
components of the Shh signalling pathway (Shh, Ptch1, Gli1 and
Gli3, not shown), which are known to control ventral eye development
(Lupo et al., 2006), as well
as that of the dorsal eye markers Bmp4
(Fig. 5C,D), Tbx5 and
ephrin B2 (not shown), was unchanged.
|
; Matt et al.,
2005; Molotkov et al.,
2006). Deprivation of RA causes morphological alterations of the
ventral retina (Maden, 2002;
Matt et al., 2005;
Molotkov et al., 2006), while
implantation of RA-charged beads within the eye field induces an infolding
resembling the optic fissure (Hyatt et
al., 1996). The expression of Raldh3 was decreased in
Bmp7-/- deficient embryos
(Fig. 3F;
Fig. 5F), raising the
possibility of a RA-mediated Bmp7 activity on RF formation. However,
oral administration of RA (Dickman et al.,
1997) to pregnant heterozygous mice (n=5) did not rescue
RF formation in the mutant embryos, making this link unlikely.
BMP7 regulates proliferation and apoptosis during optic fissure development
Besides dorsoventral patterning, fissure formation has been associated also
with an increased cell proliferation
(Calvente et al., 1988) and a
marked apoptotic cell death (Cuadros and
Rios, 1988; Ozeki et al.,
2000). BMP signalling is implicated in the regulation of both
proliferation and apoptosis in different neural structures, including the eye
(Trousse et al., 2001). We,
thus, examined whether BMP7 effects on fissure formation could involve
alterations in either one of the two processes.
At E10.5, the ventral optic cup of wild-type embryos showed a significantly
higher number of BrdU-positive, proliferating cells when compared with the
dorsal half (compare 64.91±4.92 with 41.79±7.25; n=5;
Fig. 6C). This difference was
absent in the Bmp7-/- embryos, where the rate of cell
proliferation was almost identical in both the ventral and dorsal aspect of
the eye (compare 45.55±5.45 with 48.42±6.07; n=5;
Fig. 6A-C). Similarly,
apoptotic cell death, detected by TUNEL staining, was markedly decreased in
the mutant embryos when compared with wild-type littermates
(Fig. 6D-I). This decrease was
more evident in the proximal pole of the cup (compare
Fig. 6H,I with 6E,F)
corresponding to the region where the optic fissure normally forms
(Martín-Partido et al.,
1988; Ozeki et al.,
2000; Silver and Hughes,
1973). Altogether, these data indicate that Bmp7-mediated
signalling controls proliferation and programmed cell death of RF
precursors.
Bmp7 requirement for RF formation is independent of Chx10
The traits we have described for the microphthalmic phenotype of
Bmp7-null mice strongly resembled those described for the ocular
retardation (or) mouse line. Mice carrying the orJ
allele, which causes a premature stop codon in the homeobox of the
Chx10 gene, are characterised by microphthalmia, reduced
proliferation of retinal progenitors
(Burmeister et al., 1996) and
optic nerve aplasia associated with decreased programmed cell death and
intra-retinal navigation errors (Silver
and Robb, 1979). It was therefore possible that Bmp7 and
Chx10 would act sequentially in the same genetic cascade. However,
Bmp7 is normally expressed in the optic cup of or
J embryos (Fig.
7C,D). Vice versa, the expression of Chx10 did not appear
reduced in the optic cup of Bmp7-/- embryos with an
evident lens placode (about 50%; Fig.
7A,B). Thus, Bmp7 requirement for early RF formation
appeared independent of Chx10 function. Furthermore, careful analysis
of orJ early optic cup revealed the presence of a
morphologically and molecularly recognisable RF
(Fig. 7E,F), although this
structure was no longer visible at slightly later stages of development
(Fig. 7G-J). A possible
explanation for this disappearance is the severely reduced generation of
Math5-positive RGC precursors
(Fig. 7I,J)
(Rowan et al., 2004;
Horsford et al., 2005), and
thus the reduced availability of RGC-derived SHH, which, in turn, is necessary
to maintain the PAX2-positive cells of the OD
(Dakubo et al., 2003).
|
), we
hypothesised that the development of the PAX2-positive RF precursors should
initially require the activity of Bmp7 to specify their identity and,
thereafter, that of Shh to maintain it. To test this hypothesis, we
turned to organotypic cultures of optic vesicle (E10) or of optic cups (E12.5)
derived from either wild-type, Bmp7-/- or
orJ embryos. If our assumption was correct, we expected
that addition of BMP7 to optic vesicles derived from
Bmp7-/- embryos would suffice to rescue
Pax2-positive cells at the RF, while addition of SHH would do the
same in the late optic cup from orJ mutants. As shown in
Fig. 8, recombinant BMP7
present in the medium of control E10 optic vesicle cultures did not
significantly expand the domain of Pax2 expression after 48 hours
(Fig. 8A,A',B,B';
8/8 treated vesicles), but it rescued Pax2 expression in the ventral
region of Bmp7-/- vesicles
(Fig. 8E,E'; 4/6 treated
vesicles), when compared with equivalent untreated tissue
(Fig. 8D,D'; 9/9).
Rescued Pax2 expression was observed also when SHH was added to the
medium of already formed optic cups from E12.5 orJ embryos
(compare Fig. 8J with 8I; 4/5
treated cups). Converse experiments, using the BMP7 antagonist follistatin in
cultures of wild-type eye primordia at different stages of differentiation,
indicated that inhibition of BMP7 signalling efficiently prevented the
formation of Pax2-positive cells in the ventral region of early
(Fig. 8C,C'; 78%, 7/9
treated vesicle) but not late (Fig.
8G; 10/10) optic cups. Pax2-positive cells were, however,
strongly reduced if the late optic cups were cultured in the presence of
SHH-specific blocking antibodies (Fig.
6H; 5/6 treated cups), as previously described
(Dakubo et al., 2003). This
demonstrates a sequential requirement of BMP7 and SHH for the development of
Pax2-positive cells at the RF.
|
|
DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONSupplementary materialREFERENCES |
|---|
). We thus propose that the OD is composed by a special group of cells, the development of which depends on the sequential activity of BMP7 and SHH.
Optic disc precursors are a unique group of Bmp7-dependent Pax2-positive cells
In a developmental study of PAX2-positive cells in the embryonic mouse eye,
Otteson and colleagues (Otteson et al.,
1998) demonstrated that PAX2-positive distoventral optic cup cells
invaginate to demarcate the site of OD formation. Because these cells are in
close continuity with those of the optic stalk, they proposed that OD
precursors may represent an extension of stalk cells into the optic cup
(Otteson et al., 1998). Here,
we show that RF precursors have instead an identity of their own,
characterised by the combined expression of netrin 1 and ventral retinal
markers (Fig. 3I). In support
of this diversity, optic stalk but not RF precursors are normally generated in
Bmp7-deficient mouse embryos (Fig.
2 insets), although their development is thereafter impaired, as
demonstrated by the aplasia of the optic nerve observed in older mutants. This
secondary alteration, however, is a likely consequence of RGC axon failure to
leave the eye cup and, thus, of the absence of axon-derived factors, such as
Shh (Wallace and Raff, 1999),
that are needed to sustain glial cell development
(Fields and Stevens-Graham,
2002). By contrast, the absence of different OD markers in
Bmp7-null embryos indicates a direct dependence of these cells on Bmp
signalling, an idea supported also by the highly enriched expression in the RF
of the BMP receptor Bmpr1b and of the activin receptors
Acvr2a and Acvr1a
(Belecky-Adams and Adler, 2001;
Trousse et al., 2001;
Liu et al., 2003;
Mishina, 2003), through which
BMP7 can signal (Mishina,
2003).
Bmp signalling appears to regulate the proliferation, survival and
morphogenetic behaviour of distal lung epithelial cells
(Eblaghie et al., 2006). BMP7
may have a similar pleiotropic activity on RF precursors, specifying their
identity, promoting their morphogenetic movements and further controlling
their proliferation, as suggested by the reduced mitotic rate observed in the
ventral optic cup of Bmp7-/- embryos. In these embryos, a
reduced number or absence of PAX2-positive cells in the ventral optic cup
seems to compromise the correct infolding of its inner layer to initiate
fissure formation (Fig. 2Q). A
similar defect was observed also in kidney and retinal defect (Krd)
haploid embryos, where an insufficient number of PAX2-positive cells could
explain the lack of ventral neuroepithelium invagination to form the optic
groove (Otteson et al., 1998).
In our study, we could not determine whether the reduced apoptosis observed in
the mutants is a consequence of the decreased cell proliferation or whether
Bmp7 directly controls cell death in the optic fissure. However, optic fissure
formation appears to be initiated even in the absence of a significant amount
of apoptosis (Silver and Robb,
1979), while preventing optic fissure invagination does not modify
programmed cell death in this region
(Garcia-Porrero et al., 1987),
questioning the real contribution of apoptosis to optic fissure formation.
|
;
Huillard et al., 2005). It is
not surprising that these defects do not exactly match those observed in the
Bmp7-null mice because they result from Bmp signalling interference
at relatively late stages of optic cup development, reflecting a contribution
of Bmp signalling to late ventral eye cup development
(Adler and Belecky-Adams,
2002). Ligands other then BMP7 may contribute to the control of
retinal polarity because, in Bmp7-null microphthalmic eye cups, the
expression of dorsoventral markers was basically normal with the exception of
low levels of Raldh3. However, exogenous administration of RA did not
rescue the microphthalmic phenotype of the Bmp7-/-
embryos, somehow dissociating RF initiation from the establishment of the
ventral identity of the eye cup. Rather, the data presented here provide
support to classical embryological studies in amphibian
(Beckwith, 1927;
Sato, 1933) and the more
recent studies in birds (Silver,
1977; Uemonsa et al.,
2002) that postulate the existence of an optic fissure initiating
factor (or factors). Independently of its precise anatomical source (ventral
midline, periocular mesenchyme or optic stalk, see Fig. S1 in the
supplementary material), BMP7 appears to be required as such an initiating
factor.
The sequential activity of BMP7 and SHH supports optic disc development
The phenotypic alterations we observed in Bmp7-null microphthalmic
embryos strongly resembled those reported for Chx10/orJ
mice (Silver and Robb, 1979;
Burmeister et al., 1996).
However, we show that the common OD absence has independent molecular causes.
Although Chx10 expression was strongly reduced in the
Bmp7-null embryos that presumably develop an anophthalmic phenotype
(see Fig. S2 in the supplementary material), it was apparently normal in those
affected by microphthalmia. Vice versa, Bmp7 mRNA distribution was
unchanged in the eye of orJ embryos. Furthermore, in
orJ but not in Bmp7-null embryos, RF development
was normally initiated indicating that factor(s) other that BMP7 are required
at subsequent steps of eye development to sustain OD formation. As
demonstrated by conditional inactivation studies, this factor appears to be
SHH secreted by differentiated RGCs
(Dakubo et al., 2003). Indeed,
specific abrogation of RGC-derived SHH causes the loss of OD precursors in
already formed optic cups (Dakubo et al.,
2003). Supporting this idea, we show that addition of SHH in
organotypic cultures rescues Pax2 expression in the optic cups from
orJ embryos, where RGC are highly reduced in number.
Altogether, these data suggest a model whereby OD formation requires the sequential and independent activity of BMP7 and SHH. BMP7, possibly secreted by the periocular mesenchyme is sufficient to initiate RF development. BMP7 addition to cultures of Bmp7-/- optic vesicle (well before RGC have begun to differentiate and thus in absence of Shh) is sufficient to induce PAX2 expression in the distoventral optic cup. This requirement is temporal because follistatin abolishes PAX2 expression in early, but not in late, optic cup cultures from wild-type embryos. Once RF precursors are specified, SHH secreted by pioneer RGC axons further maintains OD cells, thereby assuring proper development of axonal connections.
Specification of ventral midline cells (floor plate) in the caudal neural
tube requires Shh activity, while differential specification of those in the
rostral (diencephalic) region depends on the cooperative interaction between
Shh and Bmp7 (Dale et al.,
1997). It has been proposed that BMP7 activity may predispose
rostral midline cells to acquire diencephalic characteristics in response to
SHH, which otherwise would induce cells with floor plate properties
(Dale et al., 1997). In a
possible speculative analogy, sequential activity of Bmp7 and Shh might be
necessary to differentiate retinal fissure precursors from the remaining
PAX2-positive cells of the optic stalk.
Intra-retinal axon misrouting, failure of hyaloid artery formation and OD agenesis
In Bmp7-null embryos, optic nerves do not develop because RGC
axons do not leave the eye and instead take aberrant trajectories,
accumulating predominantly in the subretinal space. Similar alterations in RGC
axon navigation have been reported in mice lacking Bmpr1b
(Liu et al., 2003) or after
inhibition of BMP signalling in the ventral optic cup
(Adler and Belecky-Adams, 2002;
Huillard et al., 2005).
Although there is evidence that BMPs can modify growth cone movements
(Bovolenta, 2005), we could not
detect any direct effect of BMP7 on RGC axon behaviour. Thus, the simpler
explanation for the axon guidance phenotype of Bmp7-/-
embryos is the absence of a morphological structure through which axons can
navigate. An additional likely factor is the reduced expression of netrin1
(Deiner et al., 1997) and
possibly of other locally expressed guidance cues, as for example
Sfrp1 (Rodríguez et al.,
2005).
A similar mechanical explanation may account for the failure of hyaloid
artery formation, although a direct dependence on BMP7 activity cannot be
excluded in this case. BMP7 is essential for mesenchymal to epithelial
transition during kidney development and regeneration
(Zeisberg et al., 2003;
Zeisberg et al., 2005). It is
then possible that a BMP7 autocrine function on periocular mesenchyme may
enable its transition to endothelial cells. The absence of the hyaloid artery
in the Bmp7 mutants, together with the expression of this morphogen
in the artery forming mesenchyme also raises the interesting possibility that
this tissue may actively contribute to the initiation of fissure formation.
Organised mesenchymal cells could mechanically promote the invagination of the
ventral eye primordium and further provide the morphogenetic signal to control
the specification and proliferation of RF precursors. Shaping of the ventral
optic cup would then require mesenchymal-neuroepithelial interaction, an event
also proposed for the specification of the RPE, a dorsal derivative of the
optic vesicle (reviewed by
Martínez-Morales et al.,
2004).
Independently of the precise relationship between RF and hyaloid artery
formation, the Bmp7-/- microphthalmic phenotype strongly
resembles a rare congenital pathology known as `true aplasia of the optic
nerve' characterised by the absence of the optic nerve, hyaloid vessels and OD
(Little et al., 1976;
Weiter et al., 1977), opening
the possibility that altered expression of BMP7 might also be the molecular
cause of these types of malformation in humans.
Another question that deserves attention is whether the mechanisms that may
control RF/OD formation in mammals may also apply to other vertebrate as
interesting species specific features exist, including possible morphogenetic
movements (Holt, 1980), the
relative position of the fissure within the eye cup
(Schook, 1980;
Li et al., 2000b) and the
expression of molecular markers. As an example, in Xenopus, cells in
the ventral retina where the choroid fissure forms, seem to move into position
from the optic stalk (Holt,
1980). Intriguingly, in the chick, where only one Vax gene has
been found (Vax) (Schulte et al.,
1999), RF is enlarged and the domain of netrin 1 expression is
wider than in the mouse (F.T. and P.B., unpublished), pointing to possible
variations in the molecular mechanisms of OD formation.
|
Supplementary material |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONSupplementary materialREFERENCES |
|---|
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
Present address: Centre de Biologie du Développement, CNRS/UPS UMR
5547. Univ. P. Sabatier. 31062 Toulouse Cedex 4, France
|
REFERENCES |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONSupplementary materialREFERENCES |
|---|
Adler, R. and Belecky-Adams, T. L. (2002). The
role of bone morphogenetic proteins in the differentiation of the ventral
optic cup. Development
129,3161
-3171.
Barbieri, A. M., Lupo, G., Bulfone, A., Andreazzoli, M.,
Mariani, M., Fougerousse, F., Consalez, G. G., Borsani, G., Beckmann, J. S.,
Barsacchi, G. et al. (1999). A homeobox gene, vax2,
controls the patterning of the eye dorso-ventral axis. Proc. Natl.
Acad. Sci. USA 96,10729
-10734.
Barbieri, A. M., Broccoli, V., Bovolenta, P., Alfano, G.,
Marchitiello, A., Mocchetti, C., Crippa, L., Bulfone, A., Marigo, V.,
Ballabio, A. et al. (2002). Vax2 inactivation in mouse
determines alteration of the eye dorsal-ventral axis, misrouting of the optic
fibres and eye coloboma. Development
129,805
-813.
Barishak, Y. R. (1992). Embryology of the eye and its adnexae. Dev. Ophthalmol. 24, 1-142.[Medline]
Beckwith, C. J. (1927). The effects of extirpation of the lens rudiment on the development of the eye in Amblystoma punctatum, with special reference to the choroids fissure. J. Exp. Zool. 49,217 -259.[CrossRef]
Belecky-Adams, T. and Adler, R. (2001). Developmental expression patterns of bone morphogenetic proteins, receptors, and binding proteins in the chick retina. J. Comp. Neurol. 430,562 -572.[CrossRef][Medline]
Bertuzzi, S., Hindges, R., Mui, S. H., O'Leary, D. D. and Lemke,
G. (1999). The homeodomain protein Vax1 is required for axon
guidance and major tract formation in the developing forebrain.
Genes Dev. 13,3092
-3105.
Birgbauer, E., Cowan, C. A., Sretavan, D. W. and Henkemeyer, M. (2000). Kinase independent function of EphB receptors in retinal axon pathfinding to the optic disc from dorsal but not ventral retina. Development 127,1231 -1241.[Abstract]
Bovolenta, P. (2005). Morphogen signalling at the vertebrate growth cone: a few cases or a general strategy? J. Neurobiol. 64,405 -416.[CrossRef][Medline]
Bovolenta, P., Mallamaci, A., Puelles, L. and Boncinelli, E. (1998). Expression pattern of cSix3, a member of the Six/sine oculis family of transcription factors. Mech. Dev. 70,201 -203.[CrossRef][Medline]
Burmeister, M., Novak, J., Liang, M. Y., Basu, S., Ploder, L., Hawes, N. L., Vidgen, D., Hoover, F., Goldman, D., Kalnins, V. I. et al. (1996). Ocular retardation mouse caused by Chx10 homeobox null allele: impaired retinal progenitor proliferation and bipolar cell differentiation. Nat. Genet. 12,376 -384.[CrossRef][Medline]
Butler, S. J. and Dodd, J. (2003). A role for BMP heterodimers in roof plate-mediated repulsion of commissural axons. Neuron 38,389 -401.[CrossRef][Medline]
Calvente, R., Carmona, R., Abadia-Molina, F. and Abadia-Fenoll, F. (1988). Stereological study on the mode of optic cup expansion and the accumulation of mitoses in the early stages of chick embryo development. Anat. Rec. 222,401 -407.[CrossRef][Medline]
Chapman, D. L., Garvey, N., Hancock, S., Alexiou, M., Agulnik, S. I., Gibson-Brown, J. J., Cebra-Thomas, J., Bollag, R. J., Silver, L. M. and Papaioannou, V. E. (1996). Expression of the T-box family genes, Tbx1-Tbx5, during early mouse development. Dev. Dyn. 206,379 -390.[CrossRef][Medline]
Chen, D., Zhao, M. and Mundy, G. R. (2004). Bone morphogenetic proteins. Growth Factors 22,233 -241.[CrossRef][Medline]
Crossley, P. H. and Martin, G. R. (1995). The mouse Fgf8 gene encodes a family of polypeptides and is expressed in regions that direct outgrowth and patterning in the developing embryo. Development 121,439 -451.[Abstract]
Cuadros, M. A. and Ríos, A. (1988). Spatial and temporal correlation between early nerve fiber growth and neuroepithelial cell death in the chick embryo retina. Anat. Embryol. 178,543 -551.[CrossRef][Medline]
Dakubo, G. D., Wang, Y. P., Mazerolle, C., Campsall, K.,
McMahon, A. P. and Wallace, V. A. (2003). Retinal ganglion
cell-derived sonic hedgehog signaling is required for optic disc and stalk
neuroepithelial cell development. Development
130,2967
-2980.
Dale, J. K., Vesque, C., Lints, T. J., Sampath, T. K., Furley, A., Dodd, J. and Placzek, M. (1997). Cooperation of BMP7 and SHH in the induction of forebrain ventral midline cells by prechordal mesoderm. Cell 90,257 -269.[CrossRef][Medline]
Deiner, M. S., Kennedy, T. E., Fazeli, A., Serafini, T., Tessier-Lavigne, M. and Stretavan, D. W. (1997). Netrin-1 and DCC mediate axon guidance locally at the optic disc: loss of function leads to optic nerve hypoplasia. Neuron 19,575 -589.
