spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 16 August 2006
doi: 10.1242/dev.02547


Development 133, 3651-3660 (2006)
Published by The Company of Biologists 2006


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.02547v1
133/18/3651    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, J.
Right arrow Articles by Klein, P. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, J.
Right arrow Articles by Klein, P. S.

Kermit 2/XGIPC, an IGF1 receptor interacting protein, is required for IGF signaling in Xenopus eye development

Jinling Wu1, Michael O'Donnell2, Aaron D. Gitler1 and Peter S. Klein1,2,*

1 Cell and Molecular Biology Graduate Group, University of Pennsylvania School of Medicine, 364 Clinical Research Building, 415 Curie Blvd, Philadelphia, PA 19104, USA.
2 Department of Medicine (Hematology-Oncology), University of Pennsylvania School of Medicine, 364 Clinical Research Building, 415 Curie Blvd, Philadelphia, PA 19104, USA.

* Author for correspondence (e-mail: pklein{at}mail.med.upenn.edu)

Accepted 18 July 2006


    SUMMARY
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
GIPC is a PDZ-domain-containing protein identified in vertebrate and invertebrate organisms through its interaction with a variety of binding partners including many membrane proteins. Despite the multiple reports identifying GIPC, its endogenous function and the physiological significance of these interactions are much less studied. We have previously identified the Xenopus GIPC homolog kermit as a frizzled 3 interacting protein that is required for frizzled 3 induction of neural crest in ectodermal explants. We identified a second Xenopus GIPC homolog, named kermit 2 (also recently described as an IGF receptor interacting protein and named XGIPC). Despite its high amino acid similarity with kermit, kermit 2/XGIPC has a distinct function in Xenopus embryos. Loss-of-function analysis indicates that kermit 2/XGIPC is specifically required for Xenopus eye development. Kermit 2/XGIPC functions downstream of IGF in eye formation and is required for maintaining IGF-induced AKT activation. A constitutively active PI3 kinase partially rescues the Kermit 2/XGIPC loss-of-function phenotype. Our results provide the first in vivo loss of function analysis of GIPC in embryonic development and also indicate that kermit 2/XGIPC is a novel component of the IGF pathway, potentially functioning through modulation of the IGF1 receptor.

Key words: Kermit 2, GIPC, Insulin like growth factor (IGF), IGF1 receptor (IGF1R), Eye development, Xenopus


    INTRODUCTION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
GIPC (GAIP interacting protein, C terminus) is a PDZ-domain-containing protein initially identified by virtue of its interaction with RGS-GAIP (regulator of G protein signaling-GTPase activating protein for G{alpha}i) (De Vries et al., 1998bGo). The list of identified binding partners for GIPC includes numerous membrane proteins (Katoh, 2002Go), such as the transmembrane semaphorin M-SemF (Wang et al., 1999Go), neuropilin 1 (Cai and Reed, 1999Go), the Wnt receptor frizzled 3 (Tan et al., 2001Go), the ß1-adrenergic receptor (Hu et al., 2003Go), the TGFß-type III receptor (Blobe et al., 2001Go), melanosomal membrane protein gp75 (tyrosinase-related protein 1) (Liu et al., 2001Go), the tyrosine kinase receptor TrkA (Lou et al., 2001Go), intergrin {alpha} subunits (El Mourabit et al., 2002Go; Tani and Mercurio, 2001Go), insulin-like growth factor 1 receptor (IGF1R) (Booth et al., 2002Go; Ligensa et al., 2001Go), human lutropin receptor (Hirakawa et al., 2003Go), myosin VI (Dance et al., 2004Go; Hasson, 2003Go), dopamine D2 and D3 receptors (Jeanneteau et al., 2004aGo; Jeanneteau et al., 2004bGo), a myeloid cell-surface marker CD93 (Bohlson et al., 2005Go) and human papillomavirus type 18 E6 protein (Favre-Bonvin et al., 2005Go). Although the list of GIPC-binding partners is long, the endogenous function of GIPC and the physiological significance of these associations are much less studied. Loss-of-function studies published so far have been primarily in ex vivo or in vitro systems, such as Xenopus ectodermal explants (Tan et al., 2001Go) and cultured cell lines (Favre-Bonvin et al., 2005Go; Hirakawa et al., 2003Go); the in vivo role of GIPC in embryonic development has not yet been examined.

Previously, we identified a Xenopus homolog of GIPC, kermit (Tan et al., 2001Go), that is 72% identical to mammalian GIPC (De Vries et al., 1998bGo). Knockdown of kermit using antisense morpholino oligonucleotides blocked neural crest induction by Xenopus frizzled 3 in ectodermal (animal cap) explants (Tan et al., 2001Go), but did not inhibit neural crest formation in whole embryos. We reasoned that this negative result may indicate the presence of a compensating or redundant activity in whole embryos that is absent in animal cap explants. We therefore identified a second kermit gene (67% amino acid identity with kermit 1) in Xenopus early embryos to study the redundancy between kermit and kermit2. Unexpectedly, we discovered a novel function for kermit 2 in IGF signaling that does not overlap with kermit 1.

Kermit 2 is identical to XGIPC, identified in a yeast two hybrid screen for IGF1 receptor binding proteins in Xenopus oocytes (Booth et al., 2002Go). XGIPC/kermit 2 binds to the cytoplasmic domain of the Xenopus IGF1R and this interaction appears to require the PDZ domain of XGIPC. Overexpression of C-terminal truncation mutants of XGIPC that retain the PDZ domain blocks insulin-induced Xenopus MAP kinase activation and oocyte maturation. Human GIPC was also identified as a binding partner for human IGF1R (Ligensa et al., 2001Go).

IGF signaling has been recently implicated in neural induction in Xenopus and zebrafish embryos (Eivers et al., 2004Go; Pera et al., 2003Go; Pera et al., 2001Go; Richard-Parpaillon et al., 2002Go). Ectopic expression of IGF in dorsal cells leads to the induction of ectopic eyes and eye expansion and, when expressed in ventral cells, induces secondary head-like structures (Pera et al., 2001Go; Richard-Parpaillon et al., 2002Go). Inhibition of IGF signaling by either dominant-negative IGF1R or IGF1R depletion reduces head structures (Pera et al., 2001Go; Richard-Parpaillon et al., 2002Go). As kermit 2/XGIPC physically interacts with XIGF1R, we examined the involvement of kermit 2/XGIPC in IGF signaling in Xenopus embryonic development.

We report here that kermit2/XGIPC is expressed throughout Xenopus early embryonic development and is localized to the anterior region during neurula stage in a pattern highly similar to XIGF1R (Richard-Parpaillon et al., 2002Go). Knockdown of kermit 2 leads to embryos with reduced anterior structures, specifically reduction in the presumptive eye region. Furthermore, depletion of kermit 2 and expression of dominant-negative XIGF1R synergistically inhibit eye development. Kermit 2 is required for IGF1 induced eye formation in whole embryos and for the induction of eye molecular markers in ectodermal explants. Finally, we present evidence that kermit 2 is required to maintain IGF/PI3 kinase-dependent activation of AKT. These results indicate that kermit 2/XGIPC is required for IGF signaling in Xenopus eye development likely through its interaction with the IGF1 receptor.


    MATERIALS AND METHODS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cloning of kermit2, plasmid constructs and in vitro transcription
kermit2 was identified through a Blast search of the Xenopus EST database using the kermit sequence (Tan et al., 2001Go). The GenBank accession number for kermit2 is BC089139. kermit2 5'UTR sequence was identified from a stage 10 Xenopus 5'RACE cDNA library. Capped mRNAs were synthesized by in vitro transcription of plasmids encoding XIGF1R (Richard-Parpaillon et al., 2002Go), DN-IGFR (Pera et al., 2001Go), XIGF1 (Pera et al., 2001Go), p110* (Carballada et al., 2001Go), kermit 2/pCS2, kermit 2-GFP/pCS2 and 5'UTR-kermit 2-GFP/pCS2 (described below) using SP6 mMessage mMachine kits (Ambion). Kermit 2/pCS2 was cloned by RT-PCR amplifying stage 1 Xenopus RNA using primers (forward, AGGGATCCATGCCTCTGGGATTGCGCGTA; reverse, AGTCTAGATTAAAAGCGTCCTTGTTTAGC) with engineered BamHI and XbaI sites and cloned directionally into pCS2+. Kermit 2-GFP/pCS2 was generated by PCR using kermit 2/pCS2 as the template and cloned into BamHI/EcoRI sites of pCS2-EGFP. 5'UTR-kermit 2-GFP/pCS2 was cloned by PCR amplifying using primers (upstream, CGGGATCCCAGGACTAAGGAACAGGAGGCAGG; downstream, AGGAATTCAAAGCGTCCTTGTTTAGCATC) with engineered BamHI and EcoRI sites and cloned directionally into pCS2-EGFP.

RT-PCR
RNA isolation and RT-PCR methods are described elsewhere (Yang et al., 2002Go). Primers for EF-1{alpha} (Yang et al., 2002Go), ODC (Yang et al., 2002Go), Otx2 (Cox and Hemmati-Brivanlou, 1995Go), En2 (Hemmati-Brivanlou et al., 1994Go), muscle actin (Hemmati-Brivanlou and Melton, 1994Go), XAG (Blitz and Cho, 1995Go) and Xrx (Mathers et al., 1997Go) have been described previously. Primers were designed to detect kermit2 (upstream, ATGCCTCTGGGATTGCGCGTAAAG; downstream, TTTAACTTTGTCAATCGTGCTCTC), HoxD1 (upstream, CACTTCTTGCGGGGATGTTT; downstream, AGAGTCCTGTAGCTCAGCTG), Pax6 (by N. Hirsch and W. Harris; upstream, AGTGTCCTCATTCACATCG; downstream, AGTACTGAGACATGTCAGG) and Vent1 (upstream, GCATCTCCTTGGCATATTTGG; downstream, TTCCCTTCAGCATGGTTCAAC).

Lineage tracing and in situ hybridization
Embryos were co-injected with RNA encoding ß-galactosidase with a nuclear localization motif and control morpholino or kermit 2 morpholino (5'-AGAGGCATCTTTCTTTCAGCGAAGG-3'). ß-Galactosidase activity was visualized in embryos with Red-Gal (Research organics). Whole-mount in situ hybridization was performed as described (Deardorff et al., 1998Go). Antisense probes detected chordin (Sasai et al., 1994Go), gooscoid (Blumberg et al., 1991Go), Bf1 (Papalopulu and Kintner, 1996Go), Otx2 (Lamb et al., 1993Go), Pax6 (Hirsch and Harris, 1997Go) and Xrx (Mathers et al., 1997Go). For sense probes, kermit 2/pCS2 was linearized by NotI and transcribed by Sp6 polymerase. For antisense probes, kermit 2/pCS2 was linearized by BamHI and transcribed by T7 polymerase.

Embryos, microinjection, immunoprecipitation and immunoblotting
Eggs were obtained from Xenopus females, in vitro fertilized and microinjected as described (Deardorff et al., 1998Go). Each injected blastomere received 10 nl of RNA or morpholino. For unilateral injections, morpholino and/or mRNA were injected into one dorsal blastomere at the four-cell stage. Animal pole explants assays were performed as described previously (Deardorff et al., 2001Go). For immunoprecipitation, Xenopus embryos were injected in the animal pole at the one-cell stage, cultured to stage 10 and lysed in embryo lysis buffer [20 mM Tris (pH 7.5), 140 mM NaCl, 10% glycerol, 1 mM DTT, 2 mM sodium vanadate, 25 mM NaF, 1% Nonidet P-40 and protease inhibitor cocktail for mammalian cells (Sigma)]. Anti-GFP monoclonal antibody (1 µl) (Roche, 1 814 460) was incubated with 250 µl of cleared lysate overnight at 4°C, collected on 30 µl protein G agarose beads (Invitrogen, 15920-010) for 1 hour, washed three times with PBS, and analyzed by western blot using IGF1R antibody (Cell Signaling, 3022). AKT, P-AKT, MAPK, P-MAPK and ß-tubulin antibodies are from Sigma (p2482), Cell Signaling (9271), Cell Signaling (9102), Sigma (M9692) and BD Biosciences (556321), respectively.

TUNEL assay and phosphorylated histone H3 staining
Phosphorylated histone H3 staining was performed as described (Bellmeyer et al., 2003Go). TUNEL staining protocol was from www.xenbase.org


    RESULTS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Expression of kermit2/XGIPC in Xenopus embryos
To characterize the temporal pattern of kermit2 expression, we extracted RNA from multiple stages of embryogenesis and performed RT-PCR. kermit2 was detected maternally (four-cell embryos) and throughout early embryonic development (Fig. 1A). kermit2 is ubiquitously expressed in early and mid-neurula stage embryos (Fig. 1B and data not shown). As neurulation progresses, kermit2 expression is restricted to the anterior region (Fig. 1B,D), including the cement gland and neural plate border, adjacent to and/or overlapping the presumptive eye region (Fig. 1D). The expression pattern of kermit2 is very similar to XIGF1R at this stage (Richard-Parpaillon et al., 2002Go). By tailbud stages, kermit2 expression becomes further restricted, with strong expression in the cement gland, otic vesicles (Fig. 1E), pronephros, branchial arches (Fig. 1F), and cranial nerves V, VII and IX (data not shown).

Kermit2/XGIPC is required for eye development
To study the endogenous function of kermit 2/XGIPC in Xenopus embryos, we depleted kermit 2 using morpholino antisense oligonucleotides. The kermit 2 morpholino blocked translation of kermit 2-GFP mRNA containing the endogenous 5'UTR but had no effect on kermit 2-GFP mRNA lacking the 5'UTR (Fig. 2A). Unilateral injection (into one dorsal blastomere at the four-cell stage) of kermit 2 morpholino strongly inhibited anterior development, especially eye development, in a dose-dependent manner (Fig. 2B; data not shown). Although there was a distribution of phenotypes, 60% (n=38) of embryos receiving 40 ng of kermit 2 morpholino developed without any detectable eyes on the injected side and 32% had small eyes (Fig. 2B). Co-injection of kermit2-GFP mRNA lacking the morpholino target sequence restored eye formation in 72% (n=43) of kermit2-depleted embryos, and of these, 28% appeared completely normal (Fig. 2B). kermit2-GFP mRNA alone did not cause apparent developmental defects. In addition, bilateral injection of kermit 2 morpholino caused absent or miniscule eyes in 83% (n=73) of embryos, and this effect was reversed in 60% (n=85) of embryos co-injected with the kermit2-GFP rescuing mRNA, although bilateral injections were also associated with more severe trunk defects that were not completely rescued by kermit2-GFP (data not shown). These results suggest that the reduced eye formation phenotype is specifically due to loss of kermit 2.

To characterize further the kermit 2 loss-of-function phenotype, we analyzed molecular markers at various stages by in situ hybridization. Kermit 2 depletion disrupted anterior development, which could indicate direct inhibition of anterior neural development or could alternatively indicate mild ventralization. To examine whether kermit 2 plays a role in dorsal development, we examined the expression of the dorsal organizer genes chordin and goosecoid. Kermit 2 or control morpholinos were injected into two dorsal animal blastomeres of four-cell/eight-cell embryos, and chordin or goosecoid expression was assessed at the early gastrula stage (Fig. 3A-D). Expression of chordin and goosecoid was not affected by depletion of kermit 2, suggesting that loss of kermit 2 does not disrupt early dorsal specification. We then examined the expression of the anterior neural markers Bf1 (a forebrain marker), Otx2 (expressed in the forebrain, eyes and anterior midbrain) and Pax6 (a forebrain and eye marker) at the neurula stage (stage 20). To our surprise, unilateral injection of kermit 2 morpholino into dorsoanimal blastomeres did not obviously affect Bf1 expression (80% no change, n=45, Fig. 3F). Furthermore Pax6 and Otx2 expression were reduced only in the presumptive eye domain (Pax6, 93% eye reduction, n=75; Otx2, 81% eye reduction, n=32, Fig. 3H,J). Pax6 expression in the spinal cord was not affected. Consistent with an apparently eye-specific phenotype, the expression of the eye-specific markers Xrx (85% reduction, n=32, Fig. 3L) and Xath5 (data not shown) was also strongly reduced by kermit 2 depletion. This eye-specific phenotype is probably due to loss of kermit 2, as co-injection of kermit2 mRNA lacking the 5'UTR partially recovered Xrx expression in 73% (n=26, Fig. 3S, compared with 3R and 3L) of kermit 2-depleted embryos. We also analyzed the expression of Xrx and Pax6 at earlier stages of development (early neurula stage, stage 14) and found that depletion of kermit 2 did not have an obvious effect on Xrx (74% no change, n=49, Fig. 3N) or Pax6 (84% no change, n=50, Fig. 3P) expression at this stage, suggesting that kermit 2 is required for the maintenance, but not the initiation, of eye formation.


Figure 1
View larger version (56K):
[in this window]
[in a new window]
 
Fig. 1. Temporal and spatial pattern of kermit2 expression. (A) RT-PCR analysis of kermit2 temporal expression. Total RNA was isolated from embryos at different stages and analyzed by RT-PCR. -RT, negative control without reverse transcriptase. ODC was used as a loading control. (B) RT-PCR analysis of kermit2 spatial expression. Stage 16 embryos were dissected into dorsal, ventral, anterior and posterior pieces, as shown in the diagram. Stage 20 embryos were dissected into anterior and posterior pieces. EF1{alpha} was used as a loading control. kermit2 is equally expressed in anterior, posterior, dorsal and ventral regions at mid-neurula stage (stage16), but is localized to the anterior region by stage 20. Anterior marker Otx2, posterior dorsal marker HoxD1, and posterior ventral marker Vent-1 were used as positive controls. (C-F) In situ hybridization of neurula and tadpole stage embryos. (C,D) Stage 20, anterior view, dorsal towards the top. (C) Sense control; (D) antisense probe. At stage 20, kermit2 is expressed in the cement gland and neural plate border, which is adjacent to and/or overlapping the presumptive eye region. (E,F) Antisense probe. By tailbud stages, kermit2 expression becomes further restricted, strongly expressed in the cement gland and otic vesicles (ov: arrow) at stage 26 (E), and is also expressed in the pronephros and branchial arches in stage 33 tadpoles (F).

 


Figure 2
View larger version (63K):
[in this window]
[in a new window]
 
Fig. 2. Kermit 2 loss-of-function phenotype. (A) A kermit 2-directed antisense morpholino blocks translation of kermit 2-GFP mRNA (5'UTR-kermit 2-GFP, which contains the morpholino target sequence in the 5'UTR), but not kermit 2-GFP mRNA lacking the 5'UTR. Kermit 2-GFP mRNA (1 ng) with or without the 5'UTR was injected into one-cell embryos together with kermit 2 morpholino (K2M; 20 ng). Embryos were harvested at stage 10 and analyzed by western blot with GFP antibodies. ß-Tubulin was used as a loading control. (B) Unilateral injection of kermit 2 morpholino (40 ng) into one dorsal blastomere at the four-cell stage completely blocked eye development in 60% of embryos (lower left panel, n=38) and reduced eye formation in an additional 32% (not shown). Co-expression of kermit2-GFP mRNA, which lacked the morpholino target sequence, restored eye formation in 72% of kermit2-depleted embryos (lower right panel, n=43). kermit2-GFP mRNA alone did not cause apparent embryonic defects (upper right panel).

 
Interaction between kermit2/XGIPC and XIGF1R in eye development
Kermit 2, despite its high amino acid similarity with Kermit, does not bind to the Kermit interaction partner, frizzled 3 (unpublished data). However, kermit 2/XGIPC was identified as an XIGF1R-binding protein by Booth et al. from a yeast two-hybrid screen (Booth et al., 2002Go). To study the role of kermit 2/XGIPC in the IGF signaling pathway, we confirmed that kermit 2/XGIPC interacts with the IGF1R in Xenopus embryos. Full-length XIGF1R coimmunoprecipitated with GFP-tagged kermit 2 expressed in gastrula-stage embryos (Fig. 4A), suggesting that kermit 2/XGIPC physically interacts with the XIGF1R in Xenopus.


Figure 3
View larger version (83K):
[in this window]
[in a new window]
 
Fig. 3. Depletion of kermit 2/XGIPC specifically inhibits Xenopus eye development. (A-D) Depletion of kermit 2 does not affect the expression of dorsal mesoderm markers chordin and goosecoid. Embryos are viewed from the vegetal side and dorsal is towards the top. Control morpholino or kermit 2 morpholino (40 ng) was injected into two dorsal animal blastomeres of four-cell embryos. Embryos were fixed at the gastrula stage (stage 10) and whole-mount in situ hybridization was performed for chordin (A,B) and goosecoid (C,D). (E-L) Depletion of kermit 2 specifically reduces marker gene expression within the presumptive eye field in stage 20 embryos. Embryos are viewed from the anterior side with dorsal towards the top. Control or kermit 2 morpholino was injected into one dorsal animal blastomere of four-cell/eight-cell embryos with 500 pg of mRNA for nuclear ß-galactosidase. Embryos were fixed at stage 20 and ß-galactosidase activity was measured in situ (red) followed by whole-mount in situ hybridization for Bf1 (E,F), Otx2 (G,H), Pax6 (I,J) and Xrx (K,L). Bf1 expression was not affected by depletion of kermit 2 (F). Expression of Otx2 (H) and Pax6 (J) were reduced only within the presumptive eyeforming region (red arrowheads) in embryos injected with kermit 2 morpholino. The expression of the eye marker Xrx was also inhibited (L red arrowhead). (M-P) Depletion of kermit 2 does not reduce Xrx (N) or Pax6 (P) expression in early neurula stage embryos (stage 14). (Q-S) Kermit 2 mRNA restored Xrx expression in kermit 2-depleted embryos. Red arrowhead in R indicates strongly reduced Xrx expression within presumptive eye domain in kermit 2-depleted embryo; red arrow in S indicates recovered Xrx expression in embryo co-injected with kermit 2 morpholino and kermit 2 mRNA.

 
Inhibition of IGF signaling by a dominant-negative XIGF1R (DN-IGFR) reduces the size of anterior structures, including eyes, in Xenopus embryos (Pera et al., 2001Go). To test for a functional interaction between kermit 2 and IGF1R, we used doses of the kermit 2 morpholino and DN-IGFR mRNA that alone only mildly reduce eye formation (Fig. 4B). When co-injected, kermit 2 morpholino and DN-IGFR led to embryos with strongly reduced eyes (Fig. 4B), suggesting a synergistic effect between the two. Furthermore, although these levels of kermit 2 morpholino or DN-IGFR alone minimally affected Pax6 expression (72.5%, n=24; 100%, n=27, respectively), co-injection strongly reduced Pax6 expression in the presumptive eye in 82% (n=22) of the embryos (Fig. 4C). Taken together, these data indicate that kermit 2/XGIPC could be involved in the IGF pathway, potentially functioning at the receptor level.

Kermit 2/XGIPC is required for IGF1 induced eye formation
In order to test the requirement of kermit 2/XGIPC for IGF signaling, we examined whether depletion of kermit 2 inhibits IGF function in embryos. Dorsal overexpression of IGF1 mRNA has been shown to induce ectopic eyes and overgrowth of endogenous eyes (Pera et al., 2001Go; Richard-Parpaillon et al., 2002Go). We found similarly that dorsal injection of XIGF1 mRNA caused expanded eyes in 64% (n=22) of the embryos. Depletion of kermit 2 dramatically inhibited the XIGF1 induced eye phenotype and led to embryos (73%, n=20) with small eyes or no eyes (Fig. 5A). Kermit 2 depletion alone reduced eye formation (similar to Fig. 2). Dorsal injection of IGF1 mRNA also expanded cement gland formation in embryos, but this phenotype was not affected by kermit 2 depletion.

Kermit 2 is also required for IGF induced expression of eye markers in animal cap explants. As reported (Pera et al., 2001Go; Richard-Parpaillon et al., 2002Go), expression of IGF1 alone in animal caps induces anterior neural markers (Fig. 5B, lane 4), including XAG (a cement gland marker), Otx2 (a marker for the forebrain and anterior midbrain), Pax6 (a marker for eyes and the forebrain) and Xrx (an eye marker), but not the midbrain-hindbrain boundary marker En2 or the mesodermal marker muscle actin. Kermit 2 depletion strongly reduced the induction of Xrx, mildly reduced Pax6 induction, and did not affect the induction of the anterior neural markers XAG and Otx2 (lane 6). Co-injection of control morpholino did not affect any of the IGF1-induced markers (lane 5). These results suggest that kermit 2/XGIPC is required for IGF1-induced eye formation in Xenopus.


Figure 4
View larger version (57K):
[in this window]
[in a new window]
 
Fig. 4. Interaction between kermit2/XGIPC and XIGF1R in eye development. (A) Coimmunoprecipitation of kermit 2 and full-length XIGF1R. Embryos were injected at the one-cell stage with mRNAs encoding XIGF1R (2 ng) and GFP-tagged kermit 2 (1 ng), and cultured until the gastrula stage. XIGF1R/kermit 2 complexes were immunoprecipitated from embryo lysates with anti-GFP antibody and XIGF1R was visualized by western blotting. Mouse IgG was used as a negative control. (B) Kermit 2 morpholino and DN-IGFR synergistically inhibit eye formation in embryos. Kermit 2 morpholino (20 ng), DN-IGFR mRNA (500 pg), or both, were injected into two dorsal animal blastomeres of four-cell/eight-cell embryos. Embryos were cultured until tadpole stages to score phenotypes. The percentage of embryos with either strong or mild reduction in eyes is tabulated in the panel on the right side. (C) Kermit 2 morpholino and DN-IGFR synergistically reduce expression of Pax6 in presumptive eye domain (arrowhead). Microinjections were performed as in Fig. 2B. Nuclear ß-galactosidase mRNA was co-injected as a lineage tracer. Embryos were fixed at stage 20 and ß-galactosidase activity was measured in situ (red) followed by whole-mount in situ hybridization for Pax6.

 
Kermit 2/XGIPC is required for long-term activation of AKT by IGF1
As shown above, kermit 2 is required for IGF induced embryonic phenotypes, but whether it is required for the activation of downstream IGF signaling is still unknown. The two main intracellular pathways activated by IGF/IGFR are the PI3 kinase/AKT pathway and the MAP kinase pathway (Oldham and Hafen, 2003Go). We first examined the requirement of kermit 2/XGIPC for IGF signaling in Xenopus oocytes. Stage VI oocytes have low levels of background activation of AKT or MAP kinase, but respond robustly to exogenous IGF1. We injected control morpholino or kermit 2 morpholino into oocytes and cultured these oocytes for 48 hours to deplete endogenous kermit 2. We then treated these oocytes with IGF1 protein for 30 minutes or overnight (18 hours). IGF1 induced phosphorylation of AKT (Ser 473) and MAPK (e.g. Thr183 and Tyr185 in ERK2) at sites associated with activation as documented previously (Alessi et al., 1996Go; Payne et al., 1991Go; Stephens et al., 1998Go; Stokoe et al., 1997Go; Yung et al., 1997Go). Kermit 2 depletion blocked phosphorylation/activation of AKT induced by long-term exposure to IGF1, but not by short-term exposure (30 minutes) (Fig. 6A). MAP kinase phosphorylation induced by IGF1 protein was not affected by depletion of kermit 2 at any time points (Fig. 6A). The control morpholino did not affect IGF1-induced AKT or MAP kinase phosphorylation/activation. These data suggest that kermit 2/XGIPC is required to maintain activation of AKT induced by IGF1, but is not required for the initiation of signaling.

This analysis was extended to ectodermal (animal cap) explants. Compared with oocytes, animal caps have high levels of endogenous AKT and MAP kinase phosphorylation/activation. We first tested the effect of kermit 2 morpholino on the endogenous phosphorylation of AKT and MAP kinase. Control morpholino or kermit 2 morpholino was injected into fertilized eggs. Animal caps were dissected at the late blastula stage (stage 9) and cultured for 2 hours (stage 10/10.5) or overnight (stage 20). Similar to the result in oocytes, kermit 2 depletion inhibited AKT phosphorylation/activation after overnight incubation, but not after 2 hours incubation; kermit 2 morpholino had no effect on MAP kinase phosphorylation (Fig. 6B). To test whether kermit 2 is required for AKT phosphorylation/activation by exogenous IGF1, embryos were injected with IGF1 mRNA with or without kermit 2 morpholino, animal caps were explanted at the blastula stage and cultured until late neurula stage (stage 20). We found that kermit 2 depletion blocked phosphorylation/activation of AKT by overexpressed IGF1 (Fig. 6C, compare lane 5 with lane 4). (Kermit 2 morpholino did not interfere with translation of injected mRNAs, as GFP mRNA co-injected with IGF1 mRNA was expressed at equal levels with or without kermit 2 morpholino co-injection.) Taken together, the results in oocytes and animal cap explants suggest that kermit 2/XGIPC is required for maintaining IGF induced AKT activation, but not for MAPK activation.


Figure 5
View larger version (47K):
[in this window]
[in a new window]
 
Fig. 5. Kermit 2/XGIPC is required for IGF1 induced eye formation in whole embryos and in animal cap explants. (A) Kermit 2 is required for IGF1 induced eye formation in Xenopus embryos. XIGF1 mRNA (1 ng), kermit 2 morpholino (40 ng), or both, were injected into one dorsal animal blastomere of four-cell/eight-cell embryos. IGF1 injection alone leads to embryos with expanded eyes and cement glands and co-injection of kermit 2 morpholino specifically inhibits the IGF1-induced eye phenotype. (B) Kermit 2 is required for IGF1-induced eye marker expression in animal cap explants. XIGF1 mRNA alone (2 ng), or with control morpholino (CM) or kermit 2 morpholino (K2M) was injected into four animal blastomeres of four-cell/eight-cell embryos. Animal caps were explanted from stage 9 blastulae, cultured until stage 20, and then harvested for RT-PCR. St. 20 WE indicates the whole embryo control; uninjected represents animal caps from uninjected embryos; -RT, without reverse transcriptase; EF1{alpha} is the loading control. Kermit 2 morpholino specifically reduces XIGF1-induced expression of the presumptive eye markers Xrx and Pax6.

 


Figure 6
View larger version (39K):
[in this window]
[in a new window]
 
Fig. 6. Kermit 2/XGIPC is required to maintain IGF1 induced phosphorylation of AKT in oocytes and animal cap explants. (A) Kermit 2 is required for maintaining IGF1-induced AKT phosphorylation in oocytes. Oocytes were injected with 40 ng of control morpholino (CM) or kermit 2 morpholino (K2M), cultured for 48 hours and then treated with recombinant human IGF1 protein (18 ng/ml) for 30 minutes or overnight. Kermit 2 is required for IGF1-induced AKT phosphorylation/activation after overnight treatment, but not for short-term phosphorylation of AKT or MAPK. Total AKT or total MAPK was used as the loading control. (B) Effects of kermit 2 morpholino on the endogenous activation of AKT and MAPK. Control morpholino or kermit 2 morpholino was injected into four animal blastomeres of four-cell/eight-cell embryos. Animal caps were explanted at stage 9 and harvested after 2 hours or overnight. Kermit 2 morpholino reduces endogenous AKT phosphorylation after overnight incubation but not after 2 hours incubation and does not affect MAPK phosphorylation at either time point. (C) Kermit 2 is required for IGF1-induced AKT phosphorylation in stage 20 animal cap explants. 500 pg of XIGF1 mRNA and 400 pg of GFP mRNA were injected into one-cell embryos and 40 ng of kermit 2 morpholino was injected into four animal blastomeres of four-cell/eight-cell embryos. Animal caps were dissected at stage 9 and harvested at stage 20. GFP was used as the injection control.

 
Activated PI3K partially rescues the kermit 2/XGIPC loss-of-function phenotype
As kermit 2 depletion strongly inhibits the AKT phosphorylation/activation induced by IGF1, we examined the physiological relevance of this inhibition by rescuing the kermit 2 loss-of-function phenotype using a constitutively active p110 subunit (p110*) of phosphatidylinositol-3' kinase (PI3 kinase) (Carballada et al., 2001Go), a lipid kinase upstream of AKT and downstream of IGF1R. Expression of p110* partially rescues the kermit 2 depletion phenotype (Fig. 7B). In a typical experiment, 96% (n=24) of the embryos injected dorsally with the kermit 2 morpholino alone had either miniscule or no apparent eyes, whereas only 26% (n=20) of embryos co-injected with p110* showed this phenotype, and 74% developed small but normal-appearing eyes. Dorsal expression of p110* itself did not cause apparent developmental defects in embryos. p110* was confirmed to be active as it induced strong AKT phosphorylation in gastrula-stage animal caps (Fig. 7A). In addition to the morphological rescue, p110* also partially recovers the expression of Xrx, an eye marker, in kermit 2-depleted embryos. Compared with control embryos, most kermit 2-depleted embryos had strongly reduced Xrx expression (63%, n=39; Fig. 7D, middle panel) at the neurula stage (stage 19), whereas the majority of embryos co-injected with p110* showed only a mild reduction of Xrx expression (73%, n=53; Fig. 7D, right panel). These rescue results suggest that the kermit 2 loss-of-function phenotype is at least partially due to the inhibition of the PI3 kinase/AKT pathway.


Figure 7
View larger version (57K):
[in this window]
[in a new window]
 
Fig. 7. Activation of PI3K partially rescues eye development in kermit 2/XGIPC-depleted embryos. (A) p110*, a constitutively active subunit of PI3 kinase, induces AKT phosphorylation/activation in stage 10 animal cap explants. mRNA encoding p110* was injected into fertilized eggs and animal caps were explanted at the gastrula stage and analyzed by western blot with antibodies recognizing AKT phosphorylated at serine-473 (upper panel) or general anti-AKT antibodies (lower panel). (B) p110* partially rescues eye development in kermit 2-depleted embryos. Kermit 2 morpholino (40 ng), 3 ng of p110* mRNA, or both, were injected into two dorsal animal blastomeres of four-cell/eight-cell embryos. No apparent eyes are present in embryos injected with the kermit 2 morpholino, while small eyes are present in over 70% of embryos co-injected with p110* mRNA and morpholino. p110* injection alone does not affect embryo development. (C) The percentage of embryos with normal, small or absent/miniscule eyes is summarized. (D) p110* partially recovers the expression of Xrx in kermit 2-depleted embryos. One dorsal-animal blastomere of four-cell/eight-cell embryos was injected with kermit 2 morpholino with or without p110* mRNA (right side, indicated by GFP lineage tracer) and harvested at stage 20. Whole-mount in situ hybridization was performed for Xrx. Embryos are viewed from the anterior side with dorsal towards the top.

 
Kermit 2/XGIPC is required for cell survival, but not for cell proliferation in Xenopus
The IGF pathway affects multiple cellular processes, including cell survival and cell proliferation. We examined whether kermit 2/XGIPC is involved in these processes. We injected control morpholino or kermit 2 morpholino into the right side of embryos (leaving the left side as the control) and followed apoptosis by TUNEL analysis. Seventy-two percent (n=61) of kermit 2-depleted embryos demonstrate a substantial increase in the number of TUNEL-positive nuclei on the injected side compared with the control side (Fig. 8B). This effect was dose dependent (data not shown) and no difference was detected with control morpholino at equivalent doses (Fig. 8A). Expression of kermit2 mRNA without the 5'UTR significantly reduced TUNEL-positive nuclei in 83% (n=66) of kermit 2-depleted embryos (Fig. 8C), which indicates that the elevated cell death was specifically due to loss of kermit 2. Expression of the same amount of nß-gal mRNA did not reduce apoptosis in kermit 2-depleted embryos (data not shown). We also assessed whether kermit 2 regulates cell proliferation. Embryos unilaterally injected with kermit 2 morpholino were immunostained with an antibody against phosphorylated histone H3, which specifically recognizes mitotic chromosomes. We did not observe an obvious change in the number of mitotic cells on the injected side compared with the control side in early neurula stage (stage 14) and late neurula stage (stage 22) embryos (Fig. 8E,F). These results indicate that kermit 2/XGIPC is required for cell survival, but do not support a requirement for kermit 2 in proliferation in Xenopus embryos. As kermit 2 is involved in IGF signaling, we further tested whether inhibition of the IGF pathway increases cell death in Xenopus embryos. Indeed, DN-IGFR, like kermit 2 depletion, markedly increased the number of TUNEL-positive nuclei (76%, n=29; Fig. 8D) when expressed in embryos. Activation of the MAPK branch of IGF signaling leads to transcriptional responses associated with cell proliferation, whereas activation of the PI3K/AKT branch regulates the activity of BCL2 family members and anti-apoptotic responses (O'Connor, 2003Go; Oldham and Hafen, 2003Go). Therefore, these data are consistent with a requirement for kermit 2 in IGF-induced AKT activation. Finally, to determine whether the kermit 2 depletion phenotype is due to apoptosis of cells within the eye-field, we examined whether inhibition of apoptosis restores eye formation in kermit 2-depleted embryos. Kermit 2 morpholino injection alone strongly reduced Pax6 expression in the presumptive eye in 75% (n=24, Fig. 8H) of embryos. Co-expression of bcl2 rescued this phenotype and restored Pax6 expression in the presumptive eye in almost 72% (n=25, Fig. 8I) of embryos, as well as restoring eye development to normal or near normal morphology in a majority of sibling embryos allowed to develop to later stages (data not shown). This result suggests that the kermit 2 phenotype is at least partially due to elevated cell death in the presumptive eye region.


Figure 8
View larger version (72K):
[in this window]
[in a new window]
 
Fig. 8. Kermit 2/XGIPC is required for cell survival, but not for cell proliferation in Xenopus. (A-F) Control morpholino (A), kermit 2 morpholino alone (B,E,F), kermit 2 morpholino with 3 ng of kermit 2 mRNA (C) or 1 ng of DN-IGFR (D) was injected into the right side dorsal animal blastomere of four-cell/eight-cell embryos. The left side serves as a control. TUNEL staining and phosphorylated histone H3 staining were performed on neurula stage embryos. Embryos are viewed from the dorsal side, anterior towards the top. Compared with the control side (left side), the side injected with kermit 2 morpholino (right side) shows a substantial increase in the number of TUNEL-positive nuclei (B), without apparent change in the number of mitotic cells (E,F). The increased apoptosis in kermit 2-depleted embryos can be rescued by co-expression of kermit 2 mRNA lacking the 5'UTR (C). DN-IGFR also leads to elevated cell death on the injected side, as shown in D. (G-I) Co-injection of Bcl2 mRNA recovers Pax6 eye expression in kermit 2-depleted embryos. Microinjections were performed as above and nß-gal was used as the lineage tracer. Embryos were fixed at stage 20 and ß-galactosidase activity was measured in situ (red) followed by whole-mount in situ hybridization for Pax6. Red arrowhead in H indicates strongly reduced eye region in kermit 2 morpholino-injected embryo and red arrow in I indicates recovered eye expression domain by Bcl2 mRNA.

 

    DISCUSSION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We report here the identification of the second Xenopus GIPC homolog, kermit 2. Despite its high amino acid similarity with the first Xenopus GIPC homolog Kermit, kermit 2 has a different function in Xenopus embryos. Loss-of-function and molecular marker analyses indicate that kermit 2 is specifically required for Xenopus eye development. We have confirmed the physical interaction of kermit 2/XGIPC with XIGF1R in Xenopus and further established that kermit 2 is required for IGF-dependent eye development. In addition, kermit 2 is required for maintaining IGF induced AKT phosphorylation/activation and a constitutively active PI3 kinase partially rescues kermit 2 loss of function. These results provide the first demonstration of the in vivo role of GIPC in embryonic development and also show that kermit 2/XGIPC is a novel component of the IGF pathway, potentially acting through the modulation of IGF1R function.

kermit 2/XGIPC and IGF signaling in Xenopus embryonic development
Inhibition of IGF signaling in Xenopus by either dominant-negative IGF receptor or IGF receptor depletion disrupts anterior neural development broadly (Pera et al., 2001Go; Richard-Parpaillon et al., 2002Go), yet loss of kermit 2/XGIPC specifically inhibits eye formation without apparent effect on other aspects of anterior neural development. At least two mechanisms could explain the morerestricted requirement for kermit 2/XGPIC. First, depletion of kermit 2 blocks the activation of AKT, but not of MAPK. It is likely that the IGF/PI3K/AKT branch is specifically involved in eye formation, while the IGF/MAPK branch regulates anterior neural development more broadly. Indeed, IGF inhibits SMAD1 activity and induces neural differentiation via MAPK (Pera et al., 2003Go; Kuroda et al., 2005Go). Second, eye development could have a distinct temporal requirement for IGF signaling. For example, the specification of anterior neural tissue in general may only require an early exposure to IGF, whereas proper eye formation may require continual activation of IGF signaling. As kermit 2/XGIPC is required for the maintenance, but not the initiation of IGF signaling, depletion of kermit 2/XGIPC may inhibit eye formation only at late neurula stages, without disrupting general neural specification.

We also found that depletion of kermit 2 dramatically increases cell death in embryos, but does not reduce cell proliferation. This result is consistent with the data that kermit 2 depletion blocks IGF induced AKT activation, not MAPK activation. However, the increased cell death in kermit 2-depleted embryos is not restricted to the presumptive eye field. Thus, the extent to which increased cell death contributes to the eye phenotype remains to be established.

Regulation of the IGF1 receptor by kermit 2/XGIPC
As kermit 2/XGIPC functions downstream of the IGF ligand and upstream of PI3 kinase and physically associates with the XIGF1R, kermit 2 probably regulates IGF signaling through modulation of the receptor. In principle, kermit 2 could regulate the stability, activity or subcellular localization of the receptor. However, kermit 2 depletion did not obviously reduce the level of XIGF1R under conditions that reduced AKT activation (data not shown), arguing against kermit 2 regulation of IGF1R stability. Furthermore, kermit 2 depletion did not significantly affect the level of IGF-induced MAPK phosphorylation, arguing against a role for kermit 2 in regulating overall stability or activity of the IGF1R. Kermit 2 depletion also did not interfere with the early (30 minute) phosphorylation of AKT in response to IGF, suggesting that coupling to downstream signaling, at least initially, is intact.

Alternatively, mammalian GIPC is involved in the regulation of endocytic trafficking, and kermit 2/XGIPC may similarly regulate the subcellular localization of the IGF receptor. A function for GIPC in endocytic trafficking was first proposed based on its localization to endocytic vesicles (Dance et al., 2004Go; De Vries et al., 1998aGo; De Vries et al., 1998bGo; Jeanneteau et al., 2004aGo; Lou et al., 2002Go; Lou et al., 2001Go). For example, GIPC is enriched at clathrin-rich invaginations and the endocytic compartments found between microvilli in proximal tubule kidney cells (Lou et al., 2002Go). A role for GIPC in endocytosis is also supported by functional studies in cultured cells (Hirakawa et al., 2003Go; Jeanneteau et al., 2004aGo). Hirakawa et al. used RNAi to knockdown GIPC in 293 cells and found that GIPC is partially responsible for maintaining a relatively constant level of the human lutropin receptor (LHR) at the cell surface during ligand-induced internalization and for recycling of the ligand (CG) (Hirakawa et al., 2003Go). In a similar manner, kermit 2 could be required for the recycling of the IGF1R to the plasma membrane after ligand-dependent internalization. A failure to recycle internalized IGF1R could explain why depletion of kermit 2 reduces AKT phosphorylation after prolonged exposure to IGF, but not after short-term exposure. A defect in recycling of IGF1R would not be expected to disrupt MAP kinase phosphorylation, as MAP kinase can be activated by receptors that have been internalized in association with ß-arrestin and component kinases of the MAPK cascade (DeFea et al., 2000Go; Lefkowitz and Shenoy, 2005Go; Lin et al., 1998Go; Luttrell et al., 2001Go; Tohgo et al., 2003Go), while AKT and PI3 kinase have not been reported to be activated by internalized receptors within endosomes. However, we have so far been unable to demonstrate an effect of kermit 2 depletion on IGF1R trafficking, and this will remain a focus of future studies.

In summary, we have shown that kermit 2/XGIPC is required for eye development in Xenopus embryos. Kermit 2/XGIPC physically and functionally interacts with the IGF1R and is required for IGF signaling in anterior neural development specifically in eye formation. Expression of molecular markers of eye development is induced but not maintained in kermit 2-depleted embryos, and phosphorylation of AKT is similarly induced but not maintained after prolonged exposure to IGF when kermit 2 is depleted. Eye development can be partially rescued in kermit 2-depleted embryos by an active PI3 kinase. Based on these observations, we propose that kermit 2/XGIPC, through the modulation of IGF1R, mediates endogenous IGF signaling in Xenopus eye formation.


    ACKNOWLEDGMENTS
 
We thank Eddy M. De Robertis, Laurent Richard-Parpaillon, Patrick Lemaire, Monica Vetter, Vijayasaradhi Setaluri, Carole LaBonne, Dan Kessler and Jean-Pierre Saint-Jeannet for plasmids and reagents. We thank Dan Kessler, Jean-Pierre Saint-Jeannet, Mary Mullins, Jonathan Epstein, Tom Kadesch and Jing Yang for helpful discussions.


    REFERENCES
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

Alessi, D. R., Andjelkovic, M., Caudwell, B., Cron, P., Morrice, N., Cohen, P. and Hemmings, B. A. (1996). Mechanism of activation of protein kinase B by insulin and IGF-1. EMBO J. 15,6541 -6551.[Medline]

Bellmeyer, A., Krase, J., Lindgren, J. and LaBonne, C. (2003). The protooncogene c-myc is an essential regulator of neural crest formation in xenopus. Dev. Cell 4, 827-839.[CrossRef][Medline]

Blitz, I. and Cho, K. (1995). Anterior neurectoderm is progressively induced during gastrulation: the role of the Xenopus homeobox gene orthodenticle. Development 121,993 -1004.[Abstract]

Blobe, G. C., Liu, X., Fang, S. J., How, T. and Lodish, H. F. (2001). A novel mechanism for regulating transforming growth factor beta (TGF-beta) signaling. Functional modulation of type III TGF-beta receptor expression through interaction with the PDZ domain protein, GIPC. J. Biol. Chem. 276,39608 -39617.[Abstract/Free Full Text]

Blumberg, B., Wright, C. V., De Robertis, E. M. and Cho, K. W. (1991). Organizer-specific homeobox genes in Xenopus laevis embryos. Science 253,194 -196.[Abstract/Free Full Text]

Bohlson, S. S., Zhang, M., Ortiz, C. E. and Tenner, A. J. (2005). CD93 interacts with the PDZ domain-containing adaptor protein GIPC: implications in the modulation of phagocytosis. J. Leukoc. Biol. 77,80 -89.[Abstract/Free Full Text]

Booth, R. A., Cummings, C., Tiberi, M. and Liu, X. J. (2002). GIPC participates in G protein signaling downstream of insulin-like growth factor 1 receptor. J. Biol. Chem. 277,6719 -6725.[Abstract/Free Full Text]

Cai, H. and Reed, R. R. (1999). Cloning and characterization of neuropilin-1-interacting protein: a PSD-95/Dlg/ZO-1 domain-containing protein that interacts with the cytoplasmic domain of neuropilin-1. J. Neurosci. 19,6519 -6527.[Abstract/Free Full Text]

Carballada, R., Yasuo, H. and Lemaire, P. (2001). Phosphatidylinositol-3 kinase acts in parallel to the ERK MAP kinase in the FGF pathway during Xenopus mesoderm induction. Development 128,35 -44.[Abstract]

Cox, W. G. and Hemmati-Brivanlou, A. (1995). Caudalization of neural fate by tissue recombination and bFGF. Development 121,4349 -4358.[Abstract]

Dance, A. L., Miller, M., Seragaki, S., Aryal, P., White, B., Aschenbrenner, L. and Hasson, T. (2004). Regulation of myosin-VI targeting to endocytic compartments. Traffic 5, 798-813.[CrossRef][Medline]

De Vries, L., Elenko, E., McCaffery, J. M., Fischer, T., Hubler, L., McQuistan, T., Watson, N. and Farquhar, M. G. (1998a). RGS-GAIP, a GTPase-activating protein for Galphai heterotrimeric G proteins, is located on clathrin-coated vesicles. Mol. Biol. Cell 9,1123 -1134.[Abstract/Free Full Text]

De Vries, L., Lou, X., Zhao, G., Zheng, B. and Farquhar, M. G. (1998b). GIPC, a PDZ domain containing protein, interacts specifically with the C terminus of RGS-GAIP. Proc. Natl. Acad. Sci. USA 95,12340 -12345.[Abstract/Free Full Text]

Deardorff, M. A., Tan, C., Conrad, L. J. and Klein, P. S. (1998). Frizzled-8 is expressed in the Spemann organizer and plays a role in early morphogenesis. Development 125,2687 -2700.[Abstract]

Deardorff, M. A., Tan, C., Saint-Jeannet, J. P. and Klein, P. S. (2001). A role for frizzled 3 in neural crest development. Development 128,3655 -3663.[Abstract/Free Full Text]

DeFea, K. A., Zalevsky, J., Thoma, M. S., Dery, O., Mullins, R. D. and Bunnett, N. W. (2000). beta-arrestin-dependent endocytosis of proteinase-activated receptor 2 is required for intracellular targeting of activated ERK1/2. J. Cell Biol. 148,1267 -1281.[Abstract/Free Full Text]

Eivers, E., McCarthy, K., Glynn, C., Nolan, C. M. and Byrnes, L. (2004). Insulin-like growth factor (IGF) signalling is required for early dorso-anterior development of the zebrafish embryo. Int. J. Dev. Biol. 48,1131 -1140.[CrossRef][Medline]

El Mourabit, H., Poinat, P., Koster, J., Sondermann, H., Wixler, V., Wegener, E., Laplantine, E., Geerts, D., Georges-Labouesse, E., Sonnenberg, A. et al. (2002). The PDZ domain of TIP-2/GIPC interacts with the C-terminus of the integrin alpha5 and alpha6 subunits. Matrix Biol. 21,207 -214.[CrossRef][Medline]

Favre-Bonvin, A., Reynaud, C., Kretz-Remy, C. and Jalinot, P. (2005). Human papillomavirus type 18 E6 protein binds the cellular PDZ protein TIP-2/GIPC, which is involved in transforming growth factor beta signaling and triggers its degradation by the proteasome. J. Virol. 79,4229 -4237.[Abstract/Free Full Text]

Hasson, T. (2003). Myosin VI: two distinct roles in endocytosis. J. Cell Sci. 116,3453 -3461.[Abstract/Free Full Text]

Hemmati-Brivanlou, A. and Melton, D. A. (1994). Inhibition of activin signalling promotes neuralization in Xenopus laevis.Cell 77,273 -281.[CrossRef][Medline]

Hemmati-Brivanlou, A., Kelley, O. G. and Melton, D. A. (1994). Follistatin, an antagonist of activin, is present in the Spemann organizer and displays direct neuralizing activity. Cell 77,283 -295.[CrossRef][Medline]

Hirakawa, T., Galet, C., Kishi, M. and Ascoli, M. (2003). GIPC binds to the human lutropin receptor (hLHR) through an unusual PDZ domain binding motif, and it regulates the sorting of the internalized human choriogonadotropin and the density of cell surface hLHR. J. Biol. Chem. 278,49348 -49357.[Abstract/Free Full Text]

Hirsch, N. and Harris, W. A. (1997). Xenopus Pax-6 and retinal development. J. Neurobiol. 32, 45-61.[CrossRef][Medline]

Hu, L. A., Chen, W., Martin, N. P., Whalen, E. J., Premont, R. T. and Lefkowitz, R. J. (2003). GIPC interacts with the beta1-adrenergic receptor and regulates beta1-adrenergic receptor-mediated ERK activation. J. Biol. Chem. 278,26295 -26301.[Abstract/Free Full Text]

Jeanneteau, F., Diaz, J., Sokoloff, P. and Griffon, N. (2004a). Interactions of GIPC with dopamine D2, D3 but not D4 receptors define a novel mode of regulation of G protein-coupled receptors. Mol. Biol. Cell 15,696 -705.[Abstract/Free Full Text]

Jeanneteau, F., Guillin, O., Diaz, J., Griffon, N. and Sokoloff, P. (2004b). GIPC recruits GAIP (RGS19) to attenuate dopamine D2 receptor signaling. Mol. Biol. Cell 15,4926 -4937.[Abstract/Free Full Text]

Katoh, M. (2002). GIPC gene family (Review). Int. J. Mol. Med. 9,585 -589.[Medline]

Kuroda, H., Fuentealba, L., Ikeda, A., Reversade, B. and De Robertis, E. M. (2005). Default neural induction: neuralization of dissociated Xenopus cells is mediated by Ras/MAPK activation. Genes Dev. 19,1022 -1027.[Abstract/Free Full Text]

Lamb, T. M., Knecht, A. K., Smith, W. C., Stachel, S. E., Economides, A. N., Stahl, N., Yancopolous, G. D. and Harland, R. M. (1993). Neural Induction by the Secreted Polypeptide Noggin. Science 262,713 -718.[Abstract/Free Full Text]

Lefkowitz, R. J. and Shenoy, S. K. (2005). Transduction of receptor signals by beta-arrestins. Science 308,512 -517.[Abstract/Free Full Text]

Ligensa, T., Krauss, S., Demuth, D., Schumacher, R., Camonis, J., Jaques, G. and Weidner, K. M. (2001). A PDZ domain protein interacts with the C-terminal tail of the insulin-like growth factor-1 receptor but not with the insulin receptor. J. Biol. Chem. 276,33419 -33427.[Abstract/Free Full Text]

Lin, F. T., Daaka, Y. and Lefkowitz, R. J. (1998). beta-arrestins regulate mitogenic signaling and clathrin-mediated endocytosis of the insulin-like growth factor I receptor. J. Biol. Chem. 273,31640 -31643.[Abstract/Free Full Text]

Liu, T. F., Kandala, G. and Setaluri, V. (2001). PDZ domain protein GIPC interacts with the cytoplasmic tail of melanosomal membrane protein gp75 (tyrosinase-related protein-1). J. Biol. Chem. 276,35768 -35777.[Abstract/Free Full Text]

Lou, X., Yano, H., Lee, F., Chao, M. V. and Farquhar, M. G. (2001). GIPC and GAIP form a complex with TrkA: a putative link between G protein and receptor tyrosine kinase pathways. Mol. Biol. Cell 12,615 -627.[Abstract/Free Full Text]

Lou, X., McQuistan, T., Orlando, R. A. and Farquhar, M. G. (2002). GAIP, GIPC and Galphai3 are concentrated in endocytic compartments of proximal tubule cells: putative role in regulating megalin's function. J. Am. Soc. Nephrol. 13,918 -927.[Abstract/Free Full Text]

Luttrell, L. M., Roudabush, F. L., Choy, E. W., Miller, W. E., Field, M. E., Pierce, K. L. and Lefkowitz, R. J. (2001). Activation and targeting of extracellular signal-regulated kinases by beta-arrestin scaffolds. Proc. Natl. Acad. Sci. USA 98,2449 -2454.[Abstract/Free Full Text]

Mathers, P. H., Grinberg, A., Mahon, K. A. and Jamrich, M. (1997). The Rx homeobox gene is essential for vertebrate eye development. Nature 387,603 -607.[CrossRef][Medline]

O'Connor, R. (2003). Regulation of IGF-I receptor signaling in tumor cells. Horm. Metab. Res. 35,771 -777.[CrossRef][Medline]

Oldham, S. and Hafen, E. (2003). Insulin/IGF and target of rapamycin signaling: a TOR de force in growth control. Trends Cell Biol. 13,79 -85.[CrossRef][Medline]

Papalopulu, N. and Kintner, C. (1996). A posteriorising factor, retinoic acid, reveals that anteroposterior patterning controls the timing of neuronal differentiation in Xenopus neuroectoderm. Development 122,3409 -3418.[Abstract]

Payne, D. M., Rossomando, A. J., Martino, P., Erickson, A. K., Her, J. H., Shabanowitz, J., Hunt, D. F., Weber, M. J. and Sturgill, T. W. (1991). Identification of the regulatory phosphorylation sites in pp42/mitogen-activated protein kinase (MAP kinase). EMBO J. 10,885 -892.[Medline]

Pera, E. M., Wessely, O., Li, S. Y. and De Robertis, E. M. (2001). Neural and head induction by insulin-like growth factor signals. Dev. Cell 1,655 -665.[CrossRef][Medline]

Pera, E. M., Ikeda, A., Eivers, E. and De Robertis, E. M. (2003). Integration of IGF, FGF, and anti-BMP signals via Smad1 phosphorylation in neural induction. Genes Dev. 17,3023 -3028.[Abstract/Free Full Text]

Richard-Parpaillon, L., Heligon, C., Chesnel, F., Boujard, D. and Philpott, A. (2002). The IGF pathway regulates head formation by inhibiting Wnt signaling in Xenopus. Dev. Biol. 244,407 -417.[CrossRef][Medline]

Sasai, Y., Lu, B., Steinbeisser, H., Geissert, D., Gont, L. K. and De Robertis, E. M. (1994). Xenopus chordin: a novel dorsalizing factor activated by organizer-specific homeobox genes. Cell 79,779 -790.[CrossRef][Medline]

Stephens, L., Anderson, K., Stokoe, D., Erdjument-Bromage, H., Painter, G. F., Holmes, A. B., Gaffney, P. R., Reese, C. B., McCormick, F., Tempst, P. et al. (1998). Protein kinase B kinases that mediate phosphatidylinositol 3,4,5-trisphosphate-dependent activation of protein kinase B.[see comment]. Science 279,710 -714.[Abstract/Free Full Text]

Stokoe, D., Stephens, L. R., Copeland, T., Gaffney, P. R., Reese, C. B., Painter, G. F., Holmes, A. B., McCormick, F. and Hawkins, P. T. (1997). Dual role of phosphatidylinositol-3,4,5-trisphosphate in the activation of protein kinase B.[see comment]. Science 277,567 -570.[Abstract/Free Full Text]

Tan, C., Deardorff, M. A., Saint-Jeannet, J. P., Yang, J., Arzoumanian, A. and Klein, P. S. (2001). Kermit, a frizzled interacting protein, regulates frizzled 3 signaling in neural crest development. Development 128,3665 -3674.[Abstract/Free Full Text]

Tani, T. T. and Mercurio, A. M. (2001). PDZ interaction sites in integrin alpha subunits. T14853, TIP/GIPC binds to a type I recognition sequence in alpha 6A/alpha 5 and a novel sequence in alpha 6B. J. Biol. Chem. 276,36535 -36542.[Abstract/Free Full Text]

Tohgo, A., Choy, E. W., Gesty-Palmer, D., Pierce, K. L., Laporte, S., Oakley, R. H., Caron, M. G., Lefkowitz, R. J. and Luttrell, L. M. (2003). The stability of the G protein-coupled receptor-beta-arrestin interaction determines the mechanism and functional consequence of ERK activation. J. Biol. Chem. 278,6258 -6267.[Abstract/Free Full Text]

Wang, L. H., Kalb, R. G. and Strittmatter, S. M. (1999). A PDZ protein regulates the distribution of the transmembrane semaphorin, M-SemF. J. Biol. Chem. 274,14137 -14146.[Abstract/Free Full Text]

Yang, J., Tan, C., Darken, R. S., Wilson, P. A. and Klein, P. S. (2002). Betacatenin/Tcf-regulated transcription prior to the midblastula transition. Development 129,5743 -5752.[CrossRef][Medline]

Yung, Y., Dolginov, Y., Yao, Z., Rubinfeld, H., Michael, D., Hanoch, T., Roubini, E., Lando, Z., Zharhary, D. and Seger, R. (1997). Detection of ERK activation by a novel monoclonal antibody. FEBS Lett. 408,292 -296.[CrossRef][Medline]





This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.02547v1
133/18/3651    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles