|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 30 August 2006
doi: 10.1242/dev.02549
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,*

1 Department for Experimental Medical Science, Section for Developmental
Biology, Lund University, 22184 Lund, Sweden.
2 Department of Protein Research, Genetic Engineering and Biotechnology Research
Institute, Mubarak City for Scientific Research, Alexandria, Egypt.
3 Department of Biological Science, Florida State University, Tallahassee, FL
32306-4370, USA.
4 Fakultät für Biologie, Universität Konstanz, 78434 Konstanz,
Germany.
5 Department of Stem Cell Biology, DFG Research Center for Molecular Physiology
of the Brain (CMPB), University of Göttingen, Justus-von-Liebig-Weg 11,
37077 Göttingen, Germany.
* Author for correspondence (e-mail: maschneider{at}bi.ku.dk)
Accepted 25 July 2006
| SUMMARY |
|---|
|
|
|---|
Key words: Perlecan, Dystroglycan, Laminin, Dystrophin, Neurexin, Polarity, Epithelia, Oogenesis, Drosophila
| INTRODUCTION |
|---|
|
|
|---|
Dg
and the transmembrane protein ßDg
(Ibraghimov-Beskrovnaya et al.,
1992
Dg
with the N-terminal region of ßDg
(Sciandra et al., 2001
Dg shows a dumbbell-like molecular shape in which two less glycosylated
globular domains are separated by the mucin-like domain (mucin-domain), a
highly glycosylated serine-threonineproline-rich region
(Brancaccio et al., 1995
Dg (Ibraghimov-Beskrovnaya et al.,
1992
Dg is not known, but proper glycosylation of
Dg
is generally considered to be crucial for its ligand-binding activity. Recent
studies have demonstrated that Oglycosylation within the mucin-domain in
required for Lam (Kanagawa et al.,
2004
The cytoplasmic tail of ßDg interacts with Dystrophin (Dys) in muscle
cells, and the Dys-homolog Utrophin (Utr) in epithelial cells. Dys/Utr in turn
connect to actin filaments of the cytoskeleton. Dg therefore occupies a
central position in an ECM-cytoskeleton link disruption of which leads to
various types of muscular dystrophies (Cohn
and Campbell, 2000
). In addition, Dg has been suggested to play a
key role in the transduction and modulation of various signaling cascades
(Henry and Campbell, 1999
;
Winder, 2001
).
In epithelial cells, reduced expression of Dg has been associated with
increased invasiveness of cancer cells
(Muschler et al., 2002
). In
some malignant tumors, e.g. prostate and mammary cancer, the expression of
Dg is reduced (Henry et al.,
2001
; Muschler et al.,
2002
). Furthermore, the amount of reduction is correlated with the
invasiveness of the tumor (Muschler et
al., 2002
). Recent results suggest that the loss of
Dg
might be an early event in carcinogenesis rather than being a consequence of
neoplastic transformation (Sgambato and
Brancaccio, 2005
; Sgambato et
al., 2003
).
Some reports have suggested that the major ligand for Dg in non-muscle
cells might be Pcan, because the binding of
Dg to Pcan LG-domains is
five times stronger than that to the most active Lam fragment
(Andac et al., 1999
;
Talts et al., 1999
). Pcan is
the major heparan sulfate proteoglycan in basement membranes (BMs) and
connective tissue, and has been implicated in adhesion, proliferation,
development and growth-factor binding
(Iozzo, 1994
). The Pcan core
protein consists of five domains and binds to a variety of molecules,
including FGF-7, Fibronectin, Heparin, Laminin 1, PDGF-B,
Dg and
Integrins. At the N-terminal domain I and the C-terminal domain V,
glucosaminoglycan (GAG) chains are attached that interact with Laminin-1 and
Collagen IV and bind to FGF-2, promoting its angiogenic and mitotic activities
(Iozzo, 1994
). Studies in
transgenic mice have shown that Pcan is required for the maintenance of the
functional and structural integrity of BMs in the heart, but is not needed for
BM assembly per se (Costell et al.,
1999
).
Not much is known about the function of the interaction between Pcan and
Dg. During the development of the neuromuscular junction, binding between Pcan
and Dg is required for clustering of acetylcholine esterase at the
postsynaptic membrane (Peng et al.,
1999
). In addition, cell culture studies with Pcan- and Laminin
2-deficient skin fibroblasts revealed that shedding of Dg is increased
by the lack of Pcan, but not by lack of Laminin
2
(Herzog et al., 2004
).
Pcan, Dg and other components of the Dystrophin-glycoprotein complex are
conserved in Drosophila and vertebrates
(Greener and Roberts, 2000
;
Voigt et al., 2002
).
Drosophila Pcan is encoded by terribly reduced optical lobes
(trol) and is required for controlling proliferation of neuronal stem
cells in the larval brain (Voigt et al.,
2002
). Pcan has been suggested to act in the ECM by binding,
storing and sequestering external signals, including FGF and Hedgehog
(Voigt et al., 2002
). A role
for Pcan in epithelial development has not been reported so far.
Drosophila Dg plays a role in polarizing epithelial cells and the
oocyte (Deng et al., 2003
). In
particular, Dg function has been investigated during the development of the
follicle-cell epithelium (FCE). The FCE forms through a mesenchymal-epithelial
transition and uses mechanisms operating on the apical, lateral and basal side
for epithelial differentiation (Tanentzapf
et al., 2000
). Contact of follicle cells with the basement
membrane and with the germline cells has been suggested to play a role in
polarizing the cells. As a result, distinct basal, apical and lateral
cell-membrane domains are established by accumulating protein complexes that
are actively reinforcing cell-membrane polarity. Loss of Dg leads to an
expansion of apical markers to the basal side of the cells and loss of lateral
markers. Some Dg mutant cells lose their epithelial appearance, form
multiple layers and eventually die (Deng
et al., 2003
).
The finding that Dg is required for epithelial cell polarity is particularly interesting because of its role during the invasive behavior of cancer cells, but little is known about the molecular mechanism behind this polarizing activity.
In this study, we investigate the hypothesis that Pcan and Dg constitute a
basal polarizing cue required for the differentiation of the basal membrane
domain and epithelial cell polarity. We chose the FCE as a model system for
several reasons: first, all follicle cells are derived from two to three
somatic stem cells, making mosaic analysis an excellent tool with which to
study gene function in epithelial development
(Margolis and Spradling,
1995
); second, the trol gene is transcribed in follicle
cells (Voigt et al., 2002
);
and third, we have previously shown that Dg plays a role in follicle-cell
polarization (Deng et al.,
2003
).
| MATERIALS AND METHODS |
|---|
|
|
|---|
The following stocks were obtained from the Bloomington Stock Center: hsFLP, FRT2AGFP/TM3; FRT42D GFP/CyO; hsFLP, Sco/CyO, FRT101 GFP, MKRS hsFLP/TM6, act<FRT-CD2-FRT<Gal4, UAS-GFP.
Generation of follicle cell clones
Loss-of function mosaic and follicle-cell clones overexpressing
UAS-constructs were induced as previously described
(Deng et al., 2003
).
Construction of the UAS-Dg-B construct
UAS-Dg-B was constructed by cloning the
BglII/XhoI insert of the EST clone SD06707 into the pUAST
transformation vector.
Construction of the Dys-hairpin
A 492 bp fragment common to the three transcripts of the Dys gene
was amplified from cDNA with the primers CGGTACCTGATCGCTCAGTATTGCCAGGCT and
AGGATCCGGGTCTGGAGGGTATTGGGT. After digestion with
KpnI/BamHI, the fragment was cloned both into pBluescript II
(Stratagene), forming the pKS-dys, and into pEGFP-N1 (Clontech), forming
pEGFP-N1-dys. Inversion of the sequence was carried out by excision of the
NheI/BamHI fragment of the pEGFP-N1-dys construct and
subsequent ligation with a 148 bp Sau3A linker into pKs-Dys, cut with
SpeI/BamHI. The1132 bp KpnI fragment containing the
inverse sequence separated by the linker was inserted into pUAST. Before
transformation the construct was verified by restriction analysis and
sequencing.
Glycoprotein extraction
Glycoprotein was extracted at 4°C in the presence of protease
inhibitors according to a modification of the methods of Smalheiser and Kim
(Smalheiser and Kim, 1995
) and
Collins (Collins et al., 2001
).
Drosophila embryos (100 mg) were added to 1 ml cold Tris-buffered
saline [TBS, 25 mM Tris-HCl (pH 7.4), 100 mM NaCl] plus 1% triton-X100 and 4%
protease inhibitors, homogenized and then incubated for 1 hour with
rotation.
Wheat-germ agglutinin (WGA)-agarose (Vector Laboratories) were used to capture glycoproteins: 500 µl WGA beads were incubated with the homogenate overnight, centrifuged and washed twice with TBS buffer containing 0.1% triton-X100 and 4% protease inhibitor (Roche Diagnostics). The WGA agarose was eluted twice with 250 µl TBS buffer containing 0.1% triton-X100, 4% protease inhibitors and 0.3 M N-acetyl glucosamine (Sigma) under agitation for 10 minutes. The eluates were pooled, and then renatured by overnight dialysis in TBS buffer at 4°C.
To remove non-specific binding components prior to immunoprecipitation experiments, we subjected the glycoprotein extract to a preclearing step using 5% (v/v) rabbit serum for 1 hour, followed by 1 hour incubation with 5% (v/v) of a 50% of protein A sepharose (PAS). The samples were centrifuged at 10,000 g for 10 minutes at 4°C and the supernatant collected in a new tube.
Co-immunoprecipitation
Lyophilized PcanV (Friedrich et al.,
2000
) was resuspended in deionized water to a final concentration
of 10 µg/µl and stored at -80°C. Three concentrations of PcanV
(0.05, 0.5 and 5 µg/µl) were prepared in total volumes of 450 µl of
binding buffer [25 mM HEPES-NaOH (pH 7.4), 100 mM NaCl, 1 mM CaCl2,
1 mM MnCl2, 2.5 mM MgCl2, 0.5 mM PMSF]. Aliquots of 50
µl of precleared glycoprotein lysate were added to the PcanV suspension and
incubated overnight with gentle agitation.
Anti-Dystroglycan antibody (anti-Dgpep) was absorbed onto PAS beads to saturation by incubation overnight with gentle agitation. The beads were recovered by centrifugation at 10,000 g for 2 minutes and washed thoroughly with TBS. Approximately 25 µl of anti-Dgpep-saturated PAS beads were added to 500 µl of immune complexes and incubated overnight with gentle agitation. The beads were collected by centrifugation, at 10,000 g for 2 minutes, and washed three times with binding buffer. Controls of boiled anti-Dgpep, no anti-Dgpep and rabbit serum were included in all experiments. The precipitating proteins were split into two portions, resolved by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and subjected to immunoblotting with anti-Dgcyto(1:500) and anti-PcanV (1:500) according to standard procedures.
Antibody production
Rabbit anti-Dys antibodies were generated and affinity purified against
peptide TSDTEANHDSDSRYM (amino acids 2366-2380; Eurogentec). Rabbit anti-Dgex8
(1:1000) was raised against the region corresponding to exon 8 (amino acids
243-507). Exon 8 was synthesized by PCR with primers ACGAATTCTTGGAGGTGTCG and
GGTCTAGATTATGGCGATTCAGACAGTG (DNA Technology), and LD11619 as template. The
PCR product was digested with EcoRI and XbaI, and cloned
into vector pMALc2. The purified fusion protein was used to raise a polyclonal
antiserum (Antibody AB), which was affinity purified with the fusion protein.
Rabbit anti-Dgpep antibodies were generated and affinity purified
against peptide GKSPATPSYRKPPPYVSP (Neosystems).
|
(1:1000)
(Kumagai et al., 1997
Prediction of glycosylation sites
Potential mucin type GalNAc O-glycosylation sites were predicted with the
NetOGlyc 3.1 server (Julenius et al.,
2005
).
| RESULTS |
|---|
|
|
|---|
Perlecan is required for maintaining cell membrane polarity
To determine whether the breakdown of epithelial organization in
trol clones is caused by a defect in cell polarity, we analyzed the
distribution of a collection of cell-polarity markers. Bazooka (Baz), a
component of the Baz-complex, is normally expressed in the apical membrane
domain. In trol clones, Baz is generally enriched and expanded to the
cytoplasm (Fig. 2A,B). Crumbs
(Crb) and Patj are components of the Crb complex, which is expressed apically.
Although Patj localization is not changed in trol clones
(Fig. 2C), Crb staining is
frequently reduced (Fig. 2D).
Armadillo/ß-catenin (Arm) is a cytoplasmic component of the adherens
junctions located at the apical side of the lateral membrane. Arm expression
appeared to be slightly elevated and expanded to all cell membranes
(Fig. 2E,F). Discs-large (Dlg)
is normally localized at the lateral membrane domain as part of the Dlg
complex. In trol clones, Dlg staining is strongly reduced
(Fig. 2G). These results
demonstrate that loss of Pcan leads to cell-polarity defects.
|
|
Dg (Talts
et al., 1999
120 kDa
band was detected in the precipitate which might reflect the abundance of this
form (compare with Fig.
5C).
Perlecan is required for Dystroglycan localization
We next investigated the effect of Pcan on the distribution of Dg and vice
versa. Using an antibody directed against the cytoplasmic domain of Dg,
anti-Dgcyto, we found that in trol clones, Dg is
frequently lost from the basal cell membrane
(Fig. 4A). Some variability in
this phenotype was observed, which probably reflected perdurance of Pcan in
the ECM (data not shown). Occasionally, apical expression of Dg seemed to be
increased in the clone (Fig.
4B). Pcan, however, was normally localized in Dg clones
(Fig. 4C). A disruption of the
filamentous organization was not obvious
(Fig. 4D).
To investigate whether Pcan is required specifically for localization of Dg, or also affects other ECM receptors, we determined Integrin (Int) localization in trol clones using antibodies directed against the Drosophila ß subunit of Int, ßPS. ßPS was not significantly reduced in trol clones (Fig. 4E). Only in an FCE entirely composed of mutant cells a disruption of ßPS staining was occasionally observed (Fig. 4F). To compare ßPS and Dg expression in trol clones directly, we performed a Dg and ßPS double staining. Dg was frequently lost from the basal membrane even in smaller trol clones, while ßPS expression appeared unchanged (Fig. 4G).
|
-chains. The second
-chain (Wing blister) is not expressed in
the FCE with exception of the border cells (data not shown). Although
medium-sized lanA clones did seldom show reduction of Lam
(Fig. 4J), Lam staining was
almost completely abolished when the entirely FCE was composed of
lanA mutant cells (Fig.
4K). In these `all-mutant-FCE', Dg was virtually unaffected
(Fig. 4L), indicating that Lam
is not required for Dg localization. Similarly, Pcan expression appeared
normal despite the lack of LanA showing only small regions of reduced staining
(data not shown). We conclude that Dg depends on Pcan for localization in the basal membrane domain. Our results further suggest that this dependency is specific for Pcan and Dg.
Perlecan-dependent Dystroglycan lacks the mucin-like domain
Glycosylation of Dg is widely accepted to be essential for its function,
and recent results suggest an important role for Oglycosylation in the
mucin-like domain for binding to Lam
(Kanagawa et al., 2004
) and
Pcan (Kanagawa et al., 2005
).
In this context, it is interesting that Drosophila Dg, unlike
vertebrate Dg, is subjected to alternative splicing which results in
at least two shorter forms of Dg that lack the putative mucin-like domain
(Deng et al., 2003
). In
addition to the longest Dg-mRNA (Dg-C), which codes for a
protein (Dg-C) with a calculated molecular weight of 130 kDa, two shorter
mRNAs (Dg-A and Dg-B) are generated that code for proteins
with calculated molecular weight of 111 kDa (Dg-A) and 105 kDa (Dg-B)
(Fig. 5A). Both shorter mRNAs
lack exon 8, which contains the coding sequences for the putative mucin-domain
consisting of 52 potential O-linked glycosylation sites that are clustered
within a stretch of 80 amino acids (Fig.
5B).
|
120 kDa and
200 kDa. Both
bands are recognized by two different antibodies directed against the
cytoplasmic domain of Dg (anti-Dgcyto and anti-Dgpep)
(Fig. 5C). The high discrepancy
between predicted (105, 111, 130 kDa) and the observed molecular weight (200
kDa) suggests that at least one form of Dg is subjected to substantial
posttranslational modifications. To test whether these modifications take
place within the mucin domain, we used an antibody specific for the region
encoded by exon 8 (anti-Dgex8). Anti-Dgex8 recognized
only the
200 kDa band (Fig.
5C), suggesting that the
200 kDa band represents Dg-C, while
the
120 kDa band, represents both Dg-A and/or Dg-B. Taken together, our
findings suggest that Dg-C contains a mucin domain, which is lacking in Dg-A
and Dg-B. To determine which of the Dg forms is actually expressed in the FCE, we compared the staining pattern of anti-Dgcyto and anti-Dgex8. Staining with anti-Dgcyto showed that Dg is highly concentrated in the basal membrane of follicle cells throughout oogenesis (Fig. 5D,F) and in the muscular sheath surrounding the egg chambers (data not shown). Staining with anti-Dgex8, however, revealed that the mucin-domain containing form Dg-C is expressed in the muscular sheath surrounding the egg chamber, but is absent from the basal membrane of the follicle cells (Fig. 5E,G). The dot-like staining present in the FCE is unspecific staining because it still can be observed in a Dg follicle cell clone (data not shown).
To directly test the role of the mucin-domain for the interaction with Pcan
and Lam, we ectopically expressed Dg-C and Dg-B in the FCE. As previously
described, overexpression of Dg-C induced ectopic accumulation of Lam
(Deng et al., 2003
; data not
shown). We found that Dg-B, which differs from Dg-C only by the lack of exon
8, was equally able to induce Lam accumulation
(Fig. 5H). Furthermore, both
forms induced ectopic accumulations of Pcan
(Fig. 5I,J).
Taken together, our results suggest that interaction between Dg and Pcan (and possibly Lam) does not require the mucin-like domain of Dg.
Dystroglycan is required for localization of Dystrophin and vice versa
Determining which molecular mechanisms Dg employs to maintain cell-membrane
polarity requires knowledge about proteins that interact with the cytoplasmic
domain of Dg. Two prime candidates are Dys and Utr, which are both represented
by the single Dystrophin (Dys) gene in the fly
(Greener and Roberts, 2000
).
The C-terminal Dys-binding site in the cytoplasmic domain of Dg is well
conserved in the fly (Greener and Roberts,
2000
). To determine whether the interaction between Dg and Dys is
conserved as well, we induced Dg follicle-cell clones and tested
whether removal of Dg affected the intracellular localization of Dys. Whereas
in wild-type follicle cells, Dys is localized at the basal membrane
(Fig. 6A), in Dg
mutant cells, the basal Dys staining was clearly reduced
(Fig. 6B).
|
Dystroglycan is required for Neurexin and Contactin, but not for Neuroglian localization
Previous studies suggested that the cell-surface receptor Neurexin (Nrx)
binds Dg in the brain (Sugita et al.,
2001
), prompting us to determine whether the Drosophila
homolog Neurexin IV (Baumgartner et al.,
1996
) is a likely candidate for binding to Dg and whether NrxIV is
a specific membrane-polarity marker in follicle cells. In Drosophila,
Nrx IV has been shown to be required for the formation of septate junctions
(SJ) in epithelia and glia (Baumgartner et
al., 1996
). Epithelial SJ are located towards the apical end of
the lateral membrane, basal to the adherens junction. In the FCE, incipient SJ
have been observed at stage 6 that have matured into pleated SJ by stage 10
(Muller, 2000
). To our
knowledge, expression of NrxIV in the developing follicular epithelium has not
been reported so far. We found that NrxIV is expressed in a dynamic pattern
throughout oogenesis in both germline and follicle cells
(Fig. 7A). During early stages,
NrxIV appears to be unevenly distributed in the cytoplasm of follicle and
germline cells. As oogenesis proceeds, NrxIV disappears from the cytoplasm of
both cell types. In the follicle cells, NrxIV accumulates first at the basal
side and then gradually disappears from the basal membrane and accumulates at
the basal side of the lateral membrane
(Fig. 7B). During SJ
development, NrxIV forms a complex with Neuroglian (Nrg) and Contactin (Cont),
and all three proteins are interdependent for SJ localization
(Faivre-Sarrailh et al.,
2004
). To determine whether a similar complex exists in the
follicle cell epithelium, we performed a triple staining.
Cont was weakly expressed during early stages of oogenesis
(Fig. 7C). A dot-like staining
was observed that appeared to be associated with the cell membrane
(Fig. 7D). At later stages of
oogenesis, Cont expression accumulated at the apical side of the lateral
membrane (Fig. 7E). As
described earlier (Wei et al.,
2004
), Nrg was expressed at the lateral membrane
(Fig. 7F). All three proteins
co-localized in dot-like structures, which appear to be associated with
tripartite cell junctions (Fig.
7G).
In Dg clones, NrxIV was no longer restricted basolaterally but was expressed throughout the basal membrane domain (Fig. 8A,B). A similar phenotype was observed in trol clones (Fig. 8C,D). Cont was found to colocalize with the ectopic accumulations of Nrx in Dg clones (Fig. 8E,F), whereas no change in Nrg localization was observed (Fig. 8E,F). These results suggest that Dg is required to exclude NrxIV and Cont from the basal membrane domain.
| DISCUSSION |
|---|
|
|
|---|
Patj is a cytoplasmic PDZ domain protein that forms an apical complex with
the transmembrane protein Crb (Klebes and
Knust, 2000
). In contrast to Patj, Crb is frequently reduced in
trol clones (Fig. 2D).
A similar loss of Crb was observed in embryonic salivary gland after ectopic
expression of Dg (Deng et al.,
2003
), suggesting that the apical enrichment of Dg in
trol clones might cause the reduction of Crb. Furthermore, our
results confirm the existence of a Crb-independent localization and retention
mechanism for Patj in the FCE that has been suggested earlier
(Tanentzapf et al., 2000
).
|
The overall similarity of the trol- and
Dg- phenotypes suggests that the two proteins act in the
same `polarity pathway'. In support of this view is our finding that, in
trol clones, Dg is frequently lost from the basal-cell membrane
(Fig. 4A,B). This effect seems
to be specific because: (1) Dg is unaffected by the lack of Lam A
(Fig. 4L); and (2) ßPS
remains localized in the basal membranes of trol mutant cells that
have lost Dg (Fig. 4E-G). Pcan
could stabilize Dg at the basal cell surface, either by direct binding or
indirectly through interaction with other cell-matrix or cell-surface
proteins. Recent findings suggested a trimolecular complex of Pcan, Lam and Dg
(Kanagawa et al., 2005
).
However, a role for Lam in stabilizing Dg in the FCE is unlikely, because Lam
is not required for Dg localization (Fig.
4L). Our findings that Pcan domain V can be co-immunoprecipitated
with Dg, supports the view that Pcan stabilizes Dg at least in part by direct
binding. These results suggest that direct interaction of the ECM molecule
Pcan with the transmembrane protein Dg is required for the maintenance of
follicle cell polarity.
In this context, it is interesting that mouse Dg is continuously shed from
the cell surface of normal cutaneous cells by proteolytic cleavage of ßDg
(Herzog et al., 2004
). Cell
culture studies with Pcan- and Lam
2-deficient skin fibroblasts further
revealed that shedding of Dg is increased by the lack of Pcan, but not by the
lack of Lam
2 (Herzog et al.,
2004
). Drosophila Dg appears not to be processed into an
and a ß subunit (Fig.
5C) (Deng et al.,
2003
). The antibody used to detect Dg in trol-
cells was directed against the cytoplasmic domain (anti-Dgcyto), so
clearly at least the intracellular domain of Dg, and probably the whole
protein, is lost from the cell membrane in these cells. One might speculate
that the loss of Dg in trol clones represents an elevated turnover of
Dg, thereby altering the cell-matrix interaction and activity of Dg in the
FCE, as shedding of Dg might do in the vertebrate system. In both systems,
Pcan, but not Lam, could function to counteract this mechanism and to
stabilize Dg at the cell membrane, but the expression pattern of Pcan and Dg
makes clear that other mechanisms of stabilizing Dg expression must exist
during early stages of oogenesis, when Pcan is not yet present in the ECM.
A function for Dg without mucin-domain
Glycosylation of Dg is widely accepted to be essential for its function,
and recent results suggest an important role for Oglycosylation in the
mucin-domain for binding to Lam (Kanagawa
et al., 2004
) and Pcan
(Kanagawa et al., 2005
). To
date, it is unclear whether the sugar-chains in the mucin-domain are directly
involved in the interaction or whether they play a primarily structural
function required for proper presentation of the ligand-binding domain. The
following findings suggest that, in Drosophila, binding of Pcan and
Dg does not require the mucin domain: first, the form of Dg that is expressed
at the basal side of the FCE and depends on Pcan for its maintained
localization does not contain the mucin-like domain
(Fig. 5E,G); second, ectopic
expression of Dg leads to ectopic accumulation of Lam and Pcan independent of
the presence of the mucin domain (Fig.
5H-J); and third, one single band of
120 kDa was detected in
embryonic protein extracts in overlay binding assays with PcanV (M. Friedrich
and R. Timpl, unpublished). The size of this band corresponds to the size of
the two Dg forms Dg-A and Dg-B, which lack the mucin-domain. Our results
suggest that the mucin-domain plays a structural role that might not be
required in the specific surroundings of the FCE. Another possibility is that
presence or absence of the mucin-like domain might regulate binding affinity
and/or selectivity.
|
Dg promotes differentiation of the basolateral membrane domain
Contact with the ECM is important for polarization of several epithelia,
including the vertebrate kidney epithelium
(Eaton and Simons, 1995
) and
the Drosophila midgut (Yarnitzky
and Volk, 1995
), dorsal vessel
(Haag et al., 1999
) and
follicular epithelia (Tanentzapf et al.,
2000
). In Madin-Darby canine kidney (MDCK) cells, contact with the
ECM results in the formation of a basal membrane domain and in long-range
effects on the differentiation of the non-basal domain
(Vega-Salas et al., 1987
).
Similar long-range effects of ECM contact during the establishment of polarity
have been observed in the Drosophila FCE
(Tanentzapf et al., 2000
).
Our results suggest that, after the initial polarization, ECM-cell contact mediated by Pcan and Dg plays a role in the maintenance of cell polarity. The expansion of Arm and the reduction of the lateral marker Dlg in Dg and trol clones might indicate a long-range effect of Dg on cell polarity. It is generally accepted that Dlg functions by preventing invasion of apical proteins and adherens-junction components into the lateral domain, suggesting that the reduction of Dlg in Dg and trol clones is the cause for the expansion of Arm in these clones. The molecular mechanisms underlying the effect of Dg on Dlg remain unknown, but our results show two clear short-range effects of Dg on the differentiation of the basal membrane domain: first, the recruitment and/or anchoring of the cytoplasmic protein Dystrophin and, second, the exclusion of the basolateral protein NrxIV.
Interaction of Dg and Dys is conserved in Drosophila
In vertebrates, the cytoplasmic tail of ßDg binds to Dys in muscle
cells and its homolog Utr, in epithelial cells. Dys/Utr, in turn, connects to
actin filaments of the cytoskeleton. Mutations in Dys cause a
reduction of the expression of Dg in the sarcolemma
(Ibraghimov-Beskrovnaya et al.,
1992
). In Drosophila, Dg and Dys are interdependent for
their localization in the basal membrane of the FCE
(Fig. 6) and in wing imaginal
discs (M.S., unpublished), suggesting that the interaction between both
proteins is conserved. Provided that Drosophila Dys also interacts
with actin filaments, this result could explain the defects in basal actin
organization that were observed in Dg clones
(Deng et al., 2003
).
In contrast to Dg clones, an abundant cytoplasmic localization of Dys was observed in trol clones. Further experiments are required to understand the precise molecular mechanisms underlying the observed defects in protein localization.
Our results raise the issue of whether Dys is also required for cell polarity. We observed that in Dys clones, the polarity marker Baz is clearly reduced, indicating a polarity defect in these cells (data not shown). The difference to Dg clones in which Baz is not affected, and trol clones, in which Baz expression is elevated, indicates that Dys might play a Dg-independent role in cell polarity and that the subcellular localization of Dys could play a role for its function.
Dg and NrxIV localization
Like Pcan and Lam, Neurexins contain several LG-like modules and have been
described as putative interaction partners for Dg in the brain
(Sugita et al., 2001
). Our
results suggest that, in the Drosophila FCE, Dg is required to
exclude NrxIV from the basal membrane domain. Whether a direct interaction
between Dg and NrxIV is involved in this process remains to be seen.
NrxIV is generally regarded as an integral component of pleated SJ. We were surprised by the finding that NrxIV is located basally to the region where SJ form, in a position that might correspond to the border between the lateral and basal cell membrane domains. The precise function of NrxIV during SJ development in the follicular epithelium remains to be elucidated.
In the embryo, NrxIV forms a complex with Nrg and Cont, and all three
proteins are interdependent for SJ localization
(Faivre-Sarrailh et al.,
2004
). The co-localization of NrxIV, Nrg and Cont in dot-like
structures, and the fact that Cont co-localizes with ectopic NrxIV in
Dg clones, suggest that molecular interactions between NrxIV, Cont
and Nrg also occur in the FCE.
A basal `polarizing cue' in the FCE
On the basis of our observations, we propose that Pcan and Dg provide a
basal `polarizing cue' required for differentiation of the basal membrane and
maintenance of epithelial cell polarity in the FCE. Binding of the ECM
molecule Pcan to its receptor Dg stabilizes Dg in the basal membrane. Dg is
required for stabilizing Dlg at the lateral membrane, which in turn prevents
apical markers and ZA components from invading the basolateral membrane
domain. In addition, Dg forms a complex with Dys at the basal membrane and
exerts a function in excluding NrxIV from the basal membrane. Further
investigations will be required to understand the molecular mechanisms
underlying the effect of Dg on Dlg localization and the roles of Dys and NrxIV
in this process. Hopefully, a better understanding of the function of Dg in
epithelial cell polarity will also shed some light on its role in cancer.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present address: Department of Cell Biology and Comparative Zoology,
University of Copenhagen, Universitetsparken 15, 2100 Copenhagen, Denmark
These authors contributed equally to this work ![]()
| REFERENCES |
|---|
|
|
|---|
Andac, Z., Sasaki, T., Mann, K., Brancaccio, A., Deutzmann, R. and Timpl, R. (1999). Analysis of heparin, alpha-dystroglycan and sulfatide binding to the G domain of the laminin alpha1 chain by site-directed mutagenesis. J. Mol. Biol. 287,253 -264.[CrossRef][Medline]
Baumgartner, S., Littleton, J. T., Broadie, K., Bhat, M. A., Harbecke, R., Lengyel, J. A., Chiquet-Ehrismann, R., Prokop, A. and Bellen, H. J. (1996). A Drosophila neurexin is required for septate junction and blood-nerve barrier formation and function. Cell 87,1059 -1068.[CrossRef][Medline]
Bieber, A. J., Snow, P. M., Hortsch, M., Patel, N. H., Jacobs, J. R., Traquina, Z. R., Schilling, J. and Goodman, C. S. (1989). Drosophila neuroglian: a member of the immunoglobulin superfamily with extensive homology to the vertebrate neural adhesion molecule L1. Cell 59,447 -460.[CrossRef][Medline]
Brancaccio, A., Schulthess, T., Gesemann, M. and Engel, J. (1995). Electron microscopic evidence for a mucin-like region in chick muscle alpha-dystroglycan. FEBS Lett. 368,139 -142.[CrossRef][Medline]
Cohn, R. D. and Campbell, K. P. (2000). Molecular basis of muscular dystrophies. Muscle Nerve 23,1456 -1471.[CrossRef][Medline]
Collins, B. J., Gorelick, G. and Schneider, A. B.
(2001). Dystroglycan is present in rat thyroid and rat thyroid
cells and responds to thyrotropin. Endocrinology
142,3152
-3162.
Costell, M., Gustafsson, E., Aszodi, A., Morgelin, M., Bloch,
W., Hunziker, E., Addicks, K., Timpl, R. and Fassler, R.
(1999). Perlecan maintains the integrity of cartilage and some
basement membranes. J. Cell Biol.
147,1109
-1122.
Deng, W. M. and Ruohola-Baker, H. (2000). Laminin A is required for follicle cell-oocyte signaling that leads to establishment of the anterior-posterior axis in Drosophila. Curr. Biol. 10,683 -686.[CrossRef][Medline]
Deng, W. M., Althauser, C. and Ruohola-Baker, H.
(2001). Notch-Delta signaling induces a transition from mitotic
cell cycle to endocycle in Drosophila follicle cells.
Development 128,4737
-4746.
Deng, W. M., Schneider, M., Frock, R., Castillejo-Lopez, C.,
Gaman, E. A., Baumgartner, S. and Ruohola-Baker, H. (2003).
Dystroglycan is required for polarizing the epithelial cells and the oocyte in
Drosophila. Development
130,173
-184.
Eaton, S. and Simons, K. (1995). Apical, basal, and lateral cues for epithelial polarization. Cell 82, 5-8.[CrossRef][Medline]
Faivre-Sarrailh, C., Banerjee, S., Li, J., Hortsch, M., Laval,
M. and Bhat, M. A. (2004). Drosophila contactin, a homolog of
vertebrate contactin, is required for septate junction organization and
paracellular barrier function. Development
131,4931
-4942.
Friedrich, M. V., Schneider, M., Timpl, R. and Baumgartner, S. (2000). Perlecan domain V of Drosophila melanogaster. Sequence, recombinant analysis and tissue expression. Eur. J. Biochem. 267,3149 -3159.[Medline]
Greener, M. J. and Roberts, R. G. (2000). Conservation of components of the dystrophin complex in Drosophila. FEBS Lett. 482,13 -18.[CrossRef][Medline]
Gutzeit, H. O., Eberhardt, W. and Gratwohl, E.
(1991). Laminin and basement membrane-associated microfilaments
in wild-type and mutant Drosophila ovarian follicles. J. Cell
Sci. 100,781
-788.
Haag, T. A., Haag, N. P., Lekven, A. C. and Hartenstein, V. (1999). The role of cell adhesion molecules in Drosophila heart morphogenesis: faint sausage, shotgun/DE-cadherin, and laminin A are required for discrete stages in heart development. Dev. Biol. 208, 56-69.[CrossRef][Medline]
Henchcliffe, C., Garcia-Alonso, L., Tang, J. and Goodman, C. S. (1993). Genetic analysis of laminin A reveals diverse functions during morphogenesis in Drosophila. Development 118,325 -337.[Abstract]
Henry, M. D. and Campbell, K. P. (1999). Dystroglycan inside and out. Curr. Opin. Cell Biol. 11,602 -607.[CrossRef][Medline]
Henry, M. D., Cohen, M. B. and Campbell, K. P. (2001). Reduced expression of dystroglycan in breast and prostate cancer. Hum. Pathol. 32,791 -795.[CrossRef][Medline]
Herzog, C., Has, C., Franzke, C. W., Echtermeyer, F. G., Schlotzer-Schrehardt, U., Kroger, S., Gustafsson, E., Fassler, R. and Bruckner-Tuderman, L. (2004). Dystroglycan in skin and cutaneous cells: beta-subunit is shed from the cell surface. J. Invest. Dermatol. 122,1372 -1380.[CrossRef][Medline]
Hohenester, E., Tisi, D., Talts, J. F. and Timpl, R. (1999). The crystal structure of a laminin G-like module reveals the molecular basis of alpha-dystroglycan binding to laminins, perlecan, and agrin. Mol. Cell 4,783 -792.[CrossRef][Medline]
Ibraghimov-Beskrovnaya, O., Ervasti, J. M., Leveille, C. J., Slaughter, C. A., Sernett, S. W. and Campbell, K. P. (1992). Primary structure of dystrophin-associated glycoproteins linking dystrophin to the extracellular matrix. Nature 355,696 -702.[CrossRef][Medline]
Iozzo, R. V. (1994). Perlecan: a gem of a proteoglycan. Matrix Biol. 14,203 -208.[CrossRef][Medline]
Julenius, K., Molgaard, A., Gupta, R. and Brunak, S.
(2005). Prediction, conservation analysis, and structural
characterization of mammalian mucin-type O-glycosylation sites.
Glycobiology 15,153
-164.
Kanagawa, M., Saito, F., Kunz, S., Yoshida-Moriguchi, T., Barresi, R., Kobayashi, Y. M., Muschler, J., Dumanski, J. P., Michele, D. E., Oldstone, M. B. et al. (2004). Molecular recognition by LARGE is essential for expression of functional dystroglycan. Cell 117,953 -964.[CrossRef][Medline]
Kanagawa, M., Michele, D. E., Satz, J. S., Barresi, R., Kusano, H., Sasaki, T., Timpl, R., Henry, M. D. and Campbell, K. P. (2005). Disruption of perlecan binding and matrix assembly by post-translational or genetic disruption of dystroglycan function. FEBS Lett. 579,4792 -4796.[Medline]
Klebes, A. and Knust, E. (2000). A conserved motif in Crumbs is required for E-cadherin localisation and zonula adherens formation in Drosophila. Curr. Biol. 10, 76-85.[CrossRef][Medline]
Kumagai, C., Kadowaki, T. and Kitagawa, Y. (1997). Disulfide-bonding between Drosophila laminin beta and gamma chains is essential for alpha chain to form alpha betagamma trimer. FEBS Lett. 412,211 -216.[CrossRef][Medline]
Li, S., Harrison, D., Carbonetto, S., Fassler, R., Smyth, N.,
Edgar, D. and Yurchenco, P. D. (2002). Matrix assembly,
regulation, and survival functions of laminin and its receptors in embryonic
stem cell differentiation. J. Cell Biol.
157,1279
-1290.
Li, S., Edgar, D., Fassler, R., Wadsworth, W. and Yurchenco, P. D. (2003). The role of laminin in embryonic cell polarization and tissue organization. Dev. Cell 4, 613-624.[CrossRef][Medline]
Margolis, J. and Spradling, A. (1995). Identification and behavior of epithelial stem cells in the Drosophila ovary. Development 121,3797 -3807.[Abstract]
Muller, H. A. (2000). Genetic control of epithelial cell polarity: lessons from Drosophila. Dev. Dyn. 218,52 -67.[CrossRef][Medline]
Muschler, J., Levy, D., Boudreau, R., Henry, M., Campbell, K.
and Bissell, M. J. (2002). A role for dystroglycan in
epithelial polarization: loss of function in breast tumor cells.
Cancer Res. 62,7102
-7109.
Peng, H. B., Xie, H., Rossi, S. G. and Rotundo, R. L.
(1999). Acetylcholinesterase clustering at the neuromuscular
junction involves perlecan and dystroglycan. J. Cell
Biol. 145,911
-921.
Pignoni, F. and Zipursky, S. L. (1997). Induction of Drosophila eye development by decapentaplegic. Development 124,271 -278.[Abstract]
Sciandra, F., Schneider, M., Giardina, B., Baumgartner, S., Petrucci, T. C. and Brancaccio, A. (2001). Identification of the beta-dystroglycan binding epitope within the C-terminal region of alpha-dystroglycan. Eur. J. Biochem. 268,4590 -4597.[Medline]
Sgambato, A. and Brancaccio, A. (2005). The dystroglycan complex: from biology to cancer. J. Cell Physiol. 205,163 -169.[CrossRef][Medline]
Sgambato, A., Migaldi, M., Montanari, M., Camerini, A.,
Brancaccio, A., Rossi, G., Cangiano, R., Losasso, C., Capelli, G., Trentini,
G. P. et al. (2003). Dystroglycan expression is frequently
reduced in human breast and colon cancers and is associated with tumor
progression. Am. J. Pathol.
162,849
-860.
Smalheiser, N. R. and Kim, E. (1995).
Purification of cranin, a laminin binding membrane protein. Identity with
dystroglycan and reassessment of its carbohydrate moieties. J.
Biol. Chem. 270,15425
-15433.
Sugita, S., Saito, F., Tang, J., Satz, J., Campbell, K. and
Sudhof, T. C. (2001). A stoichiometric complex of neurexins
and dystroglycan in brain. J. Cell Biol.
154,435
-445.
Talts, J. F., Andac, Z., Gohring, W., Brancaccio, A. and Timpl, R. (1999). Binding of the G domains of laminin alpha1 and alpha2 chains and perlecan to heparin, sulfatides, alpha-dystroglycan and several extracellular matrix proteins. EMBO J. 18,863 -870.[CrossRef][Medline]
Tanentzapf, G., Smith, C., McGlade, J. and Tepass, U.
(2000). Apical, lateral, and basal polarization cues contribute
to the development of the follicular epithelium during Drosophila oogenesis.
J. Cell Biol. 151,891
-904.
Vega-Salas, D. E., Salas, P. J., Gundersen, D. and
Rodriguez-Boulan, E. (1987). Formation of the apical pole of
epithelial (Madin-Darby canine kidney) cells: polarity of an apical protein is
independent of tight junctions while segregation of a basolateral marker
requires cell-cell interactions. J. Cell Biol.
104,905
-916.
Voigt, A., Pflanz, R., Schafer, U. and Jackle, H. (2002). Perlecan participates in proliferation activation of quiescent Drosophila neuroblasts. Dev. Dyn. 224,403 -412.[CrossRef][Medline]