|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 30 August 2006
doi: 10.1242/dev.02558
Department of Animal Biology, School of Veterinary Medicine, University of Pennsylvania, 3800 Spruce Street, Philadelphia, PA 19104, USA.
¶ Author for correspondence (e-mail: saintj{at}vet.upenn.edu)
Accepted 1 August 2006
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key words: Neural crest, Induction, Sox9, Sox10, Craniofacial, Melanocytes, Xenopus
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). These proteins
are characterized by the presence of a DNA-binding domain known as the HMG
box. Based on their homology within and outside this domain, Sox proteins have
been classified into 10 groups (A-J)
(Bowles et al., 2000). Members
of Sox group E include Sox8, Sox9 and Sox10; in the recent years SoxE genes
have been extensively studied for their role in chondrogenesis, sex
determination, pigment cell differentiation, gliogenesis and neural crest
development (reviewed by de Crombrugghe et
al., 2001; Koopman,
2005; Wegner,
2005; Wegner and Stolt,
2005; Hong and Saint-Jeannet,
2005).
The neural crest constitutes a multipotent population of cells generated at
the lateral edge of the neural plate. These cells have the remarkable ability
to migrate in the embryo to give rise to a broad range of derivatives
including craniofacial cartilage, pigment cells, spinal and enteric ganglia.
Among the three SoxE factors expressed in the developing neural crest, the
functions of Sox9 and Sox10 are best understood. Genetic studies in mouse
(Mori-Akiyama et al., 2003;
Akiyama et al., 2004;
Herbarth et al., 1998;
Southard-Smith et al., 1998;
Britsch et al., 2001) and
zebrafish (Yan et al., 2002;
Yan et al., 2005;
Dutton et al., 2001) have
demonstrated that Sox9 and Sox10 have non-overlapping function in
cranial/cardiac and trunk/vagal neural crest, respectively. Similarly,
gain-of-function and knockdown experiments in chick
(Cheung and Briscoe, 2003;
McKeown et al., 2005) and
Xenopus (Spokony et al.,
2002; Aoki et al.,
2003; Honore et al.,
2003; Lee et al.,
2004) have established that Sox9 and Sox10 regulate neural crest
precursor formation and their subsequent development along distinct lineages
(reviewed by Hong and Saint-Jeannet,
2005).
The importance of Sox8 in neural crest development is not as firmly
established. Sox8-deficient mouse embryos are primarily characterized by
idiopathic weight reduction. These mutants are viable and do not exhibit any
neural crest defects (Sock et al.,
2001). The lack of a neural crest phenotype in these animals is
believed to be due to the functional redundancy of Sox9 and/or Sox10, as the
expression of these genes overlaps largely with that of Sox8 in neural crest
progenitors and their derivatives (Sock et
al., 2001). The functional compensation between SoxE proteins is
non-reciprocal, as both Sox9- and Sox10-deficient mice exhibit severe
developmental defects, despite continued Sox8 expression. One question is
whether the redundant function of SoxE proteins is also a prevailing mechanism
in other vertebrates. Here, we describe the expression and function of Sox8
during Xenopus neural crest formation. Unlike its chick and mouse
counterparts, Xenopus Sox8 expression precedes that of Sox9 and Sox10
in the neural crest. The emergence of neural crest progenitors was
dramatically delayed in Sox8-deficient embryos, leading to severe defects in
multiple lineages of the neural crest. These results indicate that Sox8
functions in initiating neural crest formation in Xenopus and
underscore differences in the relative importance of SoxE factors across
species in the development of this important cell population.
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
) and mouse
(Schepers et al., 2000) Sox8
sequences. The resulting 506 bp PCR product was used to screen a stage 17
lambda ZAPII cDNA library (gift from Michael King) to isolate a full-length
clone. The sequence of Xenopus Sox8 has been submitted to GenBank
(Accession Number, AY324658). Sox8 ORF was subcloned into pCS2+ expression
plasmid. A mutated version of Sox8 (mSox8) was generated by PCR. In this
construct, four bases (underlined) were mutated 3' to the ATG (bold)
(ACCATGTTAAATATGTCTTCG), within
the recognition motif for Sox8 morpholino oligonucleotide (see below). These
mutations did not affect the amino acid composition of Xenopus Sox8
protein. The inducible constructs Sox8GR, Sox9GR and Sox10GR were generated by
fusing the coding region of each SoxE genes to the human glucocorticoid
receptor ligand-binding domain (GR), as described
(Gammill and Sive, 1997;
Tada et al., 1997). All
constructs were sequenced and the corresponding protein monitored using an in
vitro transcription/translation coupled rabbit reticulocyte lysate system.
In vitro transcription/translation
The in vitro transcription/translation coupled rabbit reticulocyte lysate
system was used according to the manufacturer recommendations (Promega) in the
presence of [35S] methionine and resolved on a NuPAGE BIS-Tris gel
(Invitrogen). The specificity of the morpholino antisense oligonucleotide (see
below) was determined by adding increasing amount of morpholino (10-1000 ng)
to the in vitro transcription/translation reaction directed by Sox8, mSox8,
Sox9 or Sox10 cDNAs.
Xenopus embryo injections and dexamethasone treatment
Embryos were staged according to Nieuwkoop and Faber
(Nieuwkoop and Faber, 1956).
Synthetic mRNAs were synthesized in vitro using the Message Machine kit
(Ambion). Sox8 morpholino antisense oligonucleotide (Sox8mo,
TCATGTTCAGCATTGAGGAGCCGGG) and a five-base (underlined) mismatched Sox8
morpholino (Sox8mis, TCATCTTGA
GCATTCAGGACC CCGG) were purchased from Gene
Tools. Sox8 (1 ng), mSox8 (1 ng), Sox8GR (1 ng), Sox9GR (1 ng) and Sox10GR (1
ng) mRNA and morpholinos were injected in the animal pole of two-cell or
eight-cell stage embryos. For animal explant experiments, both blastomeres of
two-cell stage embryos were injected with SoxE-GR mRNAs in the animal pole
region, explants were dissected at the late blastula stage and cultured in
vitro for 4 hours in NAM 0.5x plus 10 µM of dexamethasone (Sigma) as
described (Gammill and Sive,
1997; Tada et al.,
1997). In some experiments, the protein synthesis inhibitor
cycloheximide (10 µg/ml; Sigma) was also added to the culture medium
(Gammill and Sive, 1997).
Animal explants were subsequently analyzed by RT-PCR for the expression of
various marker genes (see below). For the rescue experiments using SoxE-GR
constructs, embryos were treated with dexamethasone at stage 10.5 and analyzed
by in situ hybridization for Slug (stage 14) and Sox10 (stage 16)
expression.
Lineage tracing and whole-mount in situ hybridization
Embryos were co-injected with ß-gal mRNA or fluorescein lysine dextran
(FLDX; Mr 10,000, Molecular Probes) to identify the
injected side. Embryos at the appropriate stage were fixed in MEMFA and
successively processed for Red-Gal (Research Organics) staining and in situ
hybridization. Antisense DIG-labeled probes (Genius kit, Roche) were
synthesized using template cDNA encoding Slug
(Mayor et al., 1995), Snail
(Essex et al., 1993), Myc
(Bellmeyer et al., 2003), Sox9
(Spokony et al., 2002), Sox10
(Aoki et al., 2003), Pax3
(Bang et al., 1997), Xag1
(Sive et al., 1989), Pdx1
(Lee and Saint-Jeannet, 2003)
and Trp2 (Aoki et al., 2003).
Whole-mount in situ hybridization was performed as previously described
(Harland, 1991). For
histology, embryos were fixed in MEMFA and embedded in Paraplast+. Sections
(12 µm) were cut on a rotary microtome and stained with Eosin alone or with
a combination of Hematoxylin and Eosin.
Cartilage staining
Alcian Blue staining of embryos was performed as described
(Berry et al., 1998;
Spokony et al., 2002).
Briefly, stage 45 embryos were fixed, skinned, eviscerated, dehydrated and
stained in Alcian Blue for 12 hours. After several rinses in 95% ethanol,
embryos were rehydrated and macerated in 2% potassium hydroxide. Specimens
were then transferred successively in 20%, 40%, 60% and 80% glycerol in 2%
potassium hydroxide. The ethmoidal plate was dissected out and specimens were
flat mounted under a coverslip in 80% glycerol.
Proliferation assay and TUNEL staining
For phosphohistone H3 detection (Saka
and Smith, 2001), Sox8mo-injected albinos embryos were fixed in
MEMFA. Embryos were incubated successively in 
-phosphohistone H3
antibody (Upstate Biotechnology; 1 µg/ml) and anti-rabbit IgG conjugated to
alkaline phosphatase (Jackson ImmunoResearch; 1:1000). Alkaline phosphatase
activity was revealed using NBT/BCIP (Roche). TUNEL staining was carried as
described (Hensey and Gautier,
1998). Sox8mo-injected albinos embryos fixed in MEMFA were
rehydrated in PBT and washed in TdT buffer (Roche) for 30 minutes. End
labeling was carried out overnight at room temperature in TdT buffer
containing 0.5 µM DIG-dUTP and 150 U/ml TdT (Roche). Embryos were then
washed for 2 hours at 65°C in PBS/1 mM EDTA. DIG was detected by anti-DIG
Fab fragments conjugated to alkaline phosphatase (Roche; 1:2000) and the
chromogenic reaction performed using NBT/BCIP (Roche). For proliferation assay
and TUNEL staining, FLDX was used as a lineage tracer to identify the injected
side.
Western blot analysis
SoxE-GR-injected embryos were collected at stage 17, homogenized, resolved
on a NuPAGE BIS-Tris gel and blotted onto nitrocellulose. Blots were
subsequently incubated in the presence of the -GR polyclonal antibody
(P-20, Santa Cruz Biotechnology) at a 1:100 dilution, washed and incubated
with anti-goat Ig coupled to horseradish peroxidase (Santa Cruz Biotechnology;
1:60,000 dilution). The product of the reaction was revealed using the
SuperSignal West Femto Maximum Sensitivity Substrate from Pierce and detected
by exposure onto a BioMax film (Kodak). Blots were stripped according to the
manufacturer recommendations (Pierce) and probed with anti--tubulin
antibody (Sigma; 1:500 dilution) as a loading control.
Analysis of gene expression by RT-PCR
For each injected sample, total RNAs from 10 animal explants were extracted
using RNeasy micro kit (Qiagen). Real-time RT-PCR (LightCycler, Roche) was
performed using specific primer sets: Sox8 (F, AAGGTCTCTGGTGGCTGAAA; R,
CACCGCCACATTTCAGAGTA); Sox9 (Lee et al.,
2004); Sox10 (F, CTGTGAACACAGCATGCAAA; R, TGGCCAACTGACCATGTAAA);
and EF1 (Lee et al.,
2004). The cycle conditions were as follows: denaturation at
95°C (3 seconds), annealing at 55°C (5 seconds) and extension at
72°C (10 seconds). With the exception of EF1, all primers were
designed outside the coding region. By optimizing primers and reaction
conditions, a single specific product was amplified as confirmed by melting
curve analysis. Water blank and -RT reactions were also performed as negative
controls. To quantify expression levels relative to control, serial dilutions
of total RNA extracted from stage 22 embryos were used as concentration
standards in each real-time RT-PCR reaction. In each case, EF1 was used
as an internal reference (not shown), and for each histogram the values were
normalized to the level of EF1 expression. The histograms presented in
Fig. 6 are representative of at
least three independent experiments.
|
RESULTS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
), 74% identity with mouse Sox8
(Schepers et al., 2000) and
78% identity with chicken Sox8 (Bell et
al., 2000). When compared with Xenopus Sox9
(Spokony et al., 2002) and
Sox10 (Aoki et al., 2003;
Honore et al., 2003), the
overall amino acid identities dropped to 52% and 48%, respectively.
Sox8 is expressed in neural crest progenitors
To analyze the expression of Sox8, whole-mount in situ hybridization was
performed on embryos at different stages. Sox8 transcripts were first detected
at the gastrula stage, in a domain around the blastopore restricted to the
ventrolateral side (Fig. 1A).
This expression domain persisted after blastopore closure and into the neurula
stages (Fig. 1B-D). A second
domain of expression appeared at the mid-gastrula stage (stage 11.5), lateral
to the prospective neural plate (Fig.
1B,C). At stage 12, this lateral expression domain increased in
what will become the neural crest-forming region
(Fig. 1D). At the neurula stage
(stage 15), the Sox8 neural crest expression domain overlapped with that of
Sox9 and Sox10 (Fig. 1E-G), and
persists in both the medial and lateral neural crest throughout neurulation
(Fig. 1H-J). At these stages,
Sox8 was also expressed in a region anterior to the neural plate, presumably
corresponding to the prospective cement gland, as confirmed by the expression
of the cement gland marker Xag1 (Fig.
1J; data not shown); however, the level of expression of Sox8 in
the presumptive cement gland was very variable from one batch of embryos to
the next. As development proceeds, neural crest cells initiated their
migration in the cranial region and strong expression of Sox8 was detected in
streams of neural crest cells migrating towards the branchial arches and into
the frontonasal region, as well as in the prospective trunk neural crest at
the dorsal midline (Fig. 1K,L).
In Fig. 1M, the expression of
the three SoxE genes is analyzed and compared in stage 25 and 35 embryos. At
stage 25, Sox8 expression persisted in the trunk and in migrating cranial
neural crest cells and in discrete domains within the brain. This is the stage
when Sox9 is downregulated in the trunk neural crest
(Spokony et al., 2002). In
contrast to Sox9 and Sox10, Sox8 did not appear to be expressed early on in
the presumptive otic placode. Sox8 otic expression was only detected around
stage 30 (not shown). At stage 35, although Sox10 expression was downregulated
in the pharyngeal arches (Aoki et al.,
2003), Sox8 expression was maintained in the neural crest
component of the branchial arches in a pattern reminiscent to that of Sox9
(Fig. 1M; middle panels). Sox8
was also detected in the pancreatic rudiment
(Fig. 1M; right panels),
similar to Sox9 where it is co-expressed with Pdx1 (not shown)
(Lee and Saint-Jeannet,
2003).
|
). The initial expression of Sox8 at the
neural plate border coincides with that of Snail at stage 11.5, following Pax3
expression detected as early as stage 11, but preceding Sox9
(Spokony et al., 2002), Myc
(Bellmeyer et al., 2003), Slug
(Mayor et al., 1995) and Foxd3
(Sasai et al., 2001). Sox10
(Aoki et al., 2003;
Honore et al., 2003)
expression was first detected only around stage 13.5/14
(Fig. 2B). We conclude that Sox8 is one of the earliest genes expressed in the prospective neural crest territory. In this tissue, its expression precedes Slug, Foxd3, Sox9, Myc and Sox10. Later, Sox8 expression in neural crest derivatives and appears to recapitulate both Sox9 and Sox10 expression patterns.
Sox8 is required for the formation of neural crest progenitors
To investigate Sox8 function during early neural crest development, we
performed knockdown of Sox8 protein in developing embryos using morpholino
antisense oligonucleotides. A Sox8 morpholino (Sox8mo) was designed to
interfere specifically with translation of Sox8 mRNA. In an in vitro
transcription/translation assay (Fig.
3A), Sox8mo blocked Sox8 protein production in a
concentration-dependent manner but did not interfere with the production of
other SoxE proteins, Sox9 and Sox10 (Fig.
3A). Unilateral injection of Sox8mo (10 ng to 30 ng) in the animal
region of two-cell stage embryos resulted in a marked decrease of Sox10
expression at stage 17 in more than 80% of the embryos analyzed
(Fig. 3B,C). Injection of a 5
bp mismatched morpholino (Sox8mis) at the same concentrations had no effect on
Sox10 expression (Fig. 3E).
Interestingly, at stage 17, the proportion of embryos with reduced Sox9 and
Slug expression was much lower (40%), even for the highest dose of morpholino
(Fig. 3B,C). The neural plate
marker Sox2 was also only marginally expanded in 35% (n=79) of the
embryos that received the higher dose (20 ng to 30 ng) of Sox8mo
(Fig. 3B). At this stage, the
overall anteroposterior patterning of these embryos was not affected, as
determined by the expression of forebrain (Otx2), hindbrain (Krox20) and
spinal cord (HoxB9) marker genes (not shown).
|
Because Slug and Sox9 are only marginally affected in Sox8-depleted embryos
when compared with Sox10, we decided to investigate whether this difference
could be due to the fact that Sox10 expression at the neural plate border is
initiated several hours after Slug and Sox9, around stage 14
(Aoki et al., 2003;
Honore et al., 2003)
(Fig. 2A). To achieve this, we
analyzed the expression of Slug and Sox9 at early time points after Sox8mo
injection. We found that the onset of expression of both Slug and Sox9 was
affected in a large number of Sox8mo-injected embryos analyzed at stage 12.5
or stage 14 (Fig. 4A,B), and at
a similar frequency to what was observed for Sox10 at stage 17
(Fig. 4B). These observations
suggested that Sox8 regulates the onset of expression of most neural crest
marker genes; however, Sox8 does not appear to be required for the maintenance
of the expression of these genes.
SoxE factors function redundantly at the neural plate border
To determine whether SoxE factors can function redundantly during neural
crest formation in Xenopus, we compared the ability of Sox8, Sox9 and
Sox10 to rescue the phenotype of Sox8-depleted embryos. As described earlier
(Fig. 3D), injection of mSox8
mRNA was efficient at restoring Sox10 expression at stage 17 (70%,
n=50; Fig. 5A), but
was also able to restore normal levels of Slug expression at stage 14 (57%,
n=52; Fig. 5A).
Expression of Sox9 at the gastrula stage using an inducible construct (Sox9GR)
was also able to rescue Slug and Sox10 expression in a large proportion of
Sox8-depleted embryos (80.5%, n=53 and 100%, n=66,
respectively; Fig. 5A). An
inducible Sox10 (Sox10GR) shared the same ability as Sox8 and Sox9 to rescue
Sox10 expression in Sox8-deficient embryos (100% rescued, n=41;
Fig. 5A); however, Sox10GR was
somewhat less potent than the other two SoxE genes at rescuing Slug expression
at stage 14 (16% rescued, n=39;
Fig. 5A). Interestingly, in
these experiments, although Slug expression was primarily restored within its
normal domain, Sox10 rescue was always associated with ectopic expression
domains lateral to the neural crest region
(Fig. 5A). This more potent
activation of Sox10 may suggest a direct regulation of Sox10 by all three SoxE
genes. Importantly, in these experiments the SoxE-GR constructs produced
similar level of proteins when determined by western blot analysis
(Fig. 5B). These results
indicate that the activity of all three Sox genes is largely interchangeable
in this assay and suggest that SoxE factors may function redundantly at the
neural plate border.
|
|
|
; Spokony et al.,
2002). Alcian Blue staining revealed that all affected embryos
(67% of the embryos; n=70) presented a severe loss or reduction of
craniofacial skeletal elements (Fig.
7B). We also wished to determine whether other neural crest
derivatives were affected in these embryos. Pigment cells are one of the
derivatives of the trunk neural crest, and around 65% of the embryos injected
with Sox8mo showed reduced Trp2-expressing cells (n=60) on the
injected side (Fig. 7C).
Another trunk neural crest derivative, the dorsal root ganglia, were
undetectable in stage 42 Sox8mo-injected embryos
(Fig. 7D). Several days later,
at equivalent stage 47, these embryos showed reduced dorsal root ganglia when
compared with sibling embryos that received injection of Sox8mis
oligonucleotides (Fig. 7D).
These results indicate that Sox8-deficient embryos have a broad range of
defects in multiple lineages of the neural crest.
|
-phosphohistone H3 antibody, no significant
difference was observed in the numbers of dividing cells in regions of the
neural folds that received Sox8mo when compared with the uninjected side
(Fig. 8A). Similarly, no
significant increase in TUNEL staining was observed in Sox8-depleted embryos
at early neurula stages (Fig.
8B). The lack of an apparent effect of Sox8 depletion either on
cell proliferation or on apoptosis suggested that the phenotype of
Sox8-depleted embryos cannot be explained by an initial reduction in the
neural crest progenitor pool or by a decrease in cell survival. To further investigate the mechanism by which Sox8 regulates neural crest development, we analyzed the pattern of neural crest cells migration in the cranial region of Sox8-depleted embryos. Sox9 and Sox10 are both expressed in the migrating cranial neural crest cells around stage 25, and this pattern of migration was severely disrupted in Sox8mo-injected embryos (Fig. 8C). Cranial neural crest cells failed to migrate into the pharyngeal arches of Sox8mo-injected embryos and accumulated lateral to the hindbrain (Fig. 8C,D). Although at this stage embryos showed no obvious increase in cell death in the vicinity of the hindbrain, as determined by TUNEL staining (Fig. 8E), it is likely that later in development these non-migrating cells will fail to differentiate and become apoptotic. These results suggest that the timing of induction of neural crest progenitors is crucial for their subsequent migration and that any delay in this process is detrimental to their proper migration and further differentiation.
|
|
DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
; Huang and Saint-Jeannet,
2004). One of the immediate consequences of the induction of
neural crest cells is the activation of a number of crest-specific genes that
define the identity of these cells (reviewed by
Gammill and Bronner-Fraser,
2003; Heeg-Truesdell and
LaBonne, 2004; Huang and
Saint-Jeannet, 2004). Among those genes, the Sox family of
transcription factors has emerged as key regulator of this cell type. Work in
different species has demonstrated the fundamental role of SoxE factors (Sox8,
Sox9 and Sox10) in the control of processes as diverse as specification,
maintenance, delamination, migration and differentiation of neural crest cells
(reviewed by Hong and Saint-Jeannet,
2005).
Although expression of all three SoxE genes is detected in neural crest
progenitors at some point following neural crest induction, there are some
differences in the onset and the sequence of their appearance across species.
For example, in Xenopus, Sox8 is the first Sox family member detected
in the presumptive neural crest immediately followed by Sox9
(Spokony et al., 2002) and
Sox10 (Aoki et al., 2003;
Honore et al., 2003). In chick
and mouse embryos, Sox9 and Sox10 precede Sox8 expression in neural crest
progenitors (Bell et al., 2000;
Cheung and Briscoe, 2003;
Cheng et al., 2000;
Sock et al., 2001;
Zhao et al., 1997;
Kuhlbrodt et al., 1998). In
zebrafish, Sox8 is never expressed in the developing neural crest
(Yan et al., 2005), while the
two orthologs of the tetrapod Sox9, Sox9a and Sox9b, are detected in neural
crest progenitors (Chiang et al.,
2001; Li et al.,
2002; Yan et al.,
2005) prior to Sox10 (Dutton
et al., 2001). These differences in the timing of appearance of
these factors may have important implications on the relative contribution of
these proteins to various aspects of neural crest development in each
species.
Another remarkable characteristic of Sox8 expression is its strong overlap
with Sox9 and/or Sox10 in neural crest derivatives. In Xenopus, Sox9
and Sox10 are initially co-expressed at the neural plate border and later have
a complementary expression pattern in the developing neural crest: while Sox9
expression is maintained in migrating cranial neural crest cells, Sox10
expression persists primarily in trunk neural crest cells
(Spokony et al., 2002;
Aoki et al., 2003;
Honore et al., 2003).
Interestingly, Sox8 appears to be the sum of Sox9 and Sox10 expression, as it
is expressed in both premigratory trunk and migratory cranial neural crest.
This is also the case in the mouse embryo, where Sox8 is co-expressed with
Sox10 in the enteric nervous system
(Kuhlbrodt et al., 1998;
Sock et al., 2001) and with
Sox9 in the pharyngeal arches (Wright et
al., 1995; Sock et al.,
2001). Because of its extensive overlap with Sox9 or Sox10, or
both, compensatory mechanisms between Sox8 and Sox9/Sox10 are expected to take
place during development of the neural crest.
|
).
Interestingly, although inactivation of one Sox10 allele is sufficient to
elicit agangliogenesis of the gut
(Southard-Smith et al., 1998;
Herbarth et al., 1998),
homozygous Sox8 mutant mouse embryos develop normal enteric ganglia
(Sock et al., 2001).
Similarly, in the central nervous system, where Sox8 and Sox10 are both
expressed in the oligodendrocyte lineage, a milder impact on oligodendrocyte
development was observed in Sox8-deficient embryos when compared with Sox10
heterozygous animals (Stolt et al.,
2004). In both cases, it has been proposed that the unilateral
compensatory activity of Sox8 by Sox10 was likely to be due to unequal amounts
of Sox8 and Sox10 proteins in the developing embryo
(Stolt et al., 2004;
Maka et al., 2005). It is
believed that Sox8 acts as a modifier gene as loss of Sox8 alleles increases
the penetrance and severity of the gut phenotype in Sox10 heterozygous mice
(Maka et al., 2005). Double
mutant analyses also indicate a cooperation between Sox8 and Sox9 in testis
differentiation in the mouse (Chaboissier
et al., 2004).
In Xenopus, the observation that Sox8-depletion leads to a delay
in the emergence of neural crest progenitors suggests that Sox8 is required to
initiate the specification of neural crest cells, consistent with the timing
of expression of this gene at the neural plate border
(Fig. 2A). However, as neural
plate border cells eventually express neural crest-specific genes such as Slug
and Sox9, it is clear that Sox8 is dispensable for the maintenance of this
cell population. Based on the mouse work, it is likely that Sox9 and/or Sox10
are also compensating for the loss of Sox8 in Xenopus. This is
supported by recent results suggesting that Sox9 and Sox10 in Xenopus
share similar properties during neural crest development
(Taylor and LaBonne, 2005).
Additionally, overexpression studies in the chick embryo also point to a
functional equivalence of SoxE factors, based on their ability to promote
ectopic neural crest formation in the neural tube
(Cheung and Briscoe, 2003). In
an attempt to address this redundancy issue directly, we analyzed the ability
of individual SoxE factors to rescue the phenotype of Sox8-depleted embryos.
We found that all three factors were as efficient at rescuing the early
phenotype of Sox8mo-injected embryos, further arguing for a redundant activity
of these factors at the neural plate border. Likewise, in animal explants, we
found that qualitatively Sox8, Sox9 and Sox10 had a comparable ability to
upregulate Sox10 expression. Recently, using a gene replacement approach, it
has been shown that Sox8 can only partially rescue the neural crest phenotype
of Sox10-deficient mouse embryos, arguing for an incomplete functional
equivalence of Sox8 and Sox10 (Kellerer et
al., 2006). These differences suggest that the extent of
compensatory activity of SoxE factors is likely to be context dependent.
Because, in Xenopus, Sox8 is expressed earlier than Sox9 and
Sox10, there is a short window of time (between stage 11.5 and stage 12)
during which no other SoxE factor is expressed to compensate for the loss of
Sox8; this period appears to be crucial for the timely specification of neural
crest progenitors. Our results indicate that a delay in the induction of
neural crest progenitors is never fully compensated for in Sox8-depleted
embryos. Although these embryos express what appears to be normal level of
Slug and Sox9 at the late neurula stages, they also exhibit major defects in
both cranial and trunk neural crest derivatives. The level of resolution of in
situ hybridization does not allow us to determine whether the overall number
of neural crest progenitors was decreased in morpholino-treated embryos.
However, using an -phosphohistone H3 antibody, no significant
difference was noted in the numbers of dividing cells in regions of the neural
folds that did received Sox8mo. Similarly, no significant increase in TUNEL
labeling was observed in Sox8-depleted embryos at early neurula stage.
However, morpholino-treated embryos showed impaired neural crest migration,
suggesting that at least the craniofacial phenotype of Sox8-depleted embryos
is a direct consequence of the inability of neural crest cells to reach their
proper targets in the periphery. Here, we can speculate that, because of the
delay in their specification, neural crest progenitors generated in
Sox8-depleted embryos did not receive all the necessary instructive cues that
are crucial to their migration.
In conclusion, this study provides evidence for an early function of Sox8 in neural crest development in Xenopus. In this organism, the tight regulation of Sox8 expression at the neural plate border appears to be crucial to the timely specification of neural crest progenitors. Although this is in apparent contrast to the reported phenotype of Sox8-null mouse embryos in which other SoxE proteins are compensating for the loss of Sox8, these results also highlight species-specific differences in the relative contribution of SoxE proteins to the development of the neural crest. We propose that these differences are the result of divergences in the timing and sequence of expression of SoxE factors at the neural plate border, rather than the result of differences in the intrinsic activity of these factors.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/133/19/3817/DC1
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
Present address: Department of Medicine, Howard Hughes Medical Institute,
University of Pennsylvania, Philadelphia, PA 19104, USA
Present address: The Wellcome Trust/Cancer Research UK Gurdon Institute,
University of Cambridge, Tennis Court Road, Cambridge CB2 1QN, UK
Present address: Department of Neurology, Weill Medical College of Cornell
University, New York, NY 10021, USA
|
REFERENCES |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Akiyama, H., Chaboissier, M. C., Behringer, R. R., Rowitch, D.
H., Schedl, A., Epstein, J. A. and de Crombrugghe, B. (2004).
Essential role of Sox9 in the pathway that controls formation of cardiac
valves and septa. Proc. Natl. Acad. Sci. USA
101,6502
-6507.
Aoki, Y., Saint-Germain, N., Gyda, M., Magner-Fink, E., Lee, Y.-H., Credidio, C. and Saint-Jeannet, J.-P. (2003). Sox10 regulates the development of neural crest-derived melanocytes in Xenopus. Dev. Biol. 259,19 -33.[CrossRef][Medline]
Bang, A. G., Papalopulu, N., Kintner, C. and Goulding, M. D. (1997). Expression of Pax3 is initiated in the early neural plate by posteriorizing signals produced by the organizer and by posterior non-axial mesoderm. Development 124,2075 -2085.[Abstract]
Bell, K. M., Western, P. S. and Sinclair, A. H. (2000). SOX8 expression during chick embryogenesis. Mech. Dev. 94,257 -260.[CrossRef][Medline]
Bellmeyer, A., Krase, J., Lindgren, J. and LaBonne, C. (2003). The protooncogene c-myc is an essential regulator of neural crest formation in xenopus. Dev. Cell 4, 827-839.[CrossRef][Medline]
Berry, D. L., Rose, C. S., Remo, B. F. and Brown, D. D. (1998). The expression pattern of thyroid hormone response genes in remodeling tadpole tissues defines distinct growth and resorbtion gene expression programs. Dev. Biol. 203, 24-35.[CrossRef][Medline]
Bowles, J., Schepers, G. and Koopman, P. (2000). Phylogeny of the SOX family of developmental transcription factors based on sequence and structural indicators. Dev. Biol. 227,239 -255.[CrossRef][Medline]
Britsch, S., Goerich, D. E., Riethmacher, D., Peirano, R. I.,
Rossner, M., Nave, K. A., Birchmeier, C. and Wegner, M.
(2001). The transcription factor Sox10 is a key regulator of
peripheral glial development. Genes Dev.
15, 66-78.
Chaboissier, M. C., Kobayashi, A., Vidal, V. I., Lutzkendorf, S,
van de Kant, H. J., Wegner, M., de Rooij, D. G., Behringer, R. R. and Schedl,
A. (2004). Functional analysis of Sox8 and Sox9 during sex
determination in the mouse. Development
131,1891
-1901.
Cheng, Y., Cheung, M., Abu-Elmagd, M. M., Orme, A. and Scotting, P. J. (2000). Chick sox10, a transcription factor expressed in both early neural crest cells and central nervous system. Brain Res. Dev. Brain Res. 121,233 -241.[Medline]
Cheung, M. and Briscoe, J. (2003). Neural crest
development is regulated by the transcription factor Sox9.
Development 130,5681
-5693.
Chiang, E.-L., Pai, C.-I., Wyatt, M., Yan, Y.-L., Postlethwait, J. and Chung, B.-C. (2001). Two Sox9 genes on duplicated zebrafish chromosomes: expression of similar transcription activators in distinct sites. Dev. Biol. 231,149 -163.[CrossRef][Medline]
de Crombrugghe, B., Lefebvre, V. and Nakashima, K. (2001). Regulatory mechanisms in the pathways of cartilage and bone formation. Curr. Opin. Cell Biol. 13,721 -727.[CrossRef][Medline]
Dutton, K. A., Pauliny, A., Lopes, S. S., Elworthy, S., Carney,
T. J., Rauch, J., Geisler, R., Haffter, P. and Kelsh, R. N.
(2001). Zebrafish colourless encodes sox10 and specifies
non-ectomesenchymal neural crest fates. Development
128,4113
-4125.
Essex, L. J., Mayor, R. and Sargent, M. G. (1993). Expression of Xenopus snail in mesoderm and prospective neural fold ectoderm. Dev. Dyn. 198,108 -122.[Medline]
Gammill, L. S. and Sive, H. (1997). Identification of otx2 target genes and restrictions in ectodermal competence during Xenopus cement gland formation. Development 124,471 -481.[Abstract]
Gammill, L. S. and Bronner-Fraser, M. (2003). Neural crest specification: migrating into genomics. Nat. Rev. Neurosci. 4,795 -805.[CrossRef][Medline]
Harland, R. M. (1991). In situ hybridization: an improved whole-mount method for Xenopus embryos. Methods Cell Biol. 36,685 -695.[Medline]
Heeg-Truesdell, E. and LaBonne, C. (2004). A slug, a fox, a pair of sox: transcriptional responses to neural crest inducing signals. Birth Defects Res. C Embryo Today 72,124 -139.[CrossRef][Medline]
Hensey, C. and Gautier, J. (1998). Programmed cell death during Xenopus development: a spatio-temporal analysis. Dev. Biol. 203,36 -48.[CrossRef][Medline]
Herbarth, B., Pingault, V., Bondurand, N., Kuhlbrodt, K.,
Hermans-Borgmeyer, I., Puliti, A., Lemort, N., Goossens, M. and Wegner, M.
(1998). Mutation of the Sry-related Sox10 gene in Dominant
megacolon, a mouse model for human Hirschsprung disease. Proc.
Natl. Acad. Sci. USA 95,5161
-5165.
Hong, C.-S. and Saint-Jeannet, J.-P. (2005). Sox proteins and neural crest development. Semin. Cell Dev. Biol. 16,694 -703.[CrossRef][Medline]
Honore, S. M., Aybar, M. J. and Mayor, R. (2003). Sox10 is required for the early development of the prospective neural crest in Xenopus embryos. Dev. Biol. 260,79 -96.[CrossRef][Medline]
Huang, X. and Saint-Jeannet, J.-P. (2004). Induction of the neural crest and the opportunities of life on the edge. Dev. Biol. 275,1 -11.[CrossRef][Medline]
Kellerer, S., Schreiner, S., Stolt, C. C., Scholz, S., Bosl, M.
R. and Wegner, M. (2006). Replacement of the Sox10
transcription factor by Sox8 reveals incomplete functional equivalence.
Development 133,2875
-2886.
Knecht, A. K. and Bronner-Fraser, M. (2002). Induction of the neural crest: a multigene process. Nat. Rev. Genet. 3,453 -461.[CrossRef][Medline]
Koopman, P. (2005). Sex determination: a tale of two Sox genes. Trends Genet. 21,367 -370.[CrossRef][Medline]
Kuhlbrodt, K., Herbarth, B., Sock, E., Hermans-Borgmeyer, I. and
Wegner, M. (1998). Sox10, a novel transcriptional modulator
in glial cells. J. Neurosci.
18,237
-250.
Lee, Y.-H. and Saint-Jeannet, J.-P. (2003). Sox9, a novel pancreatic marker in Xenopus. Int. J. Dev. Biol. 47,459 -462.[Medline]
Lee, Y.-H, Aoki, Y., Hong, C.-S, Saint-Germain, N., Credidio, C. and Saint-Jeannet, J.-P. (2004). Early requirement of the transcriptional activator Sox9 for neural crest specification in Xenopus. Dev. Biol. 275,93 -103.[CrossRef][Medline]
Li, M., Zhao, C., Wang, Y., Zhao, Z. and Meng, A. (2002). Zebrafish sox9b is an early neural crest marker. Dev. Genes Evol. 212,203 -206.[CrossRef][Medline]
Maka, M., Stolt, C. C. and Wegner, M. (2005). Identification of Sox8 as a modifier gene in a mouse model of Hirschsprung disease reveals underlying molecular defect. Dev. Biol. 277,155 -169.[CrossRef][Medline]
Mayor, R., Morgan, R. and Sargent, M. G. (1995). Induction of the prospective neural crest of Xenopus. Development 121,767 -777.[Abstract]
McKeown, S. J., Lee, V. M., Bronner-Fraser, M., Newgreen, D. F. and Farlie, P. G. (2005). Sox10 overexpression induces neural crest-like cells from all dorsoventral levels of the neural tube but inhibits differentiation. Dev. Dyn. 233,430 -444.[CrossRef][Medline]
Meulemans, D. and Bronner-Fraser, M. (2004). Gene-regulatory interactions in neural crest evolution and development. Dev. Cell 7,291 -299.[CrossRef][Medline]
Mori-Akiyama, Y., Akiyama, H., Rowitch, D. H. and de
Crombrugghe, B. (2003). Sox9 is required for determination of
the chondrogenic cell lineage in the cranial neural crest. Proc.
Natl. Acad. Sci. USA 100,9360
-9365.
Nieuwkoop, P. D. and Faber, J. (1956). Normal Table of Xenopus laevis (Daudin). Amsterdam: North-Holland.
Sadaghiani, B. and Thiebaud, C. H. (1987). Neural crest development in the Xenopus laevis embryo, studied by interspecific transplantation and scanning electron microscopy. Dev. Biol. 124,91 -110.[CrossRef][Medline]
Saka, Y. and Smith, J. C. (2001). Spatial and Temporal patterns of cell divivsion during early Xenopus embryogenesis. Dev. Biol. 229,307 -318.[CrossRef][Medline]
Sasai, N., Mizuseki, K. and Sasai, Y. (2001).
Requirement of FoxD3-class signaling for neural crest determination in
Xenopus. Development
128,2525
-2536.
Schepers, G. E., Bullejos, M., Hosking, B. M. and Koopman,
P. (2000). Cloning and characterisation of the Sry-related
transcription factor gene Sox8. Nucleic Acids Res.
28,1473
-1480.
Sive, H. L., Hattori, K. and Weintraub, H. (1989). Progressive determination during formation of the anteroposterior axis in Xenopus laevis. Cell 58,171 -180.[CrossRef][Medline]
Sock, E., Schmidt, K., Hermanns-Borgmeyer, I., Bosl, M. R. and
Wegner, M. (2001). Idiopathic weight reduction in mice
deficient in the high-mobility-group transcription factor Sox8.
Mol. Cell. Biol. 21,6951
-6959.
Southard-Smith, E. M., Kos, L. and Pavan, W. J. (1998). Sox10 mutation disrupts neural crest development in Dom Hirschsprung mouse model. Nat. Genet. 18, 60-64.[CrossRef][Medline]
Spokony, R. F., Aoki, Y., Saint-Germain, N., Magner-Fink, E. and Saint-Jeannet, J.-P. (2002). The transcription factor Sox9 is required for cranial neural crest development in Xenopus. Development 129,421 -432.
Stolt, C. C., Lommes, P., Friedrich, R. P. and Wegner, M.
(2004). Transcription factors Sox8 and Sox10 perform
non-equivalent roles during oligodendrocyte development despite functional
redundancy. Development
131,2349
-2358.
Tada, M., O'Reilly, M. A. and Smith, J. C. (1997). Analysis of competence and Brachyury autoinduction by use of hormone-inducible Xbra. Development 124,2225 -2234.[Abstract]
Taylor, K. M. and LaBonne, C. (2005). SoxE factors function equivalently during neural crest and inner ear development and their activity is regulated by SUMOylation. Dev. Cell 9,593 -603.[CrossRef][Medline]
Wegner, M. (1999). From head to toes: the
multiple facets of Sox proteins. Nucleic Acids Res.
27,1409
-1420.
Wegner, M. (2005). Secrets to a healthy Sox life: lessons for melanocytes. Pigment Cell Res. 63, 74-85.
Wegner, M. and Stolt, C. C. (2005). From stem cells to neurons and glia: a Soxist's view of neural development. Trends Neurosci. 28,583 -588.[CrossRef][Medline]
Wright, E., Hargrave, M. R., Christiansen, J., Cooper. L., Kun, J., Evans, T., Gangadharan, U., Greenfield, A. and Koopman, P. (1995). The Sry-related gene Sox9 is expressed during chondrogenesis in mouse embryos. Nat. Genet. 9, 15-20.[CrossRef][Medline]
Yan, Y. L., Miller, C. T., Nissen, R. M., Singer, A., Liu, D.,
Kirn, A., Draper, B., Willoughby, J., Morcos, P. A., Amsterdam, A. et al.
(2002). A zebrafish sox9 gene required for cartilage
morphogenesis. Development
129,5065
-5079.
Yan, Y. L., Willoughby, J., Liu, D., Crump, J. G., Wilson, C.,
Miller, C. T., Singer, A., Kimmel, C., Westerfield, M. and Postlethwait, J.
H. (2005). A pair of Sox: distinct and overlapping functions
of zebrafish sox9 co-orthologs in craniofacial and pectoral fin development.
Development 132,1069
-1083.
Zhao, Q., Eberspaecher, H., Lefebvre, V. and De Crombrugghe, B. (1997). Parallel expression of Sox9 and Col2a1 in cells undergoing chondrogenesis. Dev. Dyn. 209,377 -386.[CrossRef][Medline]
This article has been cited by other articles:
|
|
 |
|
  T. Sauka-Spengler and M. Bronner-Fraser Insights From a Sea Lamprey Into the Evolution of Neural Crest Gene Regulatory Network Biol. Bull., June 1, 2008; 214(3): 303 - 314. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Reiprich, C. C. Stolt, S. Schreiner, R. Parlato, and M. Wegner< |
