|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 1 February 2006
doi: 10.1242/dev.02271
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Gonda Department of Cell and Molecular Biology, House Ear Institute, 2100 West
3rd Street, Los Angeles CA 90057, USA.
2 Department of Obstetrics and Gynecology, McGill University, Montreal,
Canada.
3 Department of Pharmacology, Graduate School of Medicine, Kyoto University,
Kyoto, Japan.
* Author for correspondence (e-mail: agroves{at}hei.org)
Accepted 3 January 2006
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key words: Mouse, Otic Placode, Wnt
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
;
De Robertis and Kuroda, 2004;
Lander et al., 2002;
Mizutani et al., 2005;
Stamataki et al., 2005). In
other cases, inducing signals act over very short distances to produce an
essentially all-or-none response (Bier,
2000; Shilo,
2003). Fine-grained patterning at the cellular level can also
emerge in a cell field by cell-cell interactions such as lateral inhibition
(Artavanis-Tsakonas et al.,
1999; Lai, 2004)
or gap junctional communication (Levin,
2002). Despite the great progress in understanding these different
signaling strategies, much still remains to be learned about how they are
orchestrated in the induction and development of particular organs.
The inner ear is an increasingly well-characterized example of embryonic
induction. It derives from a simple patch of thickened ectoderm, the otic
placode, that arises next to the posterior hindbrain
(Barald and Kelley, 2004;
Brown et al., 2003;
Groves, 2005;
Kiernan et al., 2002;
Riley and Phillips, 2003;
Torres and Giraldez, 1998).
Studies in different species have suggested roles for both the hindbrain and
cranial paraxial mesoderm in otic placode induction, and whereas the relative
contribution of these two tissues to the induction process in different
species is still uncertain, it is clear that members of the fibroblast growth
factor (Fgf) family play a central and crucial role in this induction in fish,
amphibians, birds and mammals (Ladher et
al., 2000; Ladher et al.,
2005; Leger and Brand,
2002; Liu et al.,
2003; Lombardo et al.,
1998; Maroon et al.,
2002; Phillips et al.,
2001; Phillips et al.,
2004; Wright and Mansour,
2003). Fgf signaling induces the expression of a variety of
molecular markers (such as the transcription factors Pax2 and
Pax8) in presumptive placodal ectoderm before the placode becomes
morphologically distinct (Alvarez et al.,
2003; Ladher et al.,
2005; Wright and Mansour,
2003).
The induction of Pax2 in cranial ectoderm is commonly thought to
be synonymous with the induction of the otic placode. However, several lines
of evidence suggest that many Pax2+ ectodermal cells that
are initially induced by Fgf signaling will not contribute to the otic placode
or the inner ear. Fate-mapping studies in chicken show that cells lying within
the Pax2 domain can give rise to structures other than the otocyst,
such as the epidermis or epibranchial placodes
(Streit, 2002). Genetic fate
mapping of Pax2+ ectoderm using Pax2-Cre mice also shows
that many Pax2+ cells in the presumptive placodal region
ultimately give rise to epidermis and possibly to epibranchial placodes
(Ohyama and Groves, 2004b). In
light of these observations, what are the mechanisms by which a field of
Pax2+ precursor cells is sub-divided into otic placode and
epidermis?
Activation of the Wnt signaling pathway by Wnt8 family members has been
proposed to participate in otic placode induction
(Ladher et al., 2000).
However, more recent studies in zebrafish suggest that otic placode induction
can proceed in the absence of Wnt8 expression in the hindbrain,
although the otocysts of such embryos were usually of reduced size
(Phillips et al., 2004). It is
possible that Wnt signaling is not necessary for the induction of
Pax2+ precursor cells, but instead determines the size of
the otic placode by instructing these precursor cells to differentiate into
placodal tissue, rather than epidermis. In the present study, we show that the
canonical Wnt signaling pathway is activated in a subset of
Pax2+ cells during early development. Disruption of the
canonical Wnt signaling pathway in Pax2+ cells by
conditional deletion of the ß-catenin gene leads to an expansion of
cranial epidermis at the expense of the otic placode and otocyst. Conversely,
constitutive activation of the canonical Wnt signaling pathway by
stabilization of ß-catenin in Pax2+ cells causes an
expansion of the otic placode at the expense of epidermis. Our results suggest
that Wnt signaling mediates a placode-epidermis fate decision by acting
instructively on a field of Pax2+ precursors to direct
them to an otic placode fate.
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
) and
will be distributed by the Mutant Mouse Regional Resource Centers (Stock
number 010569-UNC). TCF/Lef Wnt reporter mice and the conditionally active
allele of ß-catenin (Catnblox(ex3)) have been described
elsewhere (Harada et al.,
1999; Mohamed et al.,
2004). The following mouse lines were purchased from the Jackson
Laboratory: CMV-Cre mice [BALB/c-Tg(CMV-cre)1Cgn/J], stock number 003465
(Schwenk et al., 1995);
conditional ß-cateninfloxed allele
(B6.129-Ctnnb1tm2Kem/J), stock number 004152
(Brault et al., 2001); R26R
Cre reporter mice (129S-Gt(ROSA)26Sortm1Sor/J), stock
number 00310 (Soriano, 1999);
Z/EG Cre reporter mice (B6.Cg-Tg(ACTB-Bgeo/GFP)21Lbe/J) stock number 004178
(Novak et al., 2000).
A conditional deletion of ß-catenin in Pax2+ cells
was generated by the following mating procedure. First, mice carrying a full
deletion of ß-catenin (ß-catenindel) were generated by
crossing ß-cateninfloxed mice with a CMV-Cre line
(Schwenk et al., 1995) and the
ß-catenindel line was maintained by breeding heterozygotes.
ß-catenindel mice were then crossed with Pax2-Cre mice to
generate a Pax2-Cre; ß-catenindel line. This line was then
crossed to a homozygous ß-cateninfloxed line to generate
ß-cateninfloxed/del; Pax2-Cre embryos (CKO) for analysis. To
activate ß-catenin in Pax2+ cells and their
descendants, Catnblox(ex3) mice were crossed with Pax2-Cre mice.
Genetic marking of Pax2+ cells was performed by crossing
Pax2-Cre mice with either R26R or Z/EG reporter mice as described previously
(Ohyama and Groves, 2004b). In
all cases, 3-10 of both mutant and control embryos were examined for all
markers described in the text.
Whole-mount in situ hybridization
Whole-mount in situ hybridization was performed by modifications of the
protocol of Stern and colleagues (Stern,
1998) as described previously
(Kil et al., 2005). Detailed
protocols are available upon request. Probes used in this study were
Foxi2 (Ohyama and Groves,
2004a), Lfng, Tbx1, Gbx2, Msx1 (provided by Doris Wu),
Pax2 (provided by Greg Dressler), Pax8 (provided by Meinrad
Busslinger), Krox20, Hoxb1 and Epha4 (provided by David
Wilkinson), Fgf3 (provided by Suzi Mansour), Dlx5 and
Hmx3 (provided by Thomas Lufkin) and rat Shh (provided by
Henk Roelink). A partial exon 6 fragment (0.6 kb) of mouse Wnt8a was
amplified from mouse genomic DNA with PCR primers (forward;
AGTGCCTGGTAACACCACCAC; reverse, GTCTGTGCACATTTGTG-CCTG). The PCR product was
subcloned into pGEM-T Easy (Promega) for production of in situ probes.
Immunostaining and detection of ß-galactosidase
Embryos were fixed in 4% paraformaldehyde, washed in PBS and embedded in
7.5% gelatin and 15% sucrose solution, and 10 µm frozen sections were
collected as described previously (Ohyama
and Groves, 2004a). The slides were washed with PBS at 50°C
and blocked in PBS, containing 0.1% Triton-X100 and 10% goat serum. Primary
antibodies were obtained as follows: Pax2 (Zymed), ß-galactosidase
(Promega), green fluorescent protein (Molecular Probes), ß-catenin
(Zymed, Sigma), 
-catenin and 
-catenin (BD Transduction
Laboratories), E-cadherin (Sigma), Phospho-Histone H3 (Upstate), activated
caspase 3 (R&D Systems) and ßIII tubulin (TuJ1; Covance). Alexa 488-
or 594-conjugated secondary antibodies for the appropriate subtype (Molecular
Probes) were used for detection together with DAPI (Molecular Probes) for
nuclear staining. In some images the blue DAPI staining was converted to
magenta in Adobe Photoshop for ease of viewing.
For whole-mount detection of apoptotic cells, embryos were fixed and
blocked with PBS containing 0.1% Triton-X100 and 20% goat serum.
Anti-activated caspase 3 was used for the primary antibody, together with a
horseradish peroxidase-conjugated secondary antibody (Molecular Probes). Color
reaction was performed with a DAB development kit (Vector). Detailed protocols
are available upon request. X-gal staining of the TCF/Lef reporter mice was
performed by a standard protocol (Mohamed
et al., 2004). For the immunohistochemical detection of
ß-galactosidase, dissected embryos were fixed with 4% paraformaldehyde
and processed for cryosectioning.
Normalization of proliferating cells in normal and mutant mice
Serial sections of normal and mutant embryos were stained with antibodies
to phospho-histone H3 (pH3) and ß-catenin and then stained with DAPI to
reveal cell nuclei. Images of sections were captured with a Zeiss Axiocam
digital camera and an Axiophot2 microscope. The number of pH3+
cells in a 150 µm length of otic placode from each control section was
counted and compared with pH3+ cell counts in each section taken
from an equivalent medial-lateral length of ectoderm from ß-catenin CKO
embryos. Cell counts were displayed graphically as the number of
pH3+ cells per section.
In the case of the conditionally active ß-catenin allele (cAct) where the otic placode was greatly enlarged compared with controls, the length of the apical surface of the thickened placode was measured in cAct and control embryos using Adobe Photoshop software. The number of pH3+ cells in the placode was counted in each section and the counts from cAct and control embryos were normalized per 150 µm length of placode.
|
RESULTS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). To
determine if the canonical Wnt pathway was activated in
Pax2+ precursor cells, we used a reporter transgenic mouse
line in which six TCF/Lef DNA-binding sites are coupled to a minimal promoter
and the ß-galactosidase reporter gene
(Mohamed et al., 2004). We
examined expression of the ß-galactosidase reporter in the presumptive
otic region of these mice between embryonic day (E) 8.0 and 9.5. At E8.0, no
reporter activity was detected in presumptive otic ectoderm, although this
ectoderm already expressed Pax2
(Fig. 1A). By E8.25, reporter
activity was present in the presumptive otic ectoderm, overlapping with the
most medial part of the Pax2 expression domain
(Fig. 1B). We observed strong
reporter activity in presumptive otic ectoderm at E8.5
(Fig. 1C). Double
immunostaining for ß-galactosidase and Pax2 showed that
ß-galactosidase is expressed in a medial subset of the Pax2 domain
adjacent to the neural tube, but not in more lateral Pax2+ cells
(Fig. 1C). As the invaginating
otic placode becomes morphologically distinct at E8.75, reporter activity is
seen in most regions of the otic placode, with the exception of the most
posterolateral regions (Fig.
1D). At this time, we did not observe reporter activity in
ectoderm lateral to the thickened placode. By E9.5, reporter activity is still
observed mainly in the anterior-medial region of the otic vesicle, with
activity in the posterolateral region of the otic vesicle being either weak or
negative. One possible candidate for the source of Wnt signaling is
Wnt8a, which is expressed in rhombomere 4 between E8.0 and E8.5
(Fig. 1A,B). These results
suggest that the most lateral population of Pax2+ cells
exhibit little or no activation of the canonical Wnt signaling pathway. As
this lateral population of cells is likely to give rise to cranial epidermis,
we hypothesized that Wnt signaling might direct Pax2+
cells to an otic placodal, rather than an epidermal, cell fate.
Conditional inactivation of ß-catenin in Pax2+ precursors causes an expansion of epidermis at the expense of the otic placode
We used conditional gene targeting to inactivate ß-catenin in all
Pax2+ cells by crossing a conditional allele of
ß-catenin (Brault et al.,
2001) with Pax2-Cre transgenic mice
(Ohyama and Groves, 2004b).
These mice drive Cre recombinase expression in the entire ectodermal
Pax2 domain adjacent to the hindbrain. In addition, these mice also
express Cre in the mid-hindbrain boundary and the pronephric tubules
(Fig. 2A). Pax2 is
initially expressed in a broad region of cranial ectoderm extending from
rhombomere 3 to rhombomere 6 at E8.5
(Ohyama and Groves, 2004b). It
then becomes localized to the invaginating otic placode at E8.75 and is
restricted to the ventromedial region of the otocyst at E9.5. Pax2-Cre mice
therefore drive Cre-mediated recombination in the descendants of a wide region
of cranial ectoderm, even though endogenous Pax2 expression becomes
restricted to the otocyst by E9.0-9.5
(Ohyama and Groves,
2004b).
|
),
Pax2-Cre/ß-catenin conditional knockout (CKO) embryos survived until at
least at E10.5. At E10.5, the mid-hindbrain region of CKO mice is entirely
missing, a similar result to that seen in Wnt1-Cre/ß-catenin mutant mice
(Brault et al., 2001). The
size of the otic vesicle was significantly reduced to less than 20% of its
normal size in CKO embryos (Fig.
2A). Both phenotypes were consistently observed in all embryos
examined, suggesting a high degree of penetrance. We verified that the
hindbrains of ß-catenin CKO mice were patterned normally by examining
Krox20 expression as a marker of rhombomeres 3 and 5
(Fig. 2B) and Fgf3
(rhombomeres 5 and 6), Epha4 (rhombomeres 3 and 5) and Hoxb1
(rhombomere 4; see Fig. S1A in the supplementary material). To determine
whether the small otocyst was due to a reduction in the size of the otic
placode, we examined expression of Pax2, Pax8 and Dlx5 at
E8.5. All three markers were strongly downregulated in CKO embryos compared
with controls (Fig. 2B). To
test whether the loss of otic tissue was accompanied by an expansion of
epidermal tissue, we examined expression of Foxi2, a forkhead
transcription factor expressed in cranial ectoderm immediately surrounding,
but excluding the otic placode (Ohyama and
Groves, 2004a). Foxi2 thus gives an estimation of the
size of both the Foxi2 domain and also of the size of the otic
placode, which is Foxi2-. CKO embryos had a significantly
expanded region of Foxi2+ epidermal cells, and a
correspondingly reduced domain of Foxi2- otic placode
cells (Fig. 2B).
Conditional inactivation of ß-catenin alters both cell proliferation and survival at later stages in the otic placode
Our results suggested the expansion of Foxi2+ ectoderm
in Pax2-Cre/ß-catenin conditional mutants occurred at the expense of otic
placode tissue. However, it is also possible that the reduction in the size of
the otic placode might be due to a decrease in proliferation or survival of
Pax2+cells. We assayed cell proliferation and cell
survival with antibodies to the M-phase marker phospho-histone H3 (pH3) and
activated caspase 3 as a marker of apoptosis in normal and CKO embryos between
E8.5 and E9.0. We only observed apoptotic cells in the otic region of CKO
embryos after E8.5. By this time, the otic placode in CKO embryos is already
greatly reduced in size relative to controls, as revealed by the
downregulation of Pax2, Pax8 and Dlx5, and the expansion of
Foxi2 (Fig. 2B). After
E8.5, the majority of apoptotic cells occurred in unthickened epidermis,
rather than thickened placodal epithelium, on the basis of morphology
(Fig. 3A) and by
co-localization of activated caspase-3-expressing cells with the epidermal
marker, Foxi2. Thus, although increased cell death is observed in CKO
embryos, it occurs after the initial downregulation of placode markers and
predominantly in unthickened, Foxi2+ epidermis and as such
is unlikely to account for the reduction in the size of the otic placode.
|
Cadherin-mediated cell adhesion is altered in the otocyst, but not in early Pax2+ precursors
ß-Catenin is not only a key mediator of the canonical Wnt signaling
pathway, but also one of the main components of cadherin-mediated adhesion
complexes (Bienz, 2005;
Harris and Peifer, 2005;
Nelson and Nusse, 2004). To
determine whether the loss of otocyst tissue in ß-catenin CKO embryos was
due to a failure in cadherin-mediated cell adhesion, we analyzed E-cadherin
adhesion complexes in CKO embryos. Despite the fact that Pax2-Cre mice delete
ß-catenin from E8.0, we still observed low levels of membrane-localized
ß-catenin protein in otic-level ectoderm at E8.75
(Fig. 4A). This probably
reflects the fact that ß-catenin preferentially associates with adherens
junctions when present in limiting amounts
(Hinck et al., 1994) and
suggests that at least 12 hours is required to clear all ß-catenin
protein from membrane junction complexes. We did not observe significant
differences in the levels of either E-cadherin, -catenin or
-catenin at E8.75 (Fig.
4A). These results suggest that the loss of otic markers and the
concomitant expansion of epidermal markers seen in CKO mice at E8.5 is
unlikely to be due to changes in cell adhesion we observe as a result of
deleting ß-catenin.
When we examined ß-catenin CKO embryos at E9.0, we noticed that the
small otic cup remaining at this time consisted of a mixture of epithelial
cells strongly expressing ß-catenin protein and some expressing no
ß-catenin protein at all (Fig.
4A). We have previously noted that a small number of
Pax2+ cells fail to undergo recombination in Pax2-Cre
transgenic mice (Ohyama and Groves,
2004b), and believe this is responsible for the residual number of
ß-catenin+ otic cells in E9.0 CKO embryos. The small number of
remaining otocyst cells in which ß-catenin protein was absent contained
significantly lower levels of E-cadherin and -catenin compared with
controls, but normal levels of -catenin
(Fig. 4A, lower panels). By
E10.5, the residual otocyst in CKO mice consists of a series of small cysts
fused to one another. The cysts tended to consist entirely of either
ß-catenin+ or ß-catenin- cells
(Fig. 4B). The
ß-catenin- cysts contained both E-cadherin and -catenin
localized to the cell membrane. As -catenin has been reported to
localize to adherens junctions in the absence of ß-catenin
(Haegel et al., 1995), we
believe that it is responsible for maintaining epithelial integrity in cells
lacking ß-catenin. We also observed a small number of Neurod1+
and TuJ1+ ß-catenin- neurons delaminating from the
small remaining otocysts of CKO embryos
(Fig. 4C), suggesting that both
otocyst formation and neurogenesis could proceed in the very small numbers of
ß-catenin- cells that gave rise to the CKO otocyst. We also
observed a reduction in the size of the geniculate and petrosal placodes after
E9.0 (see Fig. S2 in the supplementary material).
|
). This eliminates all serine and threonine residues whose
phosphorylation by the APC/axin/GSK3 complex normally targets ß-catenin
for degradation. As a result, the mutant form of ß-catenin becomes
stabilized and acts in a dominant active fashion
(Harada et al., 1999). We
crossed these mice with Pax2-Cre transgenic mice to constitutively activate
the canonical Wnt pathway in all Pax2+ precursor
cells. The otic placode of conditionally activated (cAct) ß-catenin mutant embryos formed at the level of rhombomeres 4 and 5, and patterning of the posterior hindbrain was normal based on Krox20, Fgf3, Epha4 and Hoxb expression (see Fig. S1B in the supplementary material). By E8.75, the otic placode expanded laterally and ventrally into the cranial ectoderm, as assayed by Dlx5, Pax8 and Pax2 expression (Fig. 5A). Significantly, expansion of the otic placode in cAct embryos was accompanied by a concomitant loss of Foxi2+ epidermal cells (Fig. 5A). Immunostaining of cAct embryos at E8.75 showed high levels of ß-catenin in the invaginating placodal epithelium. By E9.5, the greatly expanded region of thickened placodal epithelium extended over much of the lateral surface of the embryo, extending ventrally to the level of the ventral pharynx and occasionally invaginating in ectopic locations (Fig. 5B). This epithelium was verified to be otic in character by its expression of Dlx5, Gbx2 and Msx1 (Fig. 6A). The huge expansion of placodal epithelium appeared not to be due to an increase in cell proliferation, as we could detect no significant increase in pH3 staining in the epithelium between E8.75 and E9.5 (Fig. 5B,C). Together, these results suggest that activation of the canonical Wnt signaling pathway in Pax2+ precursors forces them to differentiate into otic placode cells and prevents them from differentiating into epidermis.
|
;
Riccomagno et al., 2005;
Wu et al., 1998). To test
whether this activity was due to Wnt signaling, we analyzed the expression of
a battery of regional markers of the otocyst in control and cAct embryos. Two
markers of the dorsal otocyst, Dlx5 and Gbx2, and a marker
of the future endolymphatic duct, Msx1, were expressed throughout the
thickened placodal epithelium in E9.5 cAct embryos
(Fig. 6A). Dlx5 and
Msx1 were expressed at lower levels in the most deeply invaginated
part of the placode, which tended to lay closest to the ventral midline
(Fig. 6A). Expression of other
dorsal otocyst markers such as Hmx3 did not appear to be expanded in
cAct embryos (Fig. 6B). By
E9.5, Pax2 and Pax8 are normally restricted to ventromedial
and dorsomedial regions of the otocyst, respectively. We saw virtually no
Pax2 expression in cAct embryos and Pax8 expression was
expressed in an expanded region of the invaginating placode
(Fig. 6B). Markers of
neurogenesis in the ventral otocyst such as lunatic fringe, Neurod1
(Fig. 6C) and Ngn1
(not shown) were absent in cAct embryos, and the posteroventral marker
Tbx1 was also entirely absent in mutant embryos. Taken together,
these results suggest that in addition to directing Pax2+
precursor cells to an otic placode fate, Wnt signaling also promotes dorsal
cell fates within the otic epithelium. |
DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Wnt signals as candidates to pattern Pax2+ precursor cells
We monitored activation of the canonical Wnt signaling pathway in
Pax2+ precursor cells using a TCF/Lef-lacZ
transgenic reporter (Mohamed et al.,
2004). We observed activation of the reporter in a subset of
Pax2+ cells in cranial ectoderm from E8.25 onwards, with
cells closest to the neural tube displaying high levels of reporter activity
and more lateral ectoderm displaying little or no reporter activity. This
pattern of activation suggested that the source of Wnt signaling emanated from
the dorsal midline - most likely the neural tube - and declined in more
lateral and ventral ectoderm. Significantly, expression of the TCF/Lef
reporter at E8.25 occurs after the onset of Pax2 expression in the
presumptive placodal ectoderm (Fig.
1A,B), suggesting that Wnt signaling is unlikely to be involved in
the initial induction of the Pax2 cell field. We have only been able
to reproducibly detect nuclear ß-catenin expression at later stages in
the inner ear (T.O., O.A.M., M.M.T., D.D. and A.K.G., unpublished), suggesting
that very low levels of nuclear ß-catenin drive TCF/Lef reporter
expression at the otic placode stage. This may explain why reporter activity
can be observed in the presumptive placode in our reporter mice which carry
six TCF/Lef-binding sites, but not in mice with only three sites
(DasGupta and Fuchs, 1999;
Dorsky et al., 2002).
|
; Hume and Dodd,
1993; Kil et al.,
2005; Niederreither et al.,
2000), and in rhombomeres 5 and 6 in zebrafish
(Lekven et al., 2001). We show
that Wnt8a is expressed in mouse rhombomere 4 between E8.0 and E8.5
(Fig. 1A,B), after which time
it disappears, to be replaced by Wnt1 and Wnt3a in the
dorsal hindbrain (Parr et al.,
1993). We note that the most posterior regions of the otic placode
and otocyst - regions that lie farthest from rhombomere 4 - expressed the
lowest levels of ß-galactosidase reporter
(Fig. 1). However, in the
absence of gene expression data for other Wnt family members and
loss-of-function data for Wnt8a in mice, the case for a
Wnt8a signaling source in rhombomere 4 must still be considered
circumstantial.
Wnt signaling mediates a cell fate decision between otic placode and epidermis
Fate-mapping experiments suggest that the earliest events in inner ear
development involve the induction of a broad field of
Pax2+ cells, some of which will maintain Pax2
expression and form the otic placode, and others which will differentiate as
epidermis. In the present study, we provide evidence from loss- and
gain-of-function mutations of ß-catenin that activation of the canonical
Wnt signaling pathway in the initial Pax2+ field causes
cells to differentiate into otic placode tissue, while
Pax2+ cells that are not exposed to Wnt signaling
differentiate as epidermis. In E8.5 ß-catenin CKO embryos, expression of
the early otic markers Pax8 and Dlx5 is greatly reduced,
while Pax2 - which by E8.5 is localized to the otic placode - is also
reduced compared with controls. We have previously shown that Foxi2
labels a region of epidermal cells adjacent to the otic placode
(Ohyama and Groves, 2004a). In
ß-catenin CKO embryos, Foxi2 expression expands to occupy the
territory that would normally form the otic placode. Conversely, forced
activation of ß-catenin in the initial Pax2+ field
causes a great expansion of thickened placodal epithelium, and expansion of
Pax8, Dlx5 and other ear markers, such as Gbx2 and
Msx1, as well as Pax2 itself. This expansion of otic placode
territory is accompanied by a corresponding loss of epidermal Foxi2
expression. Our results thus support the idea that Wnt signaling is mediating
a cell fate decision in Pax2+ cells between otic placode
and epidermis. Most studies of otic placode induction - including those from
our own laboratory - have tended to view Pax2 as an exclusive marker
of the otic placode. Our present results now reinforce the notion from fate
mapping and gene expression studies
(Ohyama and Groves, 2004b;
Streit, 2002) that induction
of Pax2 in cranial ectoderm and formation of the otic placode are
actually experimentally separable events, and that Pax2 should more
properly be thought of as initially marking a `pre-otic' pool of both placodal
and epidermal progenitor cells.
|
;
Gerchman et al., 1995;
Moro-Balbas et al., 2000;
Visconti and Hilfer, 2002), it
is likely that physical constraints prevent the greatly expanded placode of
cAct embryos from invaginating to form an enlarged otic vesicle.
Wnt and Fgf signaling in otic placode induction
Ladher and colleagues proposed a scheme for induction of the chick inner
ear whereby Fgf19 and Wnt8c act synergistically to induce
Pax2 and other markers in unspecified ectoderm
(Ladher et al., 2000). By
contrast, Riley and colleagues have questioned the role of Wnt signaling in
zebrafish otic placode formation in a study where overexpression of the
secreted Wnt antagonist dickkopf 1 (Dkk1) failed to block otic
placode induction (Phillips et al.,
2004). It is possible, however, that such Dkk1
experiments do not represent a complete loss of Wnt function. In the present
study we have attempted to overcome these problems, and problems of lethality
associated with a null mutation of ß-catenin, by conditionally
inactivating ß-catenin only in Pax2-expressing cells.
|
;
Hashimoto et al., 2002;
Holnthoner et al., 2002;
Israsena et al., 2004;
Mansukhani et al., 2005). A
simple model summarizing our results is shown in
Fig. 7A. An initial field of
Pax2+ cells - induced by Fgf signaling - receives a source
of Wnt signaling from the midline. Above a certain threshold of Wnt signaling,
Pax2+ cells differentiate into the otic placode and its
derivatives. Below this threshold, cells either differentiate into epidermis
or, in the presence of additional inducing signals, into epibranchial placodes
(Begbie et al., 2002;
Begbie et al., 1999;
Begbie and Graham, 2001). In
ß-catenin CKO embryos, the absence of Wnt signaling causes loss of early
otic markers such as Pax8 and Dlx5, and an expansion of
epidermal markers such as Foxi2. Conversely, activation of the Wnt
signaling pathway in ß-catenin cAct embryos causes an expansion of early
otic markers, and concomitant loss of epidermal markers. In support of our
model, morpholino knockdown of Wnt8 mRNA in zebrafish, or inhibition
of Wnt signaling with Dkk1 results in greatly reduced otocysts
(Phillips et al., 2004),
whereas exposure of Xenopus embryos to lithium chloride [which
activates canonical Wnt signaling by inhibiting GSK-3ß
(Klein and Melton, 1996;
Stambolic et al., 1996)] leads
to multiple expanded and interconnected otic vesicles
(Gutknecht and Fritzsch,
1990).
The role of Wnt signaling in specifying dorsoventral polarity of the inner ear
The work of Fekete, Wu and others has clearly shown that the developing ear
becomes patterned in all three embryonic axes shortly after its formation
(reviewed by Brigande et al.,
2000; Cantos et al.,
2000; Fekete,
1996; Fekete and Wu,
2002). The signals that specify the dorsoventral, mediolateral and
anteroposterior axes are beginning to be understood - for example, signals
from the ventral midline such as sonic hedgehog (Shh) are required to specify
ventral fates in the otocyst (Riccomagno
et al., 2002). More recently, Riccomagno and colleagues have shown
Wnt1 and/or Wnt3a signaling from the dorsal neural tube acts to specify dorsal
otocyst fates, and that a balance of opposing Wnt and Shh signals is required
for correct dorsoventral otocyst polarity
(Riccomagno et al., 2005).
Our results confirm aspects of these previously published studies. We find that activation of the canonical Wnt signaling pathway in cAct embryos causes a large expansion of dorsal otocyst markers at the expense of ventral markers (Fig. 6). We also show that signals from the ventral midline such as Shh are capable of counteracting Wnt signaling in at least some cases: for example, while expression of Dlx5 and Msx1 is seen throughout the placode of cAct embryos, these genes are expressed at their lowest levels in regions of the placode closest to the ventral midline (Fig. 6A, left and right panels). By contrast, Gbx2 expression seemed unaffected by proximity to the midline (Fig. 6A, center panel). We have confirmed that Shh was still expressed in cAct embryos, and as such is a good candidate to downregulate Msx1 and Dlx5 in ventral cAct otic tissue (see Fig. S3 in the supplementary material). Our results also confirm the observation of Riccomagno and colleagues that some dorsally expressed genes such as Hmx3 appear to be refractory to changes in Wnt signaling (Fig. 6B), suggesting that some aspects of dorsal identity in the otocyst are regulated by Wnt-independent signals.
In Fig. 7B, we describe a
revised model of otic placode induction, in which Fgf signaling first
establishes a field of `pre-otic' Pax2+ cells. We suggest
that subsequent Wnt signaling not only instructs Pax2+
precursors to an otic placode fate, but also specifies dorsal otic identity in
these cells. As the placode invaginates, the most ventral regions of otic
epithelium is brought close to the ventral midline, exposing it to
ventralizing signals such as Shh. Cells that do not receive Shh signals - even
those at the most lateral edge of the otic placode - continue to express
dorsal fates, and upon closure of the otic pit, these most lateral cells will
contribute to the dorsal otocyst. It is interesting to speculate in this
regard that Wnt signaling may be required continuously for the correct
development of the dorsal structures. For example, Fekete and colleagues have
shown that ectopic activation of ß-catenin in the ventral otocyst can
ultimately give rise to vestibular hair cells within the cochlea
(Stevens et al., 2003).
The processes that specify the size of a mature organ coordinate inductive
interactions with cell division and cell death (e.g.
Conlon and Raff, 1999;
Day and Lawrence, 2000;
Jacobson et al., 1997;
Johnston and Gallant, 2002;
Kenyon et al., 2003). In the
present study, we show that Wnt signaling subdivides a field of
Pax2-expressing cells into otic placode and epidermal derivatives,
and that by modulating Wnt signaling, we are able to increase the size of one
derivative at the expense of the other. It is possible that the strength and
range of Wnt signaling acts to specify the particular size of the otic placode
with respect to adjacent ectoderm in different species.
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/133/5/865/DC1
|
REFERENCES |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Alvarez, Y., Alonso, M. T., Vendrell, V., Zelarayan, L. C.,
Chamero, P., Theil, T., Bosl, M. R., Kato, S., Maconochie, M., Riethmacher, D.
et al. (2003). Requirements for FGF3 and FGF10 during inner
ear formation. Development
130,6329
-6338.
Artavanis-Tsakonas, S., Rand, M. D. and Lake, R. J.
(1999). Notch signaling: cell fate control and signal integration
in development. Science
284,770
-776.
Barald, K. F. and Kelley, M. W. (2004). From
placode to polarization: new tunes in inner ear development.
Development 131,4119
-4130.
Begbie, J. and Graham, A. (2001). Integration
between the epibranchial placodes and the hindbrain.
Science 294,595
-598.
Begbie, J., Brunet, J. F., Rubenstein, J. L. and Graham, A. (1999). Induction of the epibranchial placodes. Development 126,895 -902.[Abstract]
Begbie, J., Ballivet, M. and Graham, A. (2002). Early steps in the production of sensory neurons by the neurogenic placodes. Mol. Cell Neurosci. 21,502 -511.[CrossRef][Medline]
Bienz, M. (2005). beta-Catenin: a pivot between cell adhesion and Wnt signalling. Curr. Biol. 15,R64 -R67.[CrossRef][Medline]
Bier, E. (2000). Drawing lines in the Drosophila wing: initiation of wing vein development. Curr. Opin. Genet. Dev. 10,393 -398.[CrossRef][Medline]
Bok, J., Bronner-Fraser, M. and Wu, D. K.
(2005). Role of the hindbrain in dorsoventral but not
anteroposterior axial specification of the inner ear.
Development 132,2115
-2124.
Bouillet, P., Oulad-Abdelghani, M., Ward, S. J., Bronner, S., Chambon, P. and Dolle, P. (1996). A new mouse member of the Wnt gene family, mWnt-8, is expressed during early embryogenesis and is ectopically induced by retinoic acid. Mech. Dev. 58,141 -152.[CrossRef][Medline]
Brault, V., Moore, R., Kutsch, S., Ishibashi, M., Rowitch, D. H., McMahon, A. P., Sommer, L., Boussadia, O. and Kemler, R. (2001). Inactivation of the beta-catenin gene by Wnt1-Cre-mediated deletion results in dramatic brain malformation and failure of craniofacial development. Development 128,1253 -1264.[Abstract]
Brigande, J. V., Kiernan, A. E., Gao, X., Iten, L. E. and
Fekete, D. M. (2000). Molecular genetics of pattern formation
in the inner ear: do compartment boundaries play a role? Proc.
Natl. Acad. Sci. USA 97,11700
-11706.
Briscoe, J., Sussel, L., Serup, P., Hartigan-O'Connor, D., Jessell, T. M., Rubenstein, J. L. and Ericson, J. (1999). Homeobox gene Nkx2.2 and specification of neuronal identity by graded Sonic hedgehog signalling. Nature 398,622 -627.[CrossRef][Medline]
Brown, J. W., Beck-Jefferson, E. and Hilfer, S. R. (1998). A role for neural cell adhesion molecule in the formation of the avian inner ear. Dev. Dyn. 213,359 -369.[CrossRef][Medline]
Brown, S. T., Martin, K. and Groves, A. K. (2003). Molecular basis of inner ear induction. Curr. Top. Dev. Biol. 57,115 -149.[Medline]
Cantos, R., Cole, L. K., Acampora, D., Simeone, A. and Wu, D.
K. (2000). Patterning of the mammalian cochlea.
Proc. Natl. Acad. Sci. USA
97,11707
-11713.
Conlon, I. and Raff, M. (1999). Size control in animal development. Cell 96,235 -244.[CrossRef][Medline]
Dailey, L., Ambrosetti, D., Mansukhani, A. and Basilico, C. (2005). Mechanisms underlying differential responses to FGF signaling. Cytokine Growth Factor Rev. 16,233 -247.[CrossRef][Medline]
DasGupta, R. and Fuchs, E. (1999). Multiple roles for activated LEF/TCF transcription complexes during hair follicle development and differentiation. Development 126,4557 -4568.[Abstract]
Day, S. J. and Lawrence, P. A. (2000). Measuring dimensions: the regulation of size and shape. Development 127,2977 -2987.[Abstract]
De Robertis, E. M. and Kuroda, H. (2004). Dorsal-ventral patterning and neural induction in Xenopus embryos. Annu. Rev. Cell Dev. Biol. 20,285 -308.[CrossRef][Medline]
Dorsky, R. I., Sheldahl, L. C. and Moon, R. T. (2002). A transgenic Lef1/beta-catenin-dependent reporter is expressed in spatially restricted domains throughout zebrafish development. Dev. Biol. 241,229 -237.[CrossRef][Medline]
Fekete, D. M. (1996). Cell fate specification in the inner ear. Curr. Opin. Neurobiol. 6, 533-541.[CrossRef][Medline]
Fekete, D. M. and Wu, D. K. (2002). Revisiting cell fate specification in the inner ear. Curr. Opin. Neurobiol. 12,35 -42.[CrossRef][Medline]
Gerchman, E., Hilfer, S. R. and Brown, J. W. (1995). Involvement of extracellular matrix in the formation of the inner ear. Dev. Dyn. 202,421 -432.[Medline]
Groves, A. K. (2005). The induction of the otic placode. In Development of the Ear (ed. A. N. Popper M. W. Kelley and D. K. Wu). New York: Springer-Verlag (in press).
Gutknecht, D. and Fritzsch, B. (1990). Lithium can transform ear placodes of Xenopus into multiple otic vesicles connected by tubes. Naturwissenschaften 77,235 -237.[CrossRef][Medline]
Haegel, H., Larue, L., Ohsugi, M., Fedorov, L., Herrenknecht, K. and Kemler, R. (1995). Lack of beta-catenin affects mouse development at gastrulation. Development 121,3529 -3537.[Abstract]
Harada, N., Tamai, Y., Ishikawa, T., Sauer, B., Takaku, K., Oshima, M. and Taketo, M. M. (1999). Intestinal polyposis in mice with a dominant stable mutation of the beta-catenin gene. EMBO J. 18,5931 -5942.[CrossRef][Medline]
Harris, T. J. and Peifer, M. (2005). Decisions, decisions: beta-catenin chooses between adhesion and transcription. Trends Cell Biol. 15,234 -237.[CrossRef][Medline]
Hashimoto, M., Sagara, Y., Langford, D., Everall, I. P.,
Mallory, M., Everson, A., Digicaylioglu, M. and Masliah, E.
(2002). Fibroblast growth factor 1 regulates signaling via the
glycogen synthase kinase-3beta pathway. Implications for neuroprotection.
J. Biol. Chem. 277,32985
-32991.
Hinck, L., Nathke, I. S., Papkoff, J. and Nelson, W. J.
(1994). Dynamics of cadherin/catenin complex formation: novel
protein interactions and pathways of complex assembly. J. Cell
Biol. 125,1327
-1340.
Holnthoner, W., Pillinger, M., Groger, M., Wolff, K., Ashton, A.
W., Albanese, C., Neumeister, P., Pestell, R. G. and Petzelbauer, P.
(2002). Fibroblast growth factor-2 induces Lef/Tcf-dependent
transcription in human endothelial cells. J. Biol.
Chem. 277,45847
-45853.
Hume, C. R. and Dodd, J. (1993). Cwnt-8C: a novel Wnt gene with a potential role in primitive streak formation and hindbrain organization. Development 119,1147 -1160.[Abstract]
Israsena, N., Hu, M., Fu, W., Kan, L. and Kessler, J. A. (2004). The presence of FGF2 signaling determines whether beta-catenin exerts effects on proliferation or neuronal differentiation of neural stem cells. Dev. Biol. 268,220 -231.[CrossRef][Medline]
Jacobson, M. D., Weil, M. and Raff, M. C. (1997). Programmed cell death in animal development. Cell 88,347 -354.[CrossRef][Medline]
Johnston, L. A. and Gallant, P. (2002). Control of growth and organ size in Drosophila. BioEssays 24, 54-64.[CrossRef][Medline]
Kenyon, K. L., Ranade, S. S., Curtiss, J., Mlodzik, M. and Pignoni, F. (2003). Coordinating proliferation and tissue specification to promote regional identity in the Drosophila head. Dev. Cell 5,403 -414.[CrossRef][Medline]
Kiernan, A. E., Steel, K. P. and Fekete, D. M. (2002). Development of the mouse inner ear. In Mouse Development: Patterning, Morphogenesis and Organogenesis (ed. J. Rossant and P. L. Tam), pp. 539-566. San Diego, CA: Academic Press.
Kil, S. H., Streit, A., Brown, S. T., Agrawal, N., Collazo, A., Zile, M. H. and Groves, A. K. (2005). Distinct roles for hindbrain and paraxial mesoderm in the induction and patterning of the inner ear revealed by a study of vitamin-A-deficient quail. Dev. Biol. 285,252 -271.[CrossRef][Medline]
Klein, P. S. and Melton, D. A. (1996). A
molecular mechanism for the effect of lithium on development. Proc.
Natl. Acad. Sci. USA 93,8455
-8459.
Ladher, R. K., Anakwe, K. U., Gurney, A. L., Schoenwolf, G. C.
and Francis-West, P. H. (2000). Identification of synergistic
signals initiating inner ear development. Science
290,1965
-1967.
Ladher, R. K., Wright, T. J., Moon, A. M., Mansour, S. L. and
Schoenwolf, G. C. (2005). FGF8 initiates inner ear induction
in chick and mouse. Genes Dev.
19,603
-613.
Lai, E. C. (2004). Notch signaling: control of
cell communication and cell fate. Development
131,965
-973.
Lander, A. D., Nie, Q. and Wan, F. Y. (2002). Do morphogen gradients arise by diffusion? Dev. Cell 2, 785-796.[CrossRef][Medline]
Leger, S. and Brand, M. (2002). Fgf8 and Fgf3 are required for zebrafish ear placode induction, maintenance and inner ear patterning. Mech. Dev. 119,91 -108.[CrossRef][Medline]
Lekven, A. C., Thorpe, C. J., Waxman, J. S. and Moon, R. T. (2001). Zebrafish wnt8 encodes two wnt8 proteins on a bicistronic transcript and is required for mesoderm and neurectoderm patterning. Dev. Cell 1,103 -114.[CrossRef][Medline]
Levin, M. (2002). Isolation and community: a review of the role of gap-junctional communication in embryonic patterning. J. Membr. Biol. 185,177 -192.[CrossRef][Medline]
Liu, D., Chu, H., Maves, L., Yan, Y. L., Morcos, P. A.,
Postlethwait, J. H. and Westerfield, M. (2003). Fgf3 and Fgf8
dependent and independent transcription factors are required for otic placode
specification. Development
130,2213
-2224.
Logan, C. Y. and Nusse, R. (2004). The Wnt signaling pathway in development and disease. Annu. Rev. Cell Dev. Biol. 20,781 -810.[CrossRef][Medline]
Lombardo, A., Isaacs, H. V. and Slack, J. M. (1998). Expression and functions of FGF-3 in Xenopus development. Int. J. Dev. Biol. 42,1101 -1107.[Medline]
Mansukhani, A., Ambrosetti, D., Holmes, G., Cornivelli, L. and
Basilico, C. (2005). Sox2 induction by FGF and FGFR2
activating mutations inhibits Wnt signaling and osteoblast differentiation.
J. Cell Biol. 168,1065
-1076.
Maroon, H., Walshe, J., Mahmood, R., Kiefer, P., Dickson, C. and
Mason, I. (2002). Fgf3 and Fgf8 are required together for
formation of the otic placode and vesicle. Development
129,2099
-2108.
Mizutani, C. M., Nie, Q., Wan, F. Y., Zhang, Y. T., Vilmos, P., Sousa-Neves, R., Bier, E., Marsh, J. L. and Lander, A. D. (2005). Formation of the BMP activity gradient in the Drosophila embryo. Dev. Cell 8,915 -924.[CrossRef][Medline]
Mohamed, O. A., Clarke, H. J. and Dufort, D. (2004). Beta-catenin signaling marks the prospective site of primitive streak formation in the mouse embryo. Dev. Dyn. 231,416 -424.[CrossRef][Medline]
Moro-Balbas, J. A., Gato, A., Alonso, M. I., Martin, P. and de la Mano, A. (2000). Basal lamina heparan sulphate proteoglycan is involved in otic placode invagination in chick embryos. Anat. Embryol. (Berl.) 202,333 -343.[CrossRef]
