|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 1 March 2006
doi: 10.1242/dev.02295
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Biology, University of Pennsylvania, Philadelphia, PA 19104,
USA.
2 Department of Developmental Biology, Stanford University School of Medicine,
Stanford, CA 94305, USA.
Author for correspondence (e-mail:
eweinber{at}sas.upenn.edu)
Accepted 23 January 2006
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key words: ß-Catenin, Axis formation, Neural induction, Dorsoventral patterning, Anteroposterior patterning, Organizer, Zebrafish, ctnnb1, ctnnb2
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
; Sokol,
1999; Tao et al.,
2005; Schier and Talbot,
2005) and also, somewhat later in development, in the
posteriorizing and ventralizing signals that derive from more lateral and
ventral embryonic regions (Erter et al.,
2001; Lekven et al.,
2001). Indeed, a GFP reporter assay for ß-catenin-responsive
gene activation in the zebrafish reveals Wnt signaling activity in a
localized, presumably dorsal, domain at dome stage, and in both dorsal and
ventrolateral discrete domains at shield stage
(Dorsky et al., 2002). These
two phases of Wnt signaling have been considered (e.g.
Kim et al., 2002;
Momoi et al., 2003) as
components of sequential activator and transformer signals that fit
Nieuwkoop's two signal model of neural induction and patterning
(Nieuwkoop et al., 1952;
Nieuwkoop and Nitgevecht,
1954).
Wnt signaling mediated by the transcriptional effector ß-catenin plays
an essential role in axis formation and neural induction. A functional
ß-catenin gene is essential for formation of the Nieuwkoop center and
Spemann organizer in amphibians (Heasman
et al., 1994; Wylie et al.,
1996; Heasman, 2000) and for gastrulation and normal axis
formation in the mouse (Haegel et al., 1995;
Huelsken et al., 2000).
Accumulation of nuclear ß-catenin is first observed on the dorsal side of
pregastrula Xenopus (Schneider et
al., 1996; Larabell et al.,
1997; Rowning et al.,
1997) and zebrafish (Schneider
et al., 1996; Kelly et al.,
2000; Dougan et al.,
2003) embryos, consistent with the key role of ß-catenin in
initiating the activation of dorsalizing genes.
In zebrafish embryos bred from females homozygous for ichabod, a
spontaneous maternal effect mutation resulting in severe ventralization,
ß-catenin fails to localize to dorsal yolk syncytial layer (YSL) and
blastomere nuclei (Kelly et al.,
2000). RNA injection experiments showed that Wnt pathway
components upstream of ß-catenin failed to rescue these embryos, but RNAs
for ß-catenin and for the downstream nodal-related factor Squint
(Znr2/Ndr1) and homeodomain factor Bozozok (Dharma/Nieuwkoid) can rescue the
embryos to wild-type phenotype (Kelly et
al., 2000). These results indicated that failure to regulate
ß-catenin properly in the zebrafish embryo results in loss of dorsal
axial structures.
The Wnt pathway also promotes posterior and ventral fates and inhibits
formation of anterior neural tissue. wnt8, expressed in the
ventrolateral germ ring (Kelly et al.,
1995b), is required for formation of ventrolateral and posterior
mesoderm and spinal cord and posterior brain
(Lekven et al., 2001;
Erter et al., 2001;
Momoi et al., 2003;
Ramel and Lekven, 2004).
Similarly, Xenopus wnt8 is expressed in the ventrolateral marginal
zone (and in a wider vegetal region)
(Christian et al., 1991;
Smith and Harland, 1991;
Christian and Moon, 1993) and
may have a similar posteriorizing role
(Christian and Moon, 1993;
Hoppler et al., 1996; Fredieu
et al., 1997). Ventralizing and posteriorizing Wnt signals also appear to be
dependent on ß-catenin (Dorsky et al.,
2002; Weidinger et al.,
2005) and thus, may be impaired in embryos with ß-catenin
deficiencies.
We report here that the zebrafish genome contains a second ß-catenin gene, ß-catenin-2 (ctnnb2 - Zebrafish Information Network). Considering that both the formation of the organizer and the somewhat later posteriorizing and ventralizing effects of Wnt signaling are both mediated by ß-catenin, it was of interest to explore the degree of redundancy of function of the two ß-catenins in this organism. Moreover, we report that ß-catenin-2 maps close to the ichabod mutation and that maternal expression of ß-catenin-2 is impaired in ichabod mutant embryos, and we provide evidence that ß-catenin-2 is the sole ß-catenin gene required for formation of the dorsal organizer in the zebrafish. When only ß-catenin-1 (ctnnb1 - Zebrafish Information Network) function was inhibited, we observed no early patterning defects, indicating that this factor was not solely required for Wnt signaling activities that control the extent and nature of posterior and ventral tissue formation. Inhibiting the expression of both ß-catenin genes, however, resulted in an unexpected phenotype in which neurectoderm of both anterior and posterior identity develop with at least some appropriate anteroposterior patterning. Thus, the two ß-catenin genes normally act with functional redundancy to restrict formation of neurectoderm. In the absence of both ß-catenin-1 and ß-catenin-2 function, the embryo fails to form a recognizable organizer, but as a consequence of the loss of repressive effects on neurectoderm formation, the embryo is still capable of expressing both posterior and anterior neural makers.
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
).
ichabod p1 embryos were obtained by breeding homozygous
ichabod females with brass males. Only ichabod
females that reproducibly gave severely ventralized phenotypes were used in
this work. Throughout this report, we will use the expression
`ichabod embryos' to mean those embryos derived from homozygous
ichabod mothers.
DNA constructs and phylogenetic analysis
Sequence searches of the zebrafish EST database identified ESTs that
defined fragments of a second ß-catenin gene in zebrafish, which we term
ß-catenin-2. Sequences from these ESTs were used to identify a
PCR-based polymorphism (primers: 5'-CCTACCTGGATTCAGGGATTC-3' and
5'-ATGAGCAGAGTCGAACTGGGT-3') for genetic mapping and to obtain a
full-length cDNA clone by screening an embryonic cDNA library. The sequence of
the ß-catenin-2 cDNA has been deposited in GenBank (Accession Number
AF329680). ß-catenin-2 was mapped to the telomeric region of LG
19 by scoring the polymorphism in the Heat Shock mapping panel
(Woods et al., 2000;
Woods et al., 2005).
The following clones were used to prepare antisense probes for
hybridization and/or sense RNAs for embryo injection:
ß-catenin-1 (Kelly et al.,
1995a), ß-catenin-2, krox20
(Oxtoby and Jowett, 1993),
emx1 (Morita et al.,
1995), hoxb6b (previously named hoxa7)
(Prince et al., 1998),
islet-1 (Inoue et al.,
1994), myoD (Weinberg
et al., 1996), bozozok/nieuwkoid/dharma
(Koos and Ho, 1998),
squint/znr2/ndr1 (Erter et al.,
1998; Rebagliati et al.,
1998), chordin
(Miller-Bertoglio et al.,
1997) and goosecoid
(Stachel et al., 1993).
ß-catenin-2* RNA contained nucleotides -100 to +15 of
ß-catenin-1 (Accession Number NM_131059) substituted for -167 to
+3 of ß-catenin-2 (Accession Number AF329680) and
ß-catenin-1* RNA contained nucleotides -120 to +3 of
ß-catenin-2 substituted for -195 to +3 of
ß-catenin-1, where +1 is the A of the initiating ATG codon. The
coding sequence of ß-catenin-1* was identical to
ß-catenin-1, but the coding sequence of
ß-catenin-2* contained an additional four amino acids
after the initiating methionine.
For phylogenetic analysis, translated cDNA sequences were aligned using
MUSCLE (Edgar, 2004) and based
on this alignment, a maximum parsimony tree of nucleic acid coding sequence
was performed using the protpars program from the PHYLIP package
(Felsenstein, 1989). For this
analysis, 1000 bootstrap replicates were performed. Accession Numbers for the
ß-catenin genes of rat, human, chicken, Pelodiscus sinensis (a
turtle), Xenopus laevis, goldfish and Ciona intestinalis
are, respectively, NM_053357, NM_001904, NM_205081, AB124575, BC082826,
AY336093 and AB031543. Sequences of the two ß-catenin genes of
Tetraodon and Takifugu were obtained from the data bases of
the Tetraodon
(http://www.genoscope.cns.fr/externe/English/Projets/Projet_C/C.html)
and Takifugu
(http://fugu.hgmp.mrc.ac.uk/)
genome projects.
RNA probe synthesis, hybridization, mRNA synthesis and injection
Antisense RNA probes were synthesized and hybridization procedures were
performed as previously described (Kelly
et al., 2000) except that BM purple alkaline phosphatase substrate
(Roche) was used as chromogen. Capped mRNAs were synthesized using the
appropriate mMessage mMachine Kit (Ambion), following the manufacturer's
protocol. RNAs were stored in distilled sterile H2O at -80°C,
and injection solutions were prepared by adjusting the RNA concentration to
twice that desired and then adding an equal volume of Dulbecco's modified
phosphate-buffered saline containing 0.5% Phenol Red (Sigma). Approximately 1
nl of RNA solution was injected through the intact chorion into the yolk at
the base of the blastomeres of one- to four-cell stage embryos, using an agar
mold to hold the embryos.
Morpholino antisense oligonucleotide injections
The following custom-designed morpholino antisense oligonucleotides were
obtained from Gene Tools (Philomath, OR): ß-catenin-1 MO1,
CTGGGTAGCCATGATTTTCTCACAG; ß-catenin-1 MO1mis,
CTcGGaAGCCATcATTTTCaCAgAG; ß-catenin-1 MO1-2,
CTGTGTCAAAAGCTGTATATTCCTG; ß-catenin-1 MO1-3,
CAGCACGTAAAACGCGAATAATGGC; ß-catenin-2 MO2,
CCTTTAGCCTGAGCGACTTCCAAAC; ß-catenin-2 MO2mis,
CgTTTaGCCTcAGCGACTTgCAtAC; and ß-catenin-2 MO2-2,
GTGTCTTGTAAGCAGTGAATCCACC. The morpholino oligonucleotides were diluted and
injected as described above for the RNAs.
RT-PCR
Total RNA was isolated from 20 whole embryos using TRIzol reagent
(Invitrogen). Oligo-dT-primed cDNA was synthesized and RT-PCR reactions were
performed using SuperScript First-Strand Synthesis System for RT-PCR
(Invitrogen) from 14 µg of total RNA, following the manufacturer's
protocol. Separate reactions were set up with primer pairs derived from
ß-catenin-1, ß-catenin-2 and ef1
using 25 cycles at an annealing temperature of 55°C (in the
semi-quantitative range). The following primers were used for the
amplifications: ß-catenin-1,
5'-CGCACACATTCACTCTCAGC-3' and
5'-TGGGTAGCCATGATTTTCTCA-3'; ß-catenin-2,
5'-ACGCTCAGGATCTGATGGAC-3' and
5'-AGGCACTTTCTGAACCTCCA-3'; ef1,
5'-ACCGGCCATCTGATCTACAA-3' and
5'-CAATGGTGATACCACGCTCA-3'.
|
RESULTS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
),
hereafter named ß-catenin-1. No significant homology was found
in the 5' UTR and 3' UTR when comparing the
ß-catenin-1 and ß-catenin-2 cDNAs. The
ß-catenin 1 and 2 proteins are 92.9% identical and 96.4% similar. Most of
the protein is highly conserved, with 96.1% identity from amino acids 1-686.
Only the C-terminal 92 amino acids (#687-778), comprising part of the
C-terminal activation domain, showed marked divergence, and even here the
sequence identity was 70.2% (Fig.
1A). Although these proteins are highly conserved, zebrafish
ß-catenin-2 is more diverged from zebrafish ß-catenin-1 than the
latter is from any of the tetrapod ß-catenins. Maximum parsimony
phylogenetic analysis of nucleotide sequences shows that zebrafish
ß-catenin-1 is part of a highly conserved branch that includes human,
mouse, Xenopus, goldfish and pufferfish ß-catenins, with
zebrafish ß-catenin-2 and a second ß-catenin gene (not clearly
orthologous) of pufferfish (both Fugu and Tetraodon)
branching off somewhat earlier (Fig.
1B). All of these vertebrate ß-catenins are more related to
one another than to ascidian, D. melanogaster or C. elegans
ß-catenins, or to vertebrate plakoglobins (data not shown).
We mapped ß-catenin-2 near the telomere of LG19 (this work)
(Woods et al., 2005), whereas
ß-catenin-1 had already been mapped to LG16
(Postlethwait et al., 1998).
Although the phenotype of the ichabod mutation was consistent with a
loss of function of a ß-catenin gene, we had ruled out the involvement of
ß-catenin-1, the only known zebrafish ß-catenin gene at the
time of the initial characterization of this mutant, because the mutation
mapped to LG19 (Kelly et al.,
2000). The finding of a second ß-catenin gene on the same
region as ichabod prompted us to re-examine whether the
ichabod phenotype was a consequence of a loss of function of
ß-catenin-2.
The ichabod mutation maps near ß-catenin-2 but does not functionally change its ORF
Map crosses were set up between ichabod homozygous females and
brass males and the resulting fertilized eggs were injected with
ß-catenin-2 RNA, which allowed rescue of these embryos to
fertile adult fish. These heterozygotes were mated with each other and the F2
generation raised to adulthood. DNA was prepared from the adult female
ichabod homozygotes (identified from the ichabod phenotype
of their F3 offspring embryos), and tested for linkage of simple sequence
repeat markers by standard techniques
(Talbot and Schier, 1999). As
shown in Fig. 2A,
ichabod is located near the telomere of LG19, 1.1 cM distal to a CA
repeat marker (CA85.6-3, a marker polymorphic for the map cross, found from
genomic sequence to be closely linked to the non-polymorphic z26695 marker),
and close to the position of ß-catenin-2, which had been mapped
to the same region in a separate map cross
(Woods et al., 2000;
Woods et al., 2005). We found
that six markers distal to CA85.6-3, extending to a genetic distance of 10 cM
from this marker, failed to show any recombination with the ichabod
locus. One of these markers was a CA repeat marker (CA91.6-1) located within
the 3' UTR of ß-catenin-2. Because these results suggested
a suppression of recombination in the telomeric region of ichabod
LG19, we retested recombination frequencies of a number of markers from this
region in an independent map cross (Fig.
2B). These markers were found to recombine with each other, as
expected from their previously reported map positions
(Shimoda et al., 1999)
(http://zebrafish.mgh.harvard.edu/zebrafish/index.htm).
Thus, it appears that the ichabod chromosome contains a region of
suppressed recombination, perhaps owing to an inversion or other chromosomal
rearrangement, in proximity to both the ichabod locus and the
ß-catenin-2 gene. It is interesting in this regard that the
cycb16 mutation, a deletion of the cyclops region near the telomere
of LG12, also suppresses recombination on that chromosome
(Talbot et al., 1998).
|
|
In situ hybridization also revealed that ß-catenin-2 mRNA is reduced in ichabod mutant embryos at early stages (Fig. 3B-M). In wild-type embryos, ß-catenin-1 and ß-catenin-2 transcripts were observed at the one-cell stage (Fig. 3B,H) and ubiquitously at sphere (Fig. 3C,I) and 90% epiboly stages (Fig. 3D,J). At the 90% epiboly stage, there was somewhat more pronounced expression of both genes in the dorsal midline. In ichabod embryos, there was little difference in expression of ß-catenin-1 at the two early stages (Fig. 3E,F), and at 90% epiboly, expression in the animal half of the embryo was reduced and expression in the vegetal half of the embryo was more intense (Fig. 3G). The results were very different with ß-catenin-2 expression at the one-cell and sphere stage embryos (Fig. 3K,L), which revealed a very low expression of this gene in ichabod embryos. By 90% epiboly (Fig. 3M), some ß-catenin-2 transcript can be detected, mainly in the vegetal half of the embryo. These findings support the idea that ichabod embryos are defective in maternal expression of ß-catenin-2. Results from microarray hybridization experiments also were consistent with these findings. Using a Sigma-Compugen oligonucleotide microarray and RNA targets prepared from wild-type or ichabod embryos at 30% epiboly, we found that ß-catenin-2 showed 3.7-fold downregulation in the mutant embryos (W. Wang, S.M. and E.S.W. unpublished). As will be described later, indirect assays using western immunoblotting show that pre-gastrula ichabod embryos are deficient in ß-catenin-2, but not ß-catenin-1, protein. Thus, four lines of evidence all reveal a deficit in maternal expression of ß-catenin-2 in ichabod embryos, but indicate no downregulation of zygotic expression of this gene or of maternal or zygotic expression of ß-catenin-1 in mutant embryos.
|
). C1-C4
embryos all lack notochord and have increasing amounts of neural tube. C1
embryos (e.g. Fig. 4F) lack an
embryonic axis, have a protruding tail-like structure, often with multiple
tail fins, and a protruding mass of necrotic cells on the opposite end of the
embryo. C1a embryos have spinal cord tissue, often reduced in length and
girth, but do not form more anterior neural structures. C2 embryos have spinal
cord, hindbrain and midbrain, but do not have forebrain or eyes (e.g.
Fig. 4E). C3 embryos have
defects in forebrain and/or eye development but have an intact neural tube
posterior to the forebrain. C4 embryos have a normal appearing neural tube but
lack notochord. C5 ichabod embryos, which are very rare, appear to be
normal at 24 hpf, but do not survive. ichabod embryos are usually C1,
C1a and C2, but as the expressivity of the mutation is somewhat variable, some
crosses also yield substantial numbers of C3 embryos and, more rarely, C4 and
C5 embryos. Wild-type embryos injected with MO2 show all of the ventralized phenotypes found in progeny of female ichabod homozygotes (Fig. 4D-F,H). A second MO, MO2-2, designed against a non-overlapping region of ß-catenin-2, gave similar distributions of ventralized embryos, when injected into wild-type embryos, whereas a mismatched MO, MO-2mis, with five base pair differences, had no effect (Fig. 4G). Injection of MO2 into ichabod embryos resulted in a shift of distribution of phenotypes to the more severely ventralized classes (Fig. 4I), suggesting that some ß-catenin-2 function remains in ichabod embryos and that this function is further reduced by the MO. In contrast to the results obtained with ß-catenin-2 MOs, no ventralizing effect was seen in embryos injected with MOs designed against ß-catenin-1 (e.g. Fig. 4A-C), even at high concentrations that caused bent tails and head necrosis (Fig. 4C). These phenotypes caused by high concentrations of MO1 were not rescued by injection of ß-catenin-1* mRNA (in which the 5'-UTR of ß-catenin-1 RNA was altered so that it was no longer complementary to the sequence of MO1, see Materials and methods), indicating that they were probably not due to specific interactions of the MO with ß-catenin-1 mRNA (data not shown). Injection into wild-type embryos of one or another of two additional non-overlapping MOs (MO1-2, MO1-3), designed against the 5' UTR of ß-catenin-1, also failed to yield ventralized phenotypes.
|
).
Injection of MO2, but not MO1, is effective in eliminating boz
expression from wild-type sphere stage embryos
(Fig. 5B,C). MO2 also decreases
sqt expression in these embryos, although some transcript is still
produced, but MO1 has no effect on expression of this gene
(Fig. 5F,G). Thus, reducing
expression of maternal ß-catenin-2, but not
ß-catenin-1, in wild-type embryos eliminates or reduces the
expression of very early markers of the dorsal organizer. Although injection
of MO2 ventralizes wild-type embryos, it does not result in the majority of
embryos showing the most severe phenotypes
(Fig. 4H), and thus, the
failure to obtain complete inhibition of expression of early dorsal markers
(e.g. sqt) in MO2-injected embryos is not unexpected. boz,
however, is extremely sensitive to levels of ß-catenin-2 but is
completely insensitive to inhibition of ß-catenin-1 expression.
These results strongly support a specific requirement for ß-catenin-2 in
the early dorsal signaling center.
|
Expression of the two ß-catenin proteins in wild-type and ichabod embryos
The two ß-catenin zebrafish proteins are of identical size and are
very highly conserved in sequence. Although it would be extremely useful to
obtain antibodies that could distinguish the two ß-catenins, we have thus
far been unsuccessful in raising antibodies against the specific C-terminal
peptides. However, we were able to employ an indirect immunological approach
to identify the contribution of each of the ß-catenins to total cellular
ß-catenin protein in wild-type and ichabod embryos. To achieve
this, we used a pan-ß-catenin antibody on western blots to compare levels
of ß-catenin in embryos injected with specific MOs against each
ß-catenin transcript or with control mismatched MOs (see Fig. S1 in the
supplementary material). By comparing the effects of the MO treatment, it is
possible to determine the relative amounts of ß-catenin derived from the
two types of ß-catenin RNA. In wild-type and ichabod embryos at
100% epiboly, MO2 or MO1 treatment each decreases the amount of ß-catenin
and a combination of MO1 and MO2 reduces the level of ß-catenin even
further. We conclude that at this developmental stage when most of the
ß-catenin transcript is presumably zygotically derived, the two
ß-catenins are expressed in both types of embryos. At 30% epiboly, the MO
treatments gave different results for wild-type and ichabod embryos.
In wild-type embryos, the results of MO treatment at 30% and 100% epiboly are
essentially the same. Treatment of ichabod embryos at 30% epiboly,
however, shows that MO2 has no effect on ß-catenin protein levels,
whereas MO1 greatly reduced the protein and, importantly, no further reduction
is observed when the two MOs are injected together. We conclude that
ichabod embryos produce little or no ß-catenin-2 protein from
maternal transcripts, although maternal expression of ß-catenin-1 is
normal. These results reinforce the conclusion that the ichabod
mutation causes a specific downregulation of maternal expression of
ß-catenin-2.
The two ß-catenins function redundantly to repress neurectoderm
To test if ß-catenin-1 and ß-catenin-2 might
have overlapping functions in early embryonic patterning, we analyzed the
phenotype of embryos in which expression of both ß-catenin genes is
inhibited. We carried out these studies in two ways: first, by injecting MO1
into ichabod embryos; and second, by injecting MO1 and MO2 into
wild-type embryos (Fig. 6).
Both types of embryos exhibited a new phenotype, which we termed `ciuffo' (a
tuft or quiff of hair, in Italian) because of the appearance of a protrusion
of the embryo away from the yolk (Fig.
6B,D). Examination of expression of a series of mesodermal and
neurectodermal markers revealed that instead of a ventralized phenotype that
might have been expected if both ß-catenins functioned redundantly to
promote dorsalization, the `ciuffo' embryos were dorsalized and expressed all
neurectodermal markers that were tested. To determine whether this dorsalizing
and neuralizing effect of injection of MO1 into ichabod embryos was
due to the specific inhibition of ß-catenin-1 transcript, we performed an
RNA rescue experiment (Fig.
6E-H). Typical severe ichabod embryos
(Fig. 7E) were mostly converted
into `ciuffo' embryos by injection of MO1
(Fig. 6F), but reverted back to
C1, C1a and C2 ventralized embryos when MO1 and ß-catenin-1*
RNA were co-injected (Fig. 6H).
When just the RNA was injected, full and partial rescue of the
ichabod phenotype was obtained
(Fig. 6G), a result expected
from our finding that injection of all ß-catenin RNAs tested, including
Xenopus ß-catenin RNA (Kelly
et al., 2000), can induce organizer and rescue ichabod.
The main conclusion of this experiment, however, is that the `ciuffo'
phenotype can be rescued, indicating that the phenotype is not a result of a
non-specific effect of MO1 on a non-ß-catenin transcript.
We tested for expression of emx1
(Fig. 6L-N), krox20
(Fig. 7I-K) and hoxb6b
(Fig. 6O-Q) to determine if
`ciuffo' embryos were able to express a wide range of anterior and posterior
neurectodermal markers. Whereas emx1 and krox20 were not
expressed in the severe ichabod embryos used for these experiments
(Fig. 6J,M), they are expressed
at localized regions of the protrusion in `ciuffo' embryos
(Fig. 6K,N), which developed as
a result of injection of MO1 into ichabod embryos of the same
breeding. Most ichabod embryos also fail to express hoxb6b
(Fig. 6P), although expression
is observed by hybridization in a small number of 24 hpf embryos (not
illustrated) and confirmed by RT-PCR (data not shown). This low level of
expression is consistent with the finding that ichabod mutants do
express earlier posterior neurectodermal markers
(Kudoh et al., 2004).
hoxb6b is expressed in all `ciuffo' embryos (e.g.
Fig. 6Q) and RT-PCR indicates a
much greater amount of this transcript is present than in ichabod
embryos. Thus, even for the most posterior marker tested, the absence of
expression of the two ß-catenins resulted in an increase in transcript
levels. Interestingly, the more posterior the marker, the further its
expression site was from the yolk. This pattern, as well as the double ring of
krox20 expression (found in some, but not all embryos stained for
this marker), indicated that the `ciuffo' protrusion had some degree of
appropriate anteroposterior patterning, although the morphology of the embryo
was abnormal. We also tested for expression of the neuronal markers,
islet1 (Fig. 6R-T),
tlxA (Andermann and Weinberg,
2001) (data not shown) and HuC (data not shown). None of
these genes was expressed in severely mutant ichabod embryos (e.g.
Fig. 6S), but each was
expressed in the `ciuffo' embryos obtained after MO1 injection. Thus, the
neurectoderm that is formed by reducing expression of the two ß-catenins
does generate neurons, although they are not organized in a recognizably
patterned way. We also assayed the expression of a number of mesodermal
markers. Notably, myoD, which is expressed in concentric rings at the
posterior end of ichabod embryos
(Fig. 6V), is also expressed in
the `ciuffo' protrusion (Fig.
6Z). ntl, although expressed during gastrula stages in
ichabod embryos (Kelly et al.,
2000) and `ciuffo' embryos (data not shown) as a pan-mesodermal
marker, is not expressed in `ciuffo' gastrulae in any notochord-like structure
or at post-gastrula stages. We also found that `ciuffo' embryos fail to
express sonic hedgehog, another notochord marker. Thus, loss of
function of ß-catenin-1 in embryos already deficient in
ß-catenin-2 leads to a restoration of neurectoderm, but not
notochord. It is noteworthy that none of these effects observed in `ciuffo'
embryos occurs merely by inhibiting expression of ß-catenin-1 in
wild-type embryos, indicating a genetic redundancy of the two ß-catenins
in repression of neurectoderm.
|
). In `ciuffo' embryos produced by MO1 treatment of
ichabod embryos, there is no indication of dorsal expression of any
of these markers at 30% epiboly, with results identical to ichabod
embryos for boz, sqt and chd, and a faint radial symmetric
expression of gsc around the germ ring
(Fig. 7C,F,I,O). At 50%
epiboly, this germ ring expression of gsc becomes more intense and a
similar expression of chd is now observed
(Fig. 7J,R). By this stage, for
all three types of embryos, boz expression disappeared and
sqt expression was greatly decreased (data not shown). We also tested
for expression of fgf3 and fgf8, and their patterns of
expression in the three types of embryos were identical to sqt at
these stages. We conclude that a defined organizer does not form in `ciuffo'
embryos, as there is no expression of boz and no dorsal expression of
sqt, chd, fgf3 and fgf8. Although radial germ ring
expression was observed for sqt, fgf3 and fgf8 in `ciuffo'
embryos, the pattern was unchanged qualitatively and quantitatively from that
of ichabod embryos. The late onset of gsc and chd
expression around the germ ring, however, indicates that ß-catenin-1 and
ß-catenin-2 normally function redundantly to repress expression of these
genes in this domain. None of the genes tested was ectopically expressed when
wild-type embryos were treated with MO1 (data not shown). Thus, the
ventrolateral ectopic expression of a subset of genes normally expressed only
dorsally is observed only in the absence of the two ß-catenins.
Interestingly, ectopic chd expression has also been observed in
embryos expressing a dominant-negative form of Tcf3, which would be expected
to inhibit the function of both ß-catenins
(Pelegri and Maischein, 1998).
The ectopic expression of chd in the germ ring ventrolateral domain
would be expected to result in inhibition of BMP signaling, thus explaining
the precocious expression of neural markers in `ciuffo' embryos.
|
|
DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). Our more
recent discovery of a second ß-catenin gene, ß-catenin-2,
led us to consider that the phenotypes of ichabod mutant embryos were
a result of failure of proper regulation of this gene. ichabod was
found to map close to the position of ß-catenin-2 in the
telomeric region of LG19. Very suggestive of a chromosome rearrangement in
this region of the ichabod chromosome was the failure to observe any
recombination between markers extending from LG19 map positions 91.5 to 95.4
cM. Still ongoing fluorescent hybridization studies with interphase nuclei
clearly show a different order of markers in this region of the
ichabod chromosome compared with wild-type chromosomes (S.M., M.
Nimmakayalu, B. Emanuel and E.S.W., unpublished). RT-PCR and whole mount
hybridization experiments presented above show that ichabod mutant
embryos are defective in maternal, but not zygotic, expression of
ß-catenin-2. Treatment of ichabod embryos with MO2
results in a shift of phenotypes to more severely ventralized classes
(Fig. 4I), suggesting that
ichabod is a hypomorphic ß-catenin-2 mutant, which is
shifted towards a null phenotype by further depletion of the protein product.
Moreover, evidence from western blots of MO2- and MO1-treated embryos also
indicated that ß-catenin-2 (but not ß-catenin-1) protein levels are
low in pre-gastrula ichabod embryos. As MO ß-catenin-2
loss-of-function phenotypes are clearly the same as the ventralized
ichabod phenotypes, we suggest that the ichabod mutation is
a regulatory mutation affecting the maternal expression of
ß-catenin-2.
Maternal expression of ß-catenin-2 is required for organizer formation
The results presented here clearly show that both zebrafish ß-catenin
genes are expressed maternally and zygotically in wild-type embryos. Although
mRNA from both genes is expressed ubiquitously, we have uncovered a specific
role of ß-catenin-2 in organizer formation and early dorsal
signaling. Wild-type embryos treated with MO2, or embryos bred from homozygous
ichabod mothers both show a decrease in ß-catenin-2
transcripts and protein (Fig.
3, Fig. 6), fail to
express markers of the organizer and anterior neurectoderm
(Fig. 5,
Fig. 7J,M), and exhibit similar
ventralized phenotypes (Fig.
6). MOs directed against ß-catenin-1 have no
ventralizing effects on wild-type embryos and do not enhance the
ventralization of ichabod embryos.
The specific requirement for ß-catenin-2 for organizer formation was
unexpected. Both ß-catenin transcripts are expressed ubiquitously at
stages prior to and during organizer formation. Moreover, our experiments
revealed that both proteins were expressed from maternal transcripts in
wild-type embryos. However, as we have not yet had success in raising
antibodies that can specifically recognize each of the two proteins, we were
not able to determine whether both proteins are present in the dorsal region
of the embryo where ß-catenin acts to establish DV asymmetry. At least
three formal possibilities exist to explain the requirement for
ß-catenin-2. First, the level of ß-catenin-1 protein in dorsal
territories may not be sufficient to compensate functionally for the loss of
ß-catenin-2. Second, the protein itself may be under
post-translational control resulting in rapid inactivation of ß-catenin-1
on the dorsal side of the embryo. Third, the ß-catenin 1 and 2 proteins
might have different activities (e.g. different transactivation domains or
different requirements for co-factors), such that endogenous levels of
ß-catenin-1 are not able to activate early dorsal gene expression even
though it can do so when overexpressed. A model in which ß-catenin-2
promotes organizer formation by sequestering components that otherwise would
facilitate degradation of ß-catenin-1 is unlikely because MO1 depletion
of ß-catenin-1 in wild-type embryos does not ventralize and, in
ichabod embryos, fails to increase the severity of ventralization.
Most of the differences between the two ß-catenins are found in the
C-terminal 92 amino acids, corresponding to the major region of a
transactivation domain known to interact with CBP and p300
(Hecht et al., 2000;
Takemaru and Moon, 2000). This
region also can interact with the armadillo repeat region of the protein
(Cox et al., 1999;
Piedra et al., 2001) and has
been implicated in regulating selective binding to cadherin or Tcf proteins
(Gottardi and Gumbiner, 2004).
However, to explain the lack of sufficiency of ß-catenin-1 for organizer
formation, such differences between the two ß-catenins would also have to
explain why both ß-catenins appear to be absent in dorsal nuclei of
ichabod embryos (Kelly et al.,
2000).
We performed two types of experiments to judge if there were indeed functional differences between the two ß-catenins in the context of organizer formation. First, we determined if expression of either ß-catenin from injected RNA was more efficient in rescuing ichabod embryos. The results showed that the two ß-catenin RNAs were equally efficient in rescue, with a precipitous decline in the ability to rescue when the concentration of injected RNA for each of the two ß-catenins was reduced from 10 ng/µl to 5 ng/µl. We also carried out an experiment in which tagged forms of each ß-catenin were expressed from RNAs co-injected into ichabod embryos, and the subcellular and embryonic localization of the two proteins were then determined at the 500-cell stage using antibodies against the tagged epitopes (GFP-ß-catenin-1 and myc-ß-catenin-2) (data not shown). Our initial results showed that ß-catenin-2 had a nuclear localization in a small group of marginal cells on one side of the embryo. However, tagged ß-catenin-1 protein was also found in the very same nuclei, offering no support for a difference in subcellular distribution between the two ß-catenins as the basis for the requirement for ß-catenin-2 for organizer formation. As each of the ß-catenins is capable of localizing in blastoderm marginal nuclei, it is not surprising that rescue of ichabod embryos is achieved by injection of either ß-catenin, but we still do not know the basis of the specific requirement for endogenous ß-catenin-2 for organizer formation.
Zebrafish ß-catenins redundantly inhibit neurectoderm
In contrast to formation of the dorsal axial structures, loss of function
of one or the other of the two zebrafish ß-catenins does not appear to
affect the role of the Wnt pathway in posteriorization and ventralization of
neurectoderm and mesoderm (Lekven et al.,
2001; Erter et al.,
2001; Momoi et al.,
2003; Ramel and Lekven,
2004). We found that reduction of ß-catenin-2
expression alone results in ventralization, not dorsalization, and reduction
of ß-catenin-1 expression alone has no effect on dorsoventral or
anteroposterior patterning. However, when expression of both ß-catenins
is inhibited, we found a robust formation of neurectodermal tissue in
comparison with wild-type embryos treated with MO2 or with ichabod
embryos, which only occasionally express posterior neural markers in their
tail-like appendage. Although the neurectoderm formed when both
ß-catenins are inhibited is not organized into a normal neural tube, a
substantial amount of tissue expressing both anterior and posterior
neurectodermal markers is incorporated into a large protrusion extending out
from the yolk (e.g. Fig.
7K,N,Q). The neurectoderm of these `ciuffo' embryos is able to
form neurons (Fig. 7T) and
appears to express neural markers in correct anteroposterior order. In the
absence of organizer and ß-catenin-2 expression,
ß-catenin-1 expression alone is able to repress the expression
of all neural markers tested. When ß-catenin-2 expression is
unperturbed, inhibition of ß-catenin-1 does not lead to an
expansion of neural tissue or patterning defects. Thus, only when expression
of both ß-catenin genes is inhibited do we find a de-repression of neural
markers.
It is very likely that this activation of neural marker expression is due
to an impairment of Wnt pathway signaling normally involved in
posteriorization and ventralization. A posteriorizing activity of zebrafish
ventrolateral germring tissue has been demonstrated by transplantation studies
(Woo and Fraser, 1997), and
wnt8, which is expressed in this region of the embryo
(Kelly et al., 1995b), is
required for formation of ventrolateral and posterior mesoderm and spinal cord
and posterior brain (Lekven et al.,
2001; Erter et al.,
2001; Momoi et al.,
2003; Ramel and Lekven,
2004). The posteriorizing effect of zebrafish Wnt signaling, at
least in part, functions by negating the repression of posterior neural
factors by Tcf3a (Kim et al.,
2000; Dorsky et al.,
2003). Other important targets of ventroposteriorizing Wnt signals
include the vox/vent/ved, related homeodomain transcriptional repressors that
restrict dorsal gene expression to the proper territories, and cdx4, which
regulates the action of posterior Hox genes
(Kawahara et al., 2000a;
Kawahara et al., 2000b;
Imai et al., 2001;
Ramel and Lekven, 2004;
Shimizu et al., 2005).
In zebrafish embryos lacking expression of both ß-catenins, we
hypothesize that the dorsolateral Wnt8 signals that normally posteriorize the
neurectoderm are not transduced. Indeed, we find that ichabod embryos
treated with MOs targeted against both translated forms of wnt8
(Lekven et al., 2001) develop
the `ciuffo' phenotype and, moreover, such embryos, as well as wild-type
embryos injected with both MOs, express large amounts of chordin
transcript around the germ ring (M.V., S.M. and E.S.W., unpublished)
(Ramel and Lekven, 2004). Our
finding that MO1 treatment of ichabod embryos also results in germ
ring chordin expression (Fig.
7R) suggests that chordin repression by Wnt8 and
vox/vent/ved is mediated by both ß-catenin-1 and -2 (M.V., S.M. and
E.S.W., unpublished). A true dorsal signaling center is not established in
these embryos as boz fails to be expressed, and otherwise dorsal
markers are expressed later than they normally would be, consistent with a
response to the later Wnt8 signaling. Although some ichabod embryos
express hoxb6b in their tail extension [an observation consistent
with expression of earlier posterior neural markers in ichabod
embryos (Kudoh et al., 2004)],
the amount of transcript of this factor is also markedly increased in
MO1-treated ichabod embryos. Thus, not only do the two
ß-catenins act to posteriorize and ventralize the embryo, but they also
act to repress formation of neurectoderm. In a normal embryo, such repression
may act to restrict the amount of organizer-induced neurectoderm
formation.
Neurectoderm patterning in the absence of an organizer
The studies presented above add to an array of evidence indicating that AP
patterning of the neurectoderm can occur in embryos lacking organizer tissue.
Ectoderm of embryos lacking expression of both ß-catenins forms
neurectoderm that expresses posterior, hindbrain and forebrain markers in
apparently correct AP order. Wnt/ß-catenin signaling is thus not required
in the early embryo for either neural induction or for at least some degree of
proper AP patterning. A similar conclusion has recently been reached by
simultaneous elimination of the Spemann organizer and BMP signaling in
Xenopus (Reversade et al.,
2005). In this case, BMP signaling was eliminated by MO treatment
against three different BMP ligands. In the zebrafish, as shown above, the
depletion of the two ß-catenins results in ectopic expression of
chordin, which would in effect reduce or eliminate BMP signaling in
the absence of organizer. A significant difference between the two organisms
is that elimination of the single ß-catenin in Xenopus does not
result in chordin expression
(Reversade et al., 2005), and
totally eliminates neural induction
(Heasman et al., 1994;
Heasman et al., 2000), whereas
in zebrafish both ß-catenins appear to be required to prevent
chordin expression in ventrolateral regions of the germ ring. In both
organisms, however, it is now clear that extensive neurectoderm can be formed
with a degree of proper AP pattern in the absence of ß-catenin and
organizer. Further study of this condition may provide insight into factors
that could underlie the anteroposterior pattern of the neurectoderm in the
absence of both Wnt/ß-catenin and BMP signaling.
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/133/7/1299/DC1
* These authors contributed equally to this work 
|
REFERENCES |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Andermann, P. and Weinberg, E. S. (2001). Expression of zTlxA, a Hox-11-like gene, in early differentiating neurons and cranial sensory ganglia of the zebrafish embryo. Dev. Dyn. 222,595 -610.[CrossRef][Medline]
Christian, J. L. and Moon, R. T. (1993). Interactions between Xwnt-8 and Spemann organizer signaling pathways generate dorsoventral pattern in the embryonic mesoderm of Xenopus.Genes Dev. 7,13 -28.[Medline]
Christian, J. L., McMahon, J. A., McMahon, A. P. and Moon, R.
T. (1991). Xwnt-8, a Xenopus
Wnt-1/int-1-related gene responsive to mesoderm-inducing growth factors,
may play a role in ventral mesodermal patterning during embryogenesis.
Development 111,1045
-1055.
Cox, R. T., Pai, L.-M., Kirkpatrick, C., Stein, J. and Peifer,
M. (1999). Roles of the C-terminus of armadillo in wingless
signaling in Drosophila. Genetics
153,319
-332.
Dorsky, R. I., Sheldahl, L. C. and Moon, R. T. (2002). A transgenic Lef1/ß-catenin-dependent reporter is expressed in spatially restricted domains throughout zebrafish development. Dev. Biol. 241,229 -237.[CrossRef][Medline]
Dorsky, R. I., Itoh, M., Moon, R. T. and Chitnis, A.
(2003). Two tcf3 genes cooperate to pattern the zebrafish brain.
Development 130,1937
-1947.
Dougan, S. T., Warga, R. M., Kane, D. A., Schier, A. F. and
Talbot, W. S. (2003). The role of the zebrafish nodal-related
genes squint and cyclops in patterning of mesendoderm.
Development 130,1837
-1851.
Edgar, R. C. (2004). MUSCLE: a multiple
sequence alignment method with reduced time and space complexity.
BMC Bioinformatics 5,1
-19.
Erter, C. E., Solnica-Krezel, L. and Wright, C. V. E. (1998). The zebrafish nodal-related 2 encodes and early mesendodermal inducer signaling from the extraembryonic yolk syncytial layer. Dev. Biol. 204,361 -372.[CrossRef][Medline]
Erter, C. E., Wilm, T. P., Basler, N., Wright, C. V. E. and Solnica-Krezel, L. (2001). Wnt8 is required in lateral mesendodermal precursors for neural posteriorization in vivo. Development 128,3571 -3583.[Medline]
Felsenstein, J. (1989). PHYLIP-Phylogeny Inference Package (Version 3.2). Cladistics 5, 164-166.
Fridieu, J. R., Cui, Y., Maier, D., Danilchik, M. V. and Christian, J. L. (1997). Xwnt-8 and lithium can act upon either dorsal mesodermal or neuroectodermal cells to cause a loss of forebrain in Xenopus embryos. Dev. Biol. 186,100 -114.[Medline]
Gottardi, C. J. and Gumbiner, B. M. (2004).
Distinct molecular forms of ß-catenin are targeted to adhesive or
transcriptional complexes. J. Cell Biol.
167,339
-349.
Haelgel, H., Larue, L., Ohsugi, M., Federov, L., Herrenknecht, K. and Kemler, R. (1995). Lack of beta-catenin affects mouse development at gastrulation. Development 121,3529 -3537.[Abstract]
Harland, R. and Gerhart, J. (1997). Formation and function of Spemann's organizer. Annu. Rev. Cell Dev. Biol. 13,611 -667.[CrossRef][Medline]
Heasman, J., Crawford, A., Goldstone, K., Garner-Harnick, P., Gumbiner, B., McCrea, P., Kintner, C., Noro, C. Y. and Wylie, C. (1994). Overexpression of cadherins and underexpression of bet-catenin inhibit dorsal mesoderm induction in early Xenopus embryos. Cell 79,791 -803.[CrossRef][Medline]
Heasman, J., Kofron, M. and Wylie, C. (2000). ß-catenin signaling activity dissected in the early Xenopus embryo: a novel antisense approach. Dev. Biol. 222,124 -134.[CrossRef][Medline]
Hecht, A., Vleminckx, K., Stemmler, M. P., van Roy, F. and Kemler, R. (2000). The p300/CBP acetyltransferases function as transcriptional coactivators of ß-catenin in vertebrates. EMBO J. 19,1839 -1850.[CrossRef][Medline]
Hoppler, S., Brown, J. D. and Moon, R. T.
(1996). Expressiion of a dominant-negative Wnt blocks induction
of MyoD in Xenopus embryos. Genes
Dev. 10,2805
-2817.
