|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 1 March 2006
doi: 10.1242/dev.02305
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



1 Victor Chang Cardiac Research Institute, Darlinghurst, Sydney 2010,
Australia.
2 Faculties of Life Science and Medicine, University of New South Wales,
Randwick 2031, Australia.
3 Instituto de Biofisica Carlos Chagas Filho, Universidade Federal do Rio de
Janeiro, 20941-000, Brazil.
¶ Author for correspondence (e-mail: r.harvey{at}victorchang.unsw.edu.au)
Accepted 31 January 2006
| SUMMARY |
|---|
|
|
|---|
embryo chimaeras bearing the heterozygous
mutation died before term with cardiac malformations similar to the more
severe anomalies seen in NKX2.5 mutant families. These studies
suggest a functional interdependence between the NK2 class homeodomain and YRD
in cardiac development and evolution, and establish a new model for analysis
of Nkx2-5 function in CHD.
Key words: Heart, Homeodomain, Nkx2-5, Congenital heart disease
| INTRODUCTION |
|---|
|
|
|---|
Nkx2-5/Csx is a vertebrate member of the NK2 class of homeodomain
transcription factors that sits high in the cardiac regulatory hierarchy
(Cripps and Olson, 2002
).
Murine Nkx2-5 was first identified in screens for relatives of the
Drosophila gene tinman, expressed immediately downstream of
mesodermal specification genes during fly development and absolutely required
for formation of precursor cells of the heart and gut muscle lineages
(Bodmer, 1993
;
Azpiazu and Frasch, 1993
).
Numerous vertebrate cognates of Nkx2-5 have now been described, with
related genes expressed in the simple heart tube of amphioxus
(Holland et al., 2003
), in the
pulsatile muscular pharynx of C. elegans
(Okkema et al., 1997
) and in
the contractile foot of hydra (Shimizu and
Fujisawa, 2003
). Transgenic rescue experiments testify to the
functional homology that exists between cognates of this gene family in
distantly related species (Haun et al.,
1998
; Park et al.,
1998
; Ranganayakulu et al.,
1998
).
Nkx2-5 is expressed in the earliest recognisable cardiac precursor
cells in all models examined (Harvey,
1996
), including cells of the heart morphoregulatory field in
Xenopus (Raffin et al.,
2000
), and the second heart precursor field of amniotes
(Stanley et al., 2002
). In
Xenopus, dominant-negative inhibition of Nkx2-5 and its close
relative Nkx2-3 leads to total loss of all cardiac progenitors
(Grow and Krieg, 1998
). In
homozygous Nkx2-5 knockout mouse embryos, a simple beating myogenic
heart tube is able to form, although differentiation and morphogenesis of
specialised chamber myocardium is blocked
(Lyons et al., 1995
). A
remarkable diversity of structural and functional abnormalities of the heart
occur in human families and individuals carrying heterozygous NKX2.5
mutations (Benson et al.,
1999
). Atrioventricular (AV) conduction block, present in most
individuals, results from hypoplasia and progressive postnatal loss of AV
nodal tissue, and requires a pacemaker
(Jay et al., 2004
;
Pashmforoush et al., 2004
).
Structural malformations requiring surgery include atrial septal defect (ASD),
tetralogy of Fallot, ventricular septal defect (VSD) and hypoplastic left
heart syndrome (Benson et al.,
1999
; Elliott et al.,
2003
; McElhinney et al.,
2003
).
Among the earliest Nkx2-5-dependent genes are those encoding other cardiac
transcription factors (Biben and Harvey,
1997
; Bruneau et al.,
2000
; Molkentin et al.,
2000
; Ueyama et al.,
2003
; von Both et al.,
2004
; Yoshioka et al.,
1998
). Nkx2-5 physically interacts with several transcription
factors, including members of the GATA and T-box factor families, serum
response factor (SRF) and Foxh1, and collaborates with them to regulate target
promoters (Chen and Schwartz,
1996
; Durocher et al.,
1997
; Bruneau et al.,
2001
; Hiroi et al.,
2001
; von Both et al.,
2004
). Recent data show that competition between Nkx2-5 and
different members of the T-box family of transcription factors drives
formation of chamber and non-chamber myocardium
(Habets et al., 2002
;
Stennard and Harvey, 2005
).
Nkx2-5 also activates negative regulatory circuits controlled by
transcriptional repressors CARP and HOP
(Chen et al., 2002
;
Zou et al., 1997
).
Despite these advances, the central question of how broadly expressed
transcription factors, such as Nkx2-5, control the temporal and spatial
specificity of lineage and morphogenetic events during heart development
remains unanswered. Region-specific signalling inputs that influence the
nuclear localisation and/or the chromatin-modifying activity of transcription
factors are likely to play key roles
(Charron et al., 2001
;
McKinsey et al., 2000
).
Members of the cardiac Nkx2 family are known to function as both
transcriptional activators and repressors
(Choi et al., 1999
), and two
conserved domains, the N-terminal TN-Domain and C-terminal NK2-specific domain
(NK2SD) appear to act as negative modulatory domains, the former through
association with the Groucho family of co-repressors
(Muhr et al., 2001
;
Watada et al., 2000
).
In this paper, we genetically define a novel, conserved and essential transcriptional domain within the C terminus of murine Nkx2-5. The tyrosine-rich domain (YRD) has co-existed with the NK2 class homeodomain since before radiation of vertebrate and invertebrate evolutionary lines. The apparent absolute functional inter-dependence between the YRD and NK2 homeodomains can explain the similar phenotypic manifestations arising from mutations in different regions of the NKX2.5 protein in individuals with CHD.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Western blotting and EMSA
Nuclear extracts were prepared
(Stennard et al., 2003
) and
proteins separated by SDS-PAGE. Western blotting was performed using anti-FLAG
mouse mAb (1:1000; AMRAD) or anti-GAL4 (DBD) mouse mAb (RK5C1) (1:1000; Santa
Cruz) with anti-mouse IgG-HRP (1:2000; Silenus). Proteins were detected using
ECL reagent (Pharmacia Amersham Biotech). Nkx2-5 proteins for EMSA
(Stennard et al., 2003
) were
translated using TNT Rabbit reticulate lysates (Promega). The oligonucleotide
contained three high-affinity Nkx2-5-binding sites (5' ctcaagtgg
3').
Nkx2-5 homologues
Systemic or branchial hearts from adult O. kaurna, S. officinalis
and L. pealeii were dissected into RNAlater (Ambion). RNA was
extracted using Trizol (Invitrogen). RT-PCR was performed using 200 ng of NK2
homeodomain-specific degenerate oligonucleotides (5' cgictittytcicaigc
3' and 5' rtaicgicgittgtgiaacc 3'; r=a or g;
i=deoxyinosine), 0.5 mM dNTPs, 1xPCR buffer (Boehringer) and 2U of TAQ
(Boehringer). Cycling conditions were: 95°C for 2 minutes followed by 35
cycles of 95°C for 20 seconds, 50°C for 30 seconds and 72°C for 1
minute. Homeobox sequences were used to design specific primers for 5'
and 3' RACE using Ambion and Clontech kits, respectively, and a modified
oligonucleotide (5' aagcagtggtatcaacgcagagtacgcgggtttt 3').
ES cells and gene targeting
Gene targeting was performed using standard methods. The IRESlacZHygro
cassette was adapted from IRESCreHygro
(Stanley et al., 2002
).
Embryoid body (EB) culture was adapted from the hanging drop method
(Bader et al., 2001
). GFP
expression was analysed on a FACSCalibur (BD Biosciences). A sort gate was
established on the basis of forward scatter, side scatter and propidium iodide
staining. A second gate was established based on GFP fluorescence intensity
(FL-I) and side scatter that excluded most auto-fluorescent cells. Animal
experiments were approved by the St Vincent's Hospital/Garvan Institute for
Medical Research Animal Ethics Committee.
RT-PCR analysis
RNA from FACS-isolated GFP-positive cells was extracted using Trizol
(Invitrogen). After RNA extraction, cDNA was prepared and linearly amplified
(Baugh et al., 2001
). Results
were confirmed by RT-PCR without amplification. Real-time PCR used the
LightCycler-FastStart DNA master SYBR Green I kit (Roche) on a LightCycler
(Roche). PCR protocols: 95°C for 10 minutes; followed by 35 cycles of
95°C for 10 seconds; 60°C for 10 seconds; 72°C for 10 seconds.
TUNEL assay
TUNEL was performed on sections from three 14.5 dpc control
Nkx2-5lacZ/+(
H)
wild-type
and two similarly staged
Nkx2-5Y-A:IRESlacZ/+(
H)
wild-type
chimaeric hearts using the DeadEnd fluorometric TUNEL system (Promega). TUNEL
was assessed on a total of 8-16 sections from the mid-region of chimaeric
hearts. Statistical significance was assessed using nested analysis of
variance.
| RESULTS |
|---|
|
|
|---|
VGDL, reduced activity to
44-48% of control levels, although this minor effect may be due to the
slightly diminished stability of mutant proteins
(Fig. 1F).
We noted that the region essential for transcriptional activity, minimally
encompassing amino acids 232-262, was unusually rich in the bulky aromatic
amino acid tyrosine (24% over 37 amino acids). To assess whether tyrosines
were essential for transcriptional activity, we first mutated each
individually to alanine (Fig.
1E). Individual Y
A mutations had only minor effects on
transcription, in the extreme diminishing activity by 29% in the case of Y244A
and increasing it by 52% in the case of Y363A
(Fig. 1E). However, mutation of
the first seven out of nine tyrosines to alanine as a group reduced activity
to 25% of wild type, and when all nine were mutated, activity was reduced
further. Mutation of the first seven tyrosines to the structurally related
phenylalanine also effectively eliminated activity. Relevant mutant proteins
were stable after transfection of encoding plasmids into COS cells
(Fig. 1F; data not shown).
|
Alignment of YRD sequences (Fig. 2A) revealed that the number of tyrosines varied from four to 10 in different NK2 proteins, although there was an overall conservation of spacing, particularly among species orthologues of Nkx2-5 and Nkx2-3. The alignment became more significant if the occasional conservative amino acid change to phenylalanine was allowed, supporting the idea that the tyrosines and phenylalanines are structurally or functionally important. In addition to tyrosines, several other amino acids were strongly, although not absolutely, conserved. The asparagine at position 15 in mouse Nkx2-5, for example, was conserved in all of the Nkx2-5 and Nkx2-3 orthologues shown (Fig. 2A) and valine at position 7 was conserved in 10/11 of these. Asparagine 10, prolines 11, 18 and 37, and cysteine 33 in the mouse sequence were also well conserved in other members.
Cardiac NK2 proteins from cephalopod molluscs also carry the YRD
The YRD was absent from Drosophila Tinman, despite it having a
well-established cardiogenic function during Drosophila embryogenesis
(Cripps and Olson, 2002
). A
cluster of tyrosines was present C-terminal to the homeodomain in the C.
elegans NK2 homeoprotein, Ceh22, which has a role in specification of the
pulsatile (heart-like) pharyngeal muscles of the worm, a function that can be
substituted for by Tinman (Haun et al.,
1998
). However, other signature amino acids of the YRD are not
conserved. Furthermore, the NK2SD is lacking in Ceh22. Both insect and
nematode phyla are members of the large invertebrate clade Ecdysozoa.
Accelerated evolution of gene families has been noted in the genomes of
Drosophila and C. elegans
(Kortschak et al., 2003
),
raising the possibility that the absence of C-terminal domains in Tinman and
Ceh22 represents a derived rather than ancestral state.
To explore this possibility, we cloned cDNAs encoding Nkx2-5
homologues from the hearts of cephalopod molluscs (octopus Octopus
kaurna, cuttlefish Sepia officinalis and squid Loligo
pealii). Cephalopod molluscs belong to a separate large invertebrate
clade, Lophotrochozoa. They are highly motile invertebrates that possess a
sophisticated closed circulatory system with systemic and branchial hearts
(Fig. 2B). Remarkably, the
systemic hearts of squid produce pressures approaching those of mammalian
hearts (Wells, 1992
). A
full-length cDNA clone was isolated from RNA extracted from the adult systemic
heart of the cuttlefish S. officinalis, and shorter clones were
isolated from O. kaurna and L. pealii. In situ hybridisation
to sectioned L. pealii embryos confirmed expression in the systemic
heart and adjacent muscular ink sac (Fig.
2B-D; data not shown).
The cuttlefish SoNkx2-5 cDNA was 1.12 kb long and encoded a 326
amino acid protein containing, in addition to an NK2-class homeodomain, four
other conserved NK2 protein signature motifs: a TN Domain within the N
terminus and (within the C terminus) the NK2SD, YRD and GIRAW motifs
(Fig. 2A). The same C-terminal
domain structure was evident in proteins predicted from the O. kaurna
and L. pealii cDNAs (data not shown). The Nkx2-5 Box, found in only
vertebrate and amphioxus Nkx2-5 orthologues
(Evans, 1999
), was absent.
|
The YRD of the cephalopod proteins contained five or six tyrosines with an additional conservative change to phenylalanine and several non-tyrosine amino acids present in mammalian family members were also conserved (Fig. 2A). The above data suggest that the domain architecture of vertebrate cardiac NK2 homeodomain proteins, as seen in Nkx2-5, was established prior to divergence of the common ancestor of protostomes and deuterostomes, and that Tinman is highly derived.
Mutation of the YRD alters Nkx2-5 transcriptional activity but not DNA binding in vitro
Full-length Nkx2-5 is a weak transcriptional activator in vitro and it has
been proposed, based on in vitro data, that the C-terminal region of the
protein inhibits the activity of its strong N-terminal trans-activation domain
via an intramolecular mechanism (Sepulveda
et al., 1998
). An influence of C-terminal amino acids on Nkx2-5
dimerisation on DNA has also been reported
(Kasahara et al., 2000
). We
tested whether the Y-A mutation affected the function of full-length Nkx2-5 in
vitro. However, we found no diminishment of DNA binding
(Fig. 3A) and there was no
change in the trans-activation activity of Nkx2-5Y-A on a synthetic promoter
carrying multiple Nkx2-5-binding sites
(Fig. 3B), or on the promoter
of the Nppa1 gene, a direct Nkx2-5 target, in the absence or presence
of cardiac transcription factors Gata4 or Gata5, and Tbx20, with which Nkx2-5
can functionally synergise (Fig.
3C and Fig. S1 in the supplementary material). Furthermore, no
effect was seen on the Nppa promoter in the presence of SRF and/or
myocardin, and Tbx5 and/or Tbx2 (see Fig. S1 in the supplementary material).
However, Nkx2-5Y-A transcriptional activity was diminished by 50%
(P<0.001) relative to wild-type Nkx2-5 on the promoter of the
Gja5 gene (encoding connexin 40), another direct target of Nkx2-5;
this was most obvious in the presence of Tbx20a and Gata5 (see
Stennard et al., 2003
)
(Fig. 3C).
|
HD;
Fig. 4B), as previously
described (Biben et al., 2000
H and
NH in
Fig. 4B,C,E). Strategy I
produced ES cell lines with genotypes Nkx2-5lacZ/+ and
Nkx2-5lacZ/+(
H),
both heterozygous null for Nkx2-5
(Biben et al., 2000
|
NH),
homozygous null for Nkx2-5 and expressing both eGFP and
ß-galactosidase under Nkx2-5 control.
In strategy III, we targeted one Nkx2-5 allele in wild-type ES
cells using a vector (Fig. 4C)
carrying a mutated YRD domain in which all nine tyrosines were mutated to
alanine (Y-A mutation; Fig.
1E), as well as a picornavirus internal ribosome entry site
(IRES)-lacZ gene cassette inserted into the 3' untranslated
region (Stanley et al., 2002
).
This strategy created ES cells with genotypes
Nkx2-5Y-A:IRESlacZ/+ and
Nkx2-5Y-A:IRESlacZ/+(
H),
heterozygous for the Y-A allele and expressing ß-galactosidase under
Nkx2-5 cis-regulatory control via IRES-mediated translational
initiation of a bicistronic mRNA.
Finally, in strategy IV, we targeted the remaining wild-type
Nkx2-5 allele in Nkx2-5GFP/+ ES cells with the
Y-A vector, creating ES cell lines with genotypes
Nkx2-5GFP/Y-A:IRESlacZ and
Nkx2-5GFP/Y-A:IRESlacZ(
NH),
expressing one Y-A allele in the context of the null GFP allele, and both eGFP
and ß-galactosidase under Nkx2-5 control.
To confirm correct marker expression in targeted clones, ES cells carrying
mutant genotypes were differentiated in vitro into embryoid bodies (EBs) until
day 5, then allowed to adhere to collagen-coated slides until day 9. Foci of
beating cardiomyocytes were evident in 90% of colonies. In both
Nkx2-5GFP/lacZ(
NH)
and
Nkx2-5GFP/Y-A:IRESlacZ(
NH)
EB colonies, eGFP fluorescence and lacZ staining were coincident with
each other, and with foci of beating cardiomyocytes (see Fig. S2A-D in the
supplementary material; data not shown). We also confirmed stable expression
of the Nkx2-5Y-A mutant protein using the EB system (see Fig. S2E-J in the
supplementary material).
Cardiomyocyte gene expression is altered in Nkx2-5GFP/Y-A:IRESlacZ embryoid bodies
Cardiomyocytes formed within differentiating EBs represent cells of
different states of chamber maturation and conduction phenotypes
(Fijnvandraat et al., 2003
).
To compare gene expression in eGFP-positive cardiocytes of different Nkx2-5
genotypes, we developed a protocol for purifying Nkx2-5-GFP-positive cells
from EBs using fluorescence-activated cell sorting (FACS) for eGFP
fluorescence (Fig. 5A).
Contamination with eGFP-negative cells was only 0.1-2% using this protocol.
Virtually all surviving cells (>99%) were beating after replating and
culture for 24 hours, suggesting that contamination with other cell types
capable of expressing Nkx2-5, including foregut endoderm
(Stanley et al., 2002
), was
minimal. eGFP-positive cells null for Nkx2-5
(Nkx2-5GFP/lacZ(
NH))
and those expressing only the Y-A mutant allele
(Nkx2-5GFP/Y-A:IRESlacZ(
NH))
showed similar fluorescence versus cell count profiles, but these profiles
were qualitatively different from that of cells heterozygous for the null eGFP
allele
(Nkx2-5GFP/+(
N))
(Fig. 5B).
|
),
Smpx (encoding Chisel) and Gja1 (encoding connexin 43).
Normalised to levels of gapd expression, all of these targets, with
the exception of Hand1, were downregulated significantly and to the
same extent in cardiomyocytes of the null
(Nkx2-5GFP/lacZ(
NH))
and YRD-over-null
(Nkx2-5GFP/Y-A:IRESlacZ(
NH))
mutant genotypes, relative to levels in FACS-purified heterozygous null
Nkx2-5 mutant cells
(Nkx2-5GFP/+(
N)).
Hand1was only moderately affected in null and Y-A mutant cells,
suggesting that its downregulation in Nkx2-5 mutant hearts
(Biben and Harvey, 1997
Analysis of YRD function in chimaeric embryos
To examine the phenotypic effects of the YRD mutation in whole embryos, we
created chimaeric embryos by injection of ES cells carrying
Nkx2-5lacZ/+(
N),
Nkx2-5GFP/lacZ(
NH) and
Nkx2-5GFP/Y-A:IRESlacZ(
NH)
genotypes into wild-type blastocysts. Injected blastocysts were surgically
transferred to pseudo-pregnant mothers for fostering, and embryos were
subsequently harvested at different stages of development for lacZ
staining and phenotypic analysis. For all genotypes, lacZ was
expressed with the correct pattern in the cardiac crescent at
7.75 dpc
and looping heart tube at
8.0 dpc
(Fig. 6A,B)
(Stanley et al., 2002
). In
Nkx2-5lacZ/+(
N)
wild-type chimaeras in which
there was a high contribution of ES cell progeny (judged by the extent of
lacZ staining in the heart; Fig.
6D,G), the heart looped normally at 9.0-9.5 dpc and heterozygous
cells had contributed to chamber and non-chamber myocardium, trabeculae and
extra-cardiac regions. Furthermore, these chimaeras transmitted the mutant
allele through the germline when taken to term. By contrast, high level
Nkx2-5GFP/lacZ(
NH)
wild-type and
Nkx2-5GFP/Y-A:IRESlacZ(
NH)
wild-type chimaeras
arrested development at
8.5 dpc, showing pericardial oedema, failure of
cardiac looping, lack of ventricular chamber discrimination, no trabeculation
and a truncated outflow tract (Fig.
6C,E,F,H,I), a close phenocopy of Nkx2-5-null mutant
hearts (Lyons et al.,
1995
).
|
H)
wild-type chimaeras at
progressively later gestational stages, comparing them with
Nkx2-5lacZ/+(
H)
wild-type (heterozygous null)
chimaeras as controls. We found that all moderate to high-level Y-A chimaeras
examined at a gross level (n=25) succumbed just prior to birth from
multiple cardiac malformations, while control chimaeras (n=50) showed
normal morphology and survived beyond birth. Three independently derived
clonal Y-A mutant ES cell lines gave identical results.
As early as 14.5 dpc, high-level Y-A mutant chimaeric hearts were enlarged,
had a rounded apex and showed dilated ventricles and grossly dilated right
atria (Fig. 7A-D). On their
external surface, we observed unusual finger-like protrusions that were
positive for lacZ, indicating that they were composed of mutant cells
(Fig. 7B,C,G,H). Overall, Y-A
mutant chimaeras expressed lower levels of Myl2 (encoding myosin
light chain 2v), known to be dependent upon Nkx2-5 during development
(Lyons et al., 1995
)
(Fig. 7E,F). Myl2
downregulation was exaggerated in patches that probably correspond to areas
populated predominantly by mutant cells
(Fig. 7E,F); indeed, the
finger-like projections expressed lower levels of Myl2 compared to
surrounding myocardium (Fig.
7J, brackets). A blistering within the epicardium and between
epicardium and myocardium was also a common feature
(Fig. 7I, brackets).
Histological examination showed that the right ventricular wall in Y-A
chimaeras was thin and hyper-trabeculated, reminiscent of ventricular
non-compaction in humans (Pashmforoush et
al., 2004
) (Fig.
7K,L,M). The inter-ventricular septum was often fenestrated
(Fig. 7L), or showed frank
ventricular septal defect (VSD; n=5/8)
(Fig. 7F,M). Transmural lesions
of ventricular free wall were also occasionally detected (usually plugged with
a blood clot) and these were surrounded by mutant cells
(Fig. 7N; data not shown).
Tricuspid valves were absent or hypoplastic (n=8/8) and, when
present, were conical in shape with leaflets sitting below the annulus and
partially fused to the interventricular septum or ventricular free wall
(Fig. 7O,P). These are
classical features of Ebstein's anomaly, which occurs occasionally in humans
with NKX2.5 mutations (Benson et
al., 1999
). Mitral valves were relatively normal. In the atria,
the trabecular pattern was finer and more florid than in control hearts
(Fig. 7E,F,H; data not shown),
although this is likely to be secondary to dilation, as atrial trabeculae were
not always composed of mutant cells (Fig.
7D).
Nkx2-5 has been suggested to confer resistance to cell death-inducing
treatments (Monzen et al.,
2002
). To examine whether cell death due to compromised myocardium
was a feature of the Y-A mutant phenotype, we compared the prevalence of
apoptosis in atria and ventricular free walls of
Nkx2-5Y-A:IRESlacZ/+(
H)
wild-type (Y-A
heterozygous) and control
Nkx2-5lacZ/+(
H)
wild-type (null heterozygous)
chimaeras at 14.5 dpc using the TUNEL assay. We chose this stage of analysis
to be well before the systemic demise seen in mutant chimaeras. In the atria
of Y-A chimaeras, TUNEL-positive cells were 3.34-fold more evident than in
controls [4.93±0.59 (mean±s.e.m.) versus 1.48±0.22,
P<0.005], while in the ventricular free walls there was a
3.24-fold difference (9.40±0.95 versus 2.90±0.27,
P<0.008).
|
| DISCUSSION |
|---|
|
|
|---|
The YRD of mouse Nkx2-5 minimally encompasses a region of 37 amino acids
with 24% (9/37) being tyrosine. A similar density of tyrosines, with
occasional conservative substitutions to phenylalanine, are present in all
known vertebrate and chordate members of the cardiac clade of NK2 homeodomain
proteins. Other amino acids within the YRD are also highly conserved. However,
the YRD and other conserved domains in the C terminus of Nkx2-5
(Fig. 2A), are lacking in
Drosophila Tinman. We show here that in cardiac NK2 proteins from
cephalopod molluscs, highly active invertebrates that possess a sophisticated
closed cardiovascular system, the YRD and three of the conserved Nkx2-5
C-terminal signature domains are present. Thus, the YRD has co-evolved with
the homeodomain since before divergence of the vertebrate and invertebrate
lines some 550 million years ago. Tyrosine-rich regions, possibly ancestral
YRDs, are recognisable C-terminal to the homeodomain in NK2-class proteins
from C. elegans, mosquito, honeybee, hydra and sea anemone, the last
two being members of the diploblastic phylum cnidaria (see
Fig. 2A). A YRD-like element is
also seen in Drosophila bagpipe-related genes. The YRD may therefore
have a truly ancient origin in metazoan evolution. We have previously
suggested that Tinman and Nkx2-5 have diverged mechanistically, as evidenced
by the inability of Nkx2-5 to rescue heart development in Tinman mutant flies
(Ranganayakulu et al., 1998
).
Our data now show that the domain structure of Tinman is in fact highly
derived, highlighting a dramatic example of protein evolution within an
otherwise conserved pathway. Protein evolution of this sort has been described
in other selector gene pathways, for example, those involving
Drosophila homeotic proteins Ubx and Hox3, and segmentation protein
fushi tarazu (Mann and Carroll,
2002
). In Tinman, loss of C-terminal domains may have coincided
with gain of an alternative cardiogenic mechanism involving an N-terminal
domain (Ranganayakulu et al.,
1998
).
In mouse Nkx2-5, the YRD is essential for the earliest stages of cardiac
development. Cardiomyocytes purified by FACS from EBs expressing only the
Nkx2-5Y-A allele possessed the same gene expression signature defects as fully
null cardiocytes. Importantly, chimaeras bearing a high investment of Y-A
mutant cells showed a phenocopy of the genetic null mutant. The strongly
compromised nature of the Y-A allele was also demonstrated by the phenotype of
chimaeras carrying heterozygous Nkx2-5Y-A:IRESlacZ/+ ES
cells. These chimaeras died in the immediate pre-natal period with a
constellation of severe heart malformations, whereas high-level chimaeras made
from heterozygous Nkx2-5lacZ/+ ES cells showed normal
heart development. It is evident from these experiments that the Y-A mutation
is effectively null in vivo, and in the presence of wild-type protein has a
strong dominant-negative-like activity, producing phenotypes far stronger than
haploinsufficiency. The potency of this effect is truly remarkable
while rare genes display haploinsufficiency in adults sufficient to cause
difficulties in maintaining a genetically modified line
(Bruneau et al., 2001
),
chimaeras carrying heterozygous Nkx2-5Y-A ES cells all succumbed at foetal
stages.
It is noteworthy that in null and Y-A mutant EBs, there was an increase in the mean level of GFP fluorescence on FACS profiles relative to that seen in heterozygous null cells (Fig. 5B). Furthermore, in Nkx2-5GFP/Y-A mutant chimaeras, lacZ appeared to be upregulated dorsal to the heart compared with Nkx2-5GFP/LacZ chimaeras (Fig. 6E,F). Our recent microarray data on RNA from Nkx2-5 heterozygous and null mutant hearts suggest that this increase is due to the loss of an Nkx2-5 negative auto-regulatory feedback loop in the nulls (O. Prall and R.P.H., unpublished).
One tyrosine codon within the YRD of human NKX2.5 has been found
to be mutated to a nonsense codon in a CHD family, with individuals over three
generations displaying a spectrum of cardiac malformations identical to that
seen in families with homeodomain mutations
(Benson et al., 1999
). This
change disrupts the YRD and eliminates downstream amino acids. The
characteristics of this mutation further highlight the importance of
C-terminal domains for NKX2-5 function in vivo.
Although the YRD is essential for Nkx2-5 function in vivo, our experiments
do not address directly the mechanism of its action. Nkx2-5 acts in positive
synergy with other transcription factors to activate or repress expression of
genes encoding both cardiac transcription factors and chamber differentiation
proteins. These functions are consistent with a role for Nkx2-5 as a
high-level selector protein (Mann and
Carroll, 2002
). The repressive activities of Nkx2-5 appear to be
mediated through the TN-domain and C terminus. The TN domain has been shown to
bind to the Groucho family of co-repressors
(Muhr et al., 2001
), whereas
the C terminus carries an activity that represses the strong N-terminal
trans-activation domain (Sepulveda et al.,
1998
). Owing to the presence of negative modulatory domains, the
transcriptional activity of Nkx2-5 in vitro is therefore latent, but can be
unmasked if all C-terminal amino acids are deleted, or when other cardiac
transcription factors that directly interact with Nkx2-5 are co-expressed.
Mutagenesis shows that the NK2SD acts as a negative modulator of Nkx2-5
transcription (Ranganayakulu et al.,
1998
; Sepulveda et al.,
1998
) and, when isolated from Nkx2-5, it can repress the strong
trans-activation domains of the viral protein, VP16, in cis
(Watada et al., 2000
).
The YRD, which has positive transcriptional activity in vitro when fused to
Gal4 DBD, may contribute to the positive activities of Nkx2-5. It could also
serve to integrate its positive and negative functions. We note that the
ability of Nkx2-5 C-terminal amino acids to repress the N-terminal
trans-activation domain was intact in the YRD mutant, as was its ability to
collaborate with GATA4/5, Tbx2/5/20, SRF and myocardin on the Nppa
promoter (see Fig. S1 in the supplementary material). The activity of the
Nkx2-5Y-A mutant on the Gja5 promoter in the presence of Tbx20 and
Gata5 was compromised, albeit only weakly (
50%). Therefore, the impact of
YRD mutation within the context of Nkx2-5 in vitro is subtle at best. New
assays that more robustly model its in vivo function await development.
Other homeoproteins possess accessory domains that are essential for their
function and target specificity, and such inter-dependent relationships may
have been necessary for expansion of the homeobox gene family and
diversification of its functional repertoire. In the case of Pax transcription
factors, for example, the paired domain and paired homeodomain act
interdependently as a bipartite structure, with the paired domain influencing
the DNA-binding properties of the homeodomain
(Mann and Carroll, 2002
). The
YRD could also act in this way for NK2-class homeodomains, or attract
accessory proteins that modulate chromatin or transcriptional activity in
other ways.
Haploinsufficiency for Nkx2-5 in mice leads to cardiac phenotypes
that are much less severe than those seen in humans heterozygous for
NKX2.5 mutations: frank ASD occurs in 1% of mutant mice but in more
than 70% of humans; conduction system defects, although evident in mice, are
mild and do not progress to second and third degree conduction block as in
humans (Biben et al., 2000
).
The significantly more severe human phenotypes may be due to subtle
differences in the cardiac genetic program between species or the
dominant-negative nature of some human mutations
(Kasahara and Benson, 2004
).
Importantly, however, an animal model that accurately reflects the
developmental defects seen in individuals with NKX2.5 mutations is
lacking. We show here that in chimaeric mice, the Nkx2-5Y-A allele produces a
spectrum of cardiac phenotypes that overlaps with the more severe anomalies
seen in the human disease. ASD, VSD, valvular anomalies, dilated
cardiomyopathy and ventricular non-compaction are all components of
NKX2.5 mutant pathology. Increased myocyte death, presumably in
response to reduced resistance to biomechanical stress, is also evident in
chimaeras, and could be an unidentified component of the human disease.
Indeed, we have recently also discovered a novel NKX2.5 mutation in a
human family with dilated cardiomyopathy, and ASD and conduction defects
(Diane Fatkin and R.P.H., unpublished). Although molecular pathways remain to
be elucidated, it is likely that the structural integrity of mutant myocytes
and cellular adhesion between them is compromised in Nkx2-5Y-A chimaeras, as
suggested by phenotypes involving downregulation of myofilament gene
Myl2, transmural lesions, blistering between epicardium and
myocardium, and the possible `streaming' of myocytes into finger-like
protrusions. We have recently developed a hypomorphic genetic model of Nkx2-5
function in mouse that has phenotypic manifestations similar to those seen in
hearts of Y-A mutant chimaeras (O. Prall and R.P.H., unpublished). Our new
models should offer valuable opportunities for further understanding of the
complex and varied phenotypic manifestations of NKX2.5 mutations.
Furthermore, experiments focused on the specific role of the YRD should expand
our understanding of cardiac developmental pathways and CHD.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/133/7/1311/DC1
* These authors contributed equally to this work ![]()
Present address: The Wellcome Trust/Cancer Research UK Gurdon Institute,
University of Cambridge, Tennis Court Road, Cambridge CB2 1QR, UK ![]()
Present address: Genentech, Molecular Biology Department, 1 DNA Way, South
San Francisco, CA 94080-4990, USA ![]()
Present address: Max Planck Institute for Molecular Genetics,
Cardiovascular Genetics, Ihnestrasse 73, 14195 Berlin, Germany ![]()
| REFERENCES |
|---|
|
|
|---|
Azpiazu, N. and Frasch, M. (1993).
tinman and bagpipe: two homeo box genes that determine cell
fates in the dorsal mesoderm of Drosophila. Genes Dev.
7,1325
-1340.
Bader, A., Gruss, A., Hollrigl, A., Al-Dubai, H., Capetanaki, Y. and Weitzer, G. (2001). Paracrine promotion of cardiomyogenesis in embryoid bodies by LIF modulated endoderm. Differentiation 68,31 -43.[CrossRef][Medline]
Baugh, L. R., Hill, A. A., Brown, E. L. and Hunter, C. P. (2001). Quantitative analysis of mRNA amplification by in vitro transcription. Nucleic Acids Res. 29, E29.[CrossRef][Medline]
Benson, D. W., Silberbach, G. M., Kavanaugh-McHugh, A., Cottrill, C., Zhang, Y., Riggs, S., Smalls, O., Johnson, M. C., Watson, M. S., Seidman, J. G. et al. (1999). Mutations in the cardiac transcription factor NKX2.5 affect diverse cardiac developmental pathways. J. Clin. Invest. 104,1567 -1573.[Medline]
Biben, C. and Harvey, R. P. (1997). Homeodomain
factor Nkx2-5 controls left-right asymmetric expression of bHLH eHand
during murine heart development. Genes Dev.
11,1357
-1369.
Biben, C., Weber, R., Kesteven, S., Stanley, E., McDonald, L.,
Elliott, D. A., Barnett, L., Koentgen, F., Robb, L., Feneley, M. et al.
(2000). Cardiac septal and valvular dysmorphogenesis in mice
heterozygous for mutations in the homeobox gene Nkx2-5. Circ.
Res. 87,888
-895.
Bodmer, R. (1993). The gene tinman is required for specification of the heart and visceral muscles in Drosophila. Development 118,719 -729.[Abstract]
Bruneau, B. G., Bao, Z.-Z., Tanaka, M., Schott, J.-J., Izumo, S., Cepko, C. L., Seidman, J. G. and Seidman, C. E. (2000). Cardiac expression of the ventricle-specific homeobox gene Irx4 is modulated by Nkx2-5 and dHand. Dev. Biol. 217,266 -277.[CrossRef][Medline]
Bruneau, B. G., Nemer, G., Schmitt, J. P., Charron, F., Robitaille, L., Caron, S., Conner, D. A., Gessler, M., Nemer, M., Seidman, C. E. et al. (2001). A murine model of Holt-Oram syndrome defines roles of the T-box transcription factor Tbx5 in cardiogenesis and disease. Cell 106,709 -721.[CrossRef][Medline]
Charron, F., Tsimiklis, G., Arcand, M., Robitaille, L., Liang,
Q., Molkentin, J. D., Meloche, S. and Nemer, M. (2001).
Tissue-specific GATA factors are transcriptional effectors of the small GTPase
RhoA. Genes Dev. 15,2702
-2719.
Chen, C. Y. and Schwartz, R. J. (1996). Recruitment of the tinman homolog Nkx-2.5 by serum response factor activates cardiac alpha-actin gene transcription. Mol. Cell. Biol. 16,6372 -6384.[Abstract]
Chen, F., Kook, H., Milewski, R., Gitler, J. P., Lu, M. M., Li, J., Nazarian, R., Schnepp, R., Jen, K., Biben, C. et al. (2002). Hop is an unusual homeobox gene that modulates cardiac development. Cell 110,713 -723.[CrossRef][Medline]
Choi, C. Y., Lee, Y. M., Kim, Y. H., Park, T., Jeon, B. H.,
Schulz, R. A. and Kim, Y. (1999). The homeodomain
transcription factor NK-4 acts as either a transcriptional activator or
repressor and interacts with the p300 coactivator and the Groucho corepressor.
J. Biol. Chem. 274,31543
-31552.
Cripps, R. M. and Olson, E. N. (2002). Control of cardiac development by an evolutionarily conserved transcriptional network. Dev. Biol. 246,14 -28.[CrossRef][Medline]
Durocher, D., Charron, F., Warren, R., Schwartz, R. J. and Nemer, M. (1997). The cardiac transcription factors Nkx2-5 and GATA-4 are mutual cofactors. EMBO J. 16,5687 -5696.[CrossRef][Medline]
Elliott, D. A., Kirk, E. P., Yeoh, T., Chandar, S., McKenzie,
F., Taylor, P., Grossfeld, P., Fatkin, D., Jones, O., Hayes, P. et al.
(2003). Cardiac homeobox gene NKX2-5 mutations and congenital
heart disease: associations with atrial septal defect and hypoplastic left
heart syndrome. J. Am. Coll. Cardiol.
41,2072
-2076.
Engelmann, G. L. (1993). Coordinate gene
expression during neonatal rat heart development. A possible role for the
myocyte in extracellular matrix biogenesis and capillary angiogenesis.
Cardiovasc. Res. 27,1598
-1605.
Evans, S. (1999). Vertebrate tinman homologues and cardiac differentiation. Semin. Cell Dev. Biol. 10, 73-83.[CrossRef][Medline]
Fijnvandraat, A. C., van Ginneken, A. C., Schumacher, C. A., Boheler, K. R., Lekanne Deprez, R. H., Christoffels, V. M. and Moorman, A. F. (2003). Cardiomyocytes purified from differentiated embryonic stem cells exhibit characteristics of early chamber myocardium. J. Mol. Cell. Cardiol. 35,1461 -1472.[CrossRef][Medline]
Fye, W. B. (1987). The origin of the heart
beat: a tale of frogs, jellyfish, and turtles.
Circulation 76,493
-500.
Grow, M. W. and Krieg, P. A. (1998). Tinman function is essential for vertebrate heart development: elimination of cardiac differentiation by dominant inhibitory mutants of the tinman-related genes, XNkx2-3 and XNkx2-5. Dev. Biol. 204,187 -196.[CrossRef][Medline]
Habets, P. E., Moorman, A. F., Clout, D. E., van Roon, M. A.,
Lingbeek, M., van Lohuizen, M., Campione, M. and Christoffels, V. M.
(2002). Cooperative action of Tbx2 and Nkx2.5 inhibits ANF
expression in the atrioventricular canal: implications for cardiac chamber
formation. Genes Dev.
16,1234
-1246.
Halfon, M. S., Carmena, A., Gisselbrecht, S., Sackerson, C. M., Jimenez, F., Baylies, M. K. and Michaelson, A. M. (2000). Ras pathway specificity is determined by the integration of multiple signal-acivated and tissue-restricted transcription factors. Cell 103,63 -74.[CrossRef][Medline]
Harvey, R. P. (1996). NK-2 homeobox genes and heart development. Dev. Biol. 178,203 -216.[CrossRef][Medline]
Haun, C., Alexander, J., Stainier, D. Y. and Okkema, P. G.
(1998). Rescue of caenorhabditis elegans pharyngeal development
by a vertebrate heart specification gene. Proc. Natl. Acad. Sci.
USA 95,5072
-5075.
Hiroi, Y., Kudoh, S., Monzen, K., Ikeda, Y., Yazaki, Y., Nagai, R. and Komuro, I. (2001). Tbx5 associates with Nkx2-5 and synergistically promotes cardiomyocyte differentiation. Nat. Genet. 28,276 -280.[CrossRef][Medline]
Holland, N. D., Venkatesh, T. V., Holland, L. Z., Jacobs, D. K. and Bodmer, R. (2003). AmphiNK2-tin, an amphioxus homeobox gene expressed in myocardial progenitors: insights into evolution of the vertebrate heart. Dev. Biol. 255,128 -137.[CrossRef][Medline]
Jay, P. Y., Harris, B. S., Maguire, C. T., Buerger, A., Wakimoto, H., Tanaka, M., Kuperschmidt, S., Roden, D. M., Schultheiss, T. M., O'Brien, T. X. et al. (2004). Nkx2-5 mutation causes anatomic hypoplasia of the cardiac conduction system. J. Clin. Invest. 113,1130 -1137.[CrossRef][Medline]
Kasahara, H. and Benson, D. W. (2004).
Biochemical analyses of eight NKX2.5 homeodomain missense mutations
causing atrioventricular block and cardiac anomalies. Cardiovasc.
Res. 64,40
-51.
Kasahara, H., Lee, B., Schott, J. J., Benson, D. W., Seidman, J. G., Seidman, C. E. and Izumo, S. (2000). Loss of function and inhibitory effects of human CSX/NKX2.5 homeoprotein mutations associated with congenital heart disease. J. Clin. Invest. 106,299 -308.[Medline]
Kortschak, R. D., Samuel, G., Saint, R. and Miller, D. J. (2003). EST analysis of the cnidarian Acropora millepora reveals extensive gene loss and rapid sequence divergence in the model invertebrates. Curr. Biol. 13,2190 -2195.[CrossRef][Medline]
Lyons, I., Parsons, L. M., Hartley, L., Li, R., Andrews, J. E.,
Robb, L. and Harvey, R. P. (1995). Myogenic and morphogenetic
defects in the heart tubes of murine embryos lacking the homeobox gene
Nkx2-5. Genes Dev. 9,1654
-1666.
Mann, R. and Carroll, S. B. (2002). Molecular mechanisms of selector gene function and evolution. Curr. Opin. Genet. Dev. 12,592 -600.[CrossRef][Medline]
McElhinney, D. B., Geiger, E., Blinder, J., Benson, D. W. and
Goldmuntz, E. (2003). NKX2.5 mutations in patients with
congenital heart disease. J. Am. Coll. Cardiol.
42,1650
-1655.
McKinsey, T. A., Zhang, C.-L., Lu, J. and Olson, E. N. (2000). Signal-dependent nuclear export of a histone deacetylase regulates muscle differentiation. Nature 408,106 -111.[CrossRef][Medline]
Molkentin, J. D., Antos, C., Mercer, B., Taigen, T., Miano, J. M. and Olson, E. N. (2000). Direct activation of a GATA6 cardiac enhancer by Nkx2.5: evidence for a reinforcing regulatory network of Nkx2.5 and GATA transcription factors in the developing heart. Dev. Biol. 217,301 -309.[CrossRef][Medline]
Monzen, K., Zhu, W., Kasai, H., Hiroi, Y., Hosoda, T., Akazawa, H., Zou, Y., Hayashi, D., Yamazaki, T., Nagai, R. et al. (2002). Dual effects of the homeobox transcription factor Csx/Nkx2-5 on cardiomyocytes. Biochem. Biophys. Res. Commun. 298,493 -500.[CrossRef][Medline]
Muhr, J., Andersson, E., Persson, M., Jessell, T. M. and Ericson, J. (2001). Groucho-mediated transcriptional repression establishes progenitor cell pattern and neuronal fate in the ventral neural tube. Cell 104,861 -873.[CrossRef][Medline]
Okkema, P. G., Ha, E., Haun, C., Chen, W. and Fire, A. (1997). The Caenorhabditis elegans NK-2 homeobox gene ceh-22 activates pharyngeal muscle gene expression in combination with pha-1 and is required for normal pharyngeal development. Development 124,3965 -3973.[Abstract]
Park, M., Lewis, C., Turbay, D., Chung, A., Chen, J. N., Evans,
S., Breitbart, R. E., Fishman, M. C., Izumo, S. and Bodmer, R.
(1998). Differential rescue of visceral and cardiac defects in
Drosophila by vertebrate tinman-related genes. Proc. Natl. Acad.
Sci. USA 95,9366
-9371.
Pashmforoush, M., Lu, J. T., Chen, H., St Amand, T., Kondo, R., Pradervand, S., Evans, S., Clark, B., Feramisco, J. R., Giles, W. et al. (2004). Nkx2-5 pathways and congenital heart disease: loss of ventricular myocyte lineage specification leads to progressive cardiomyopathy and complete heart block. Cell 117,373 -386.[CrossRef][Medline]
Raffin, M., Leong, L. M., Rones, M. S., Sparrow, D., Mohun, T. and Mercola, M. (2000). Subdivision of the cardiac Nkx2.5 expression domain into myogenic and nonmyogenic compartments. Dev. Biol. 218,326 -340.[CrossRef]