|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 15 March 2006
doi: 10.1242/dev.02303
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Cell Biology, Duke University Medical Center, Durham, NC 27710, USA
* Author for correspondence (e-mail: b.capel{at}cellbio.duke.edu)
Accepted 31 January 2006
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key words: Fgf9, Fetal testis, Gonad, Germ cell
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
; Koopman et
al., 1991; Gubbay et al.,
1992). Although Sry expression is initiated at 10.5 days
post coitum (dpc), the gonad is still highly plastic at 11.5 dpc in mice and
is capable of ovarian or testicular differentiation
(Tilmann and Capel, 1999). By
12.0 dpc, gonads that expressed Sry have initiated the male pathway
and are morphologically distinct from female gonads. Although no direct
downstream targets of Sry have been definitively identified,
upregulation of a number of genes, including Sry-like HMG-box protein
9 (Sox9) (Wright et al.,
1995; da Silva et al.,
1996), desert hedgehog (Dhh)
(Bitgood et al., 1996;
Yao et al., 2002), platelet
derived growth factor receptor 
(Pdgfra)
(Brennan et al., 2003),
anti-Müllerian hormone (Amh)
(Behringer et al., 1994) and
fibroblast growth factor 9 (Fgf9)
(Colvin et al., 2001), occurs
in somatic cells of the XY gonad. Interestingly, expression of either
Sry or Sox9 in gonadal somatic cells is sufficient to induce
the differentiation of Sertoli cells
(Koopman et al., 1991;
Bishop et al., 2000;
Vidal et al., 2001). Sertoli
cells are a male-specific somatic cell type that drive testis development and
organize male morphology by sequestering germ cells inside testis cords
(reviewed by McLaren, 1991;
Brennan and Capel, 2004).
In mice, primordial germ cells (PGCs) are specified at the base of the
allantois around 7.5 dpc (Chiquoine,
1954; Mintz and Russell,
1957; Ginsburg et al.,
1990; Tam and Zhou,
1996; Saitou et al.,
2002). From there, they divide, migrate through the gut mesentery
and enter the forming gonad between 10.0 and 11.5 dpc
(Ginsburg et al., 1990;
Anderson et al., 2000). In the
early stages of their development, mouse XX and XY germ cells behave in an
identical manner with respect to their formation, proliferation and migration
(reviewed in Wylie, 1999;
McLaren, 2003;
Molyneaux et al., 2004). Once
in the gonad, PGCs are termed gonocytes and become the precursors of oogonia
in the adult ovary or spermatogonia in the adult testis. Moreover, when
gonocytes find themselves in a gonad of the alternate sex, they conform to the
sex of the gonad (Adams and McLaren,
2002). Gonocytes number 
3000 at 11.5 dpc
(Tam and Snow, 1981) and
continue to divide mitotically until 13.5 dpc when they enter meiosis in
ovaries or mitotic arrest in testes
(McLaren, 2000;
Adams and McLaren, 2002)
(reviewed by McLaren, 2003).
Gonocyte mitotic arrest in testes is known to be dependent upon masculinizing
interactions between germ cells and somatic cells in XY gonads (reviewed by
McLaren, 2003). Gonocyte entry
into meiosis in ovaries has been considered to be cell-autonomous, although it
should be noted that recent evidence suggests that this process may be
influenced by somatic cues (Menke et al.,
2003; Koubova et al.,
2006).
As there are no apparent differences in the rate of proliferation between
XX and XY gonocytes between 10.5 and 13.5 dpc (reviewed by
McLaren, 2003;
Schmahl and Capel, 2003), it
had been assumed that gonocyte survival and proliferation were under similar
regulatory control at early stages. However, the mouse Vasa homolog
(Mvh; Ddx4 – Mouse Genome Informatics) was recently
shown to differentially affect gonocyte proliferation in XY gonads between
11.5 and 12.5 dpc (Tanaka et al.,
2000). This indicates that although no phenotypic difference has
been detected in germ cells at these stages, the underlying pathways
regulating them are different.
Fibroblast growth factors (FGFs) are known to play a role in the
proliferation and survival of many cell types (reviewed by
Ornitz and Itoh, 2001).
Fgf9-null mutant mice die shortly after birth owing to defects in
lung formation, but XY embryos also present with phenotypic male-to-female
sex-reversal (Colvin et al.,
2001). Although, Fgf9 is expressed in XX and XY gonads at
11.5 dpc, it becomes XY specific by 12.5 dpc and is expressed throughout
testis cords (Schmahl et al.,
2004). Testis differentiation is disrupted in Fgf9
mutants as the result of a failure of Sertoli precursors to proliferate and
differentiate into Sertoli cells (Schmahl
et al., 2004).
Here, we show that, although Sry is initially expressed, testis differentiation is aborted in XY Fgf9 gonads, and the majority of germ cells (97%) are lost through cell death by 12.5 dpc. We also demonstrate that, XY Fgf9–/– gonads begin to express ovarian markers by 12.5 dpc and contain meiotic gonocytes at 14.5 dpc. Our data indicate that FGF9 acts independently of its role in Sertoli cell differentiation to promote germ cell survival in XY, but not XX, gonads.
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
).
For more precise staging, the number of tail somites (ts) between the hind
limb and the tip of the tail were counted at the time of dissection
(Hacker et al., 1995). Using
this method, 10.5 dpc corresponds to 8 ts, 11.5 dpc to 18 ts and 12.5 dpc to
30 ts. Genotypes were determined by PCR as previously described for
Fgf9 (Colvin et al.,
2001), Oct4:GFP
(Anderson et al., 1999) and
XXSryMyc (Sekido et
al., 2004). Mice carrying the Fgf9 deletion are
maintained on the C57BL/6 J background as described by Schmahl et al.
(Schmahl et al., 2004).
Oct4:GFP mice are maintained on the C57BL/6 J background.
XXSryMyc; Fgf9 mice are maintained on a mixed
DBA; C57BL/6 J background. On this mixed background,
XXSryMyc; Fgf9–/– mice
fail to form testis cords.
Alkaline phosphatase staining and germ cell counting
The alkaline phosphatase staining procedure was modified from Lawson et al.
(Lawson et al., 1999).
Briefly, embryos or genital ridges were dissected and fixed in 4%
paraformaldehyde for 2 hours at 4°C, rinsed in PBS and then placed in 70%
ethanol for over 2 hours with rocking at room temperature. Samples were then
stained using -naphthyl phosphate/Fast Red TR (Sigma F-8764)
(Ginsburg et al., 1990) and
cleared in 70% glycerol. Squash preps of embryos were made and total germ
cells were counted using a cell counter. For later stages, samples were sliced
into several pieces which were then made into squash preps. The number of germ
cells per genotype was compared using the Student's t-test.
Organ and gonocyte culture
Organ cultures were performed as previously described
(Martineau et al., 1997).
Briefly, genital ridges were cultured at 37°C with 5% CO2/95%
air on a 1.5% agar block in Dulbecco's Minimal Eagle Medium (DMEM),
supplemented with 10% fetal calf serum (BioWhittaker, Lot # 013987) and 50
µg/ml ampicillin. Human recombinant FGF9 (25 ng/ml, R&D Systems) was
added to the culture medium as designated. An equivalent volume of carrier
(PBS) was added to control organ cultures. The number of germ cells and
Sertoli cells was compared using the Student's t-test. Gonocytes were
purified for culture using a protocol modified from MacKay et al.
(MacKay et al., 1999) with the
supernatant taken in lieu of the pellet. Briefly, gonads from
Oct4:GFP (Anderson et al.,
2000) animals separated from mesonephroi were washed in
Ca2+- and Mg2+-free Hanks Buffer without Phenol Red. XX
and XY gonads were pooled separately (between 2 and 16 each per litter), then
enzymatically disrupted using 0.025% collagenase and 0.025% trypsin at
37°C for 5 minutes. Gonads were washed twice in Ca2+- and
Mg2+-free Hanks Buffer without Phenol Red and mechanically
dispersed using a pipette. This solution was centrifuged for 1 minute at 100
g. The supernatant was removed and re-spun at 100
g three more times. The final spin at 1000 g
for 3 minutes pelleted the germ cells. Supernatant was removed and germ cells
were resuspended in the desired volume of DMEM with or without FGF2, FGF7,
FGF9 or FGF16 (233-FB, 251-KG, 273-F9 and 1212-FG respectively; R&D
Systems). Two gonad equivalents of germ cells were used for each timepoint.
Gonocytes were placed into culture within 1 hour of genital ridge dissection.
Roughly 20-30% of preparations were at least 95% pure gonocytes. Purity was
confirmed by GFP expression examined using a fluorescent microscope. The WST-1
reagent (Roche) was used per instructions as a metabolic indicator. Conversion
of WST-1 was measured using an ELISA plate reader (BioRad). Briefly, WST-1 is
added to culture wells to a final concentration of 10% WST-1. Wells are then
incubated for 2 hours at 37°C and subsequently measured for absorbance.
WST-1 conversion of the samples was compared using ANOVA.
Reverse transcriptase PCR (RT-PCR) and quantitative PCR (QPCR)
Gonads were separated from mesonephroi and RNA was isolated from the gonads
alone using RNeasy (Qiagen). Reverse transcription reactions were performed
using the IScript cDNA Synthesis Kit (BioRad). The BioRad MyiQ iCycler was
used per manufacturer's instructions. The iCycler software was used for QPCR
data analysis. Primers for Sry were AGTTCCATGACCACCACCAC and
ATGGAACTGCTGCTTCTGCT; primers for hypoxanthine guanine phosphoribosyl
transferase 1 (Hprt1) were TGGACTGATTATGGACAGGACTGAA and
TCCAGCAGGTCAGCAAAGAACT. Sry expression was normalized to
Hprt1 and compared using the Student's t-test.
Immunofluorescence and in situ hybridization
Gonad/mesonephroi complexes were dissected or removed from culture and
fixed in 4% paraformaldehyde overnight at 4°C, washed in PBS, and blocked
in PBS with 5% BSA, 1% heat-inactivated goat serum and 0.1% Triton X-100 for 1
hour at room temperature before staining with antibodies. For
immunohistochemistry, antibodies against PECAM (Pharmingen; 1:500 dilution),
E-Cadherin (Zymed; 1:200), SOX9 (the kind gift of Francis Poulat, 1:1000),
H2AX (the kind gift of William Bonner, 1:800) or laminin (the kind gift
of Harold Erikson, 1:500) were added to the blocking solution and were
incubated rocking at 4°C overnight. Samples were rinsed three times for 30
minutes in PBT (PBS and 0.1% Triton X-100) with 5% BSA and 0.1%
heat-inactivated goat serum, and incubated overnight at 4°C in blocking
solution with Cy2-, Cy3- or Cy5-conjugated secondary antibodies (1:500;
Jackson Laboratories). Samples were washed three times for 30 minutes in PBT
and mounted in DABCO for confocal microscopy with a Zeiss LSM 410
laser-scanning confocal microscope. LysoTracker Red DND-99 (Molecular Probes)
was used to measure cell death per instructions. Briefly, gonads were
dissected and placed into 1 ml DMEM with 5 µl of 1 mM LysoTracker Red
DND-99 for 30 minutes. They were then washed four times in PBS for 30 minutes
per wash and then fixed and processed for immunohistochemistry. For
LysoTracker and H2AX, the total number of positive and/or negative
cells per gonad was counted via optical sectioning and compared using the
Student's t-test. Whole-mount in situ hybridization was performed as
previously described using NBT/BCIP
(Wilkinson and Nieto, 1993)
with probes for Bmp2 and Fst
(Yao et al., 2004).
|
|
RESULTS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). At 12.5 dpc, gonocyte numbers appeared qualitatively normal
in controls and in the XX Fgf9–/– gonads;
however, germ cell numbers were greatly reduced in the XY
Fgf9–/– mutants
(Fig. 1A). We then quantified
this loss by counting total gonocyte numbers in the Fgf9 mutants from
stages 7.5 to 12.5 dpc (Fig.
1B, stages 11.5-12.5 dpc shown). Germ cell numbers were similar to
expected values (Tam and Snow,
1981; Lawson and Hage,
1994; McLaren,
2000) in mutants and controls through 11.5 dpc. However, by 12.5
dpc gonocyte numbers were significantly reduced in XY Fgf9-null
mutants compared with controls and 11.5 dpc XX null mutants
(P<0.001). The number of gonocytes per embryo declined from a
maximum at 11.5 dpc and reached a plateau at 389±31.3 after 12.5 dpc
(Fig. 1B). We then examined
later stages and observed no further decrease in germ cell numbers through
16.5 dpc (data not shown).
XY Fgf9–/– germ cells display elevated levels of cell death
Although gonocyte proliferation is reduced in XY
Fgf9–/– gonads
(Schmahl et al., 2004), cell
counts indicated that numbers of gonocytes actually declined between 11.5 dpc
and 12.5 dpc. This indicated that the gonocyte phenotype cannot be due solely
to a defect in proliferation. Using LysoTracker Red DND-99 (Molecular Probes),
which detects increased cellular pH associated with cell death, we
investigated whether the XY Fgf9-null gonads had increased levels of
cell death at 11.5, 12.0 and 12.5 dpc (Fig.
2). Cells in XX and XY Fgf9+/– and XX
Fgf9–/– gonads have a very low basal level of
cell death between 11.5 and 12.5 dpc (Fig.
2A-I). XY Fgf9–/– gonads show
greater numbers of dying germ cells than XY controls at these three stages
(Fig. 2J-L). The maximum level
of germ cell loss is seen in XY Fgf9–/– gonads
at 12.0 dpc (Fig. 2K) and
returns to basal levels after 12.5 dpc (data not shown). We detected no
somatic cell death in these gonads between 11.5 dpc and 12.5 dpc.
|
|
Although Sry is initially expressed in XY Fgf9 nulls,
testis development is disrupted by 12.0 dpc
(Fig. 2K). Therefore, we
hypothesized that XY Fgf9–/– gonads might
express female markers suggesting full sex-reversal to the ovarian pathway.
Bone morphogenetic protein 2 (Bmp2) and follistatin (Fst)
are markers of ovarian differentiation that are specific to XX gonads at 12.5
dpc (Yao et al., 2003). In
situ hybridization revealed normal expression of Bmp2 and
Fst in 12.5 dpc XX Fgf9+/– and
–/– gonads (Fig.
4A-D). XY Fgf9+/– gonads express neither
of these markers at 12.5 dpc (Fig.
4E,F). However, 12.5 dpc XY
Fgf9–/– gonads express both ovarian markers
(Fig. 4G,H), indistinguishable
from XX genotypes.
Because at least part of the ovarian pathway is active by 12.5 dpc in XY
Fgf9 nulls, we asked if the surviving primordial germ cells entered
meiosis as they would in a wild-type XX gonad. Phosphorylated H2AX is a
marker for germ cells in the leptotene stage of meiosis
(Mahadevaiah et al., 2001) and
is visible at 14.5 dpc in wild-type XX gonads
(Yao et al., 2003).
Immunostaining for H2AX revealed meiotic germ cells in XX
Fgf9+/– gonads but not in XY
Fgf9+/– gonads at 14.5 dpc
(Fig. 4I,J respectively) as
predicted. In XY Fgf9–/– gonads at 14.5 dpc,
47% of the XY germ cells were positive for phosphorylated H2AX
(Fig. 4K), indicating that some
of the surviving gonocytes respond to an ovarian signaling environment and are
competent to enter meiosis. By in situ hybridization, XY
Fgf9–/– gonads also express the meiotic
markers Stra8 and Dmc1
(Menke et al., 2003) at 14.5
dpc (data not shown).
Time-dependant requirement for FGF9
In XY Fgf9–/– gonads, markers of Sertoli
cell differentiation are not expressed at 12.5 dpc
(Colvin et al., 2001;
Schmahl et al., 2004). As
Sertoli cells are known to be important for the development of germ cells in
the testis, we reasoned that the loss of germ cells in Fgf9 mutants
could be the indirect result of Sertoli cell loss. Preliminary experiments had
shown that Sertoli cells can be partially rescued in Fgf9 mutant XY
gonads by explanting at 11.5 dpc and culturing for 24 hours in DMEM and
10% FBS (discussed below). However, we found that even when Sertoli cells are
rescued in early explant cultures, there is no rescue of the germ cells. This
implies that Fgf9–/– Sertoli cells are not
sufficient to promote gonocyte survival.
|
|
FGF9 promotes gonocyte survival in vitro at 11.5 dpc but not at 10.5 dpc
To examine whether FGF9 could act directly on germ cells in the absence of
Sertoli or other somatic cells, we tested whether exogenous FGF9 could promote
the survival of purified XY gonocytes in culture. Gonocytes from 10.5 dpc XX
or XY gonads of Oct4:GFP transgenic embryos
(Anderson et al., 2000) were
removed and purified by differential centrifugation. In these animals, germ
cells express green fluorescent protein (GFP). The purity of gonocyte
preparations was determined by visualization of the proportion of
GFP-expressing cells. Samples with less than 95% gonocytes were discarded.
Survival of gonocytes was quantitatively determined by mitochondrial activity
using the WST-1 reagent (Roche) and measured with an ELISA plate reader. 46%
of 10.5 dpc XX and XY gonocytes cultured in only DMEM were still metabolically
active after 18 hours in culture (Fig.
6A). After 36 hours in culture, the survival had dropped to under
15%. XX and XY gonocytes (10.5 dpc) had similar survival patterns when
cultured in DMEM supplemented with FGF9 (25 ng/ml)
(Fig. 6A). Comparable results
were obtained from 11.5 dpc XX, XY and FGF9-treated XX gonocytes
(Fig. 6B). However, 83% of 11.5
dpc XY gonocytes treated with FGF9 were still metabolically active after 18
hours, and 43% after 36 hours (Fig.
6B). These results indicate that 11.5 dpc XY (but not XX) gonocyte
survival significantly increased when treated with FGF9
(P<0.001).
It was possible that exogenous FGF9 was delaying or masking cell death in XY gonocyte cultures by inducing proliferation. To exclude this possibility, we assayed for the presence of phosphorylated Histone H3 (pHH3) as a marker of proliferation. pHH3 was never observed in FGF9-treated gonocytes (data not shown). Consistent with this finding, clonal expansion of gonocytes was never visually observed (data not shown).
Gonocyte requirement for FGF9 is non-cell autonomous
These data indicate that a transition to dependence on FGF9 occurs in XY
gonocytes between 10.5 and 11.5 dpc. This could be a cell-autonomous effect of
the Y-chromosome in gonocytes or it could be a dependence induced by the male
somatic environment. To investigate this question, we explanted gonocytes from
XX mice carrying an Sry transgene (XXSryMyc)
(Sekido et al., 2004).
Expression of the Sry transgene in Sertoli precursors leads to the
development of a testis in XXSryMyc mice. However, the
Sry transgene is not expressed in germ cells. Therefore, in these
animals XX germ cells first encounter a male somatic environment when they
enter a gonad expressing Sry. We hypothesized that XX gonocytes from
SryMyc transgenic mice would respond to FGF9 in vitro
after experiencing a male context in vivo. To investigate this possibility, we
generated SryMyc;Oct4:GFP and
SryMyc;Fgf9–/– animals.
Importantly, the gonads of
XXSryMyc;Fgf9–/– lose
gonocytes between 11.5 dpc and 12.5 dpc similar to XY
Fgf9–/– gonads
(Fig. 6C; compare with
Fig. 1A,B). When
XXSryMyc gonocytes were purified at 10.5 dpc, they did not
respond to exogenous FGF9 in culture similar to non-transgenic XX and XY
samples at this stage (Fig.
6A). When purified at 11.5 dpc and cultured in the presence of
FGF9, XXSryMyc gonocytes showed improved survival
(P<0.001) at 18 and 36 hours comparable with FGF9-treated XY
gonocytes (Fig. 5B). These
findings are consistent with the hypothesis that a male somatic environment
induces dependence of gonocytes on FGF9.
|
;
Xu et al., 2005). FGF7/KGF, a
founding member of the FGF7 subfamily, has been demonstrated to promote cell
survival by inhibiting apoptosis
(Hishikawa et al., 2004;
Bao et al., 2005). We also
tested FGF16, which is a member of the FGF9 subfamily
(Itoh and Ornitz, 2004).
Neither FGF2 nor FGF7 (25 ng/ml) altered 11.5 XX or XY gonocyte survival
relative to controls (Fig.
7A,B). However, 25 ng/ml FGF16 was able to improve XY gonocyte
survival after 36 hours (Fig.
7C). When the concentration of FGF16 was raised to 40 ng/ml, XY
gonocyte survival was rescued to the same level as treatment with 25 ng/ml
FGF9 (Fig. 7D; compare with
Fig. 6B). |
DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
;
Schmahl et al., 2004). In this
study, we use in vitro cultures of whole gonads and purified gonocytes to show
that FGF9 also acts directly to promote the survival of gonocytes from the
testis, but not the ovary, after 11.5 dpc. Although XY Fgf9-null
gonads initiate the male pathway, they fail to maintain testis development and
lose most of their gonocytes between 11.5 and 12.5 dpc. Further analysis
revealed that somatic cells within these gonads switch to the ovarian pathway,
as indicated by in situ hybridization for the ovarian markers bone
morphogenetic protein 2 (Bmp2) and follistatin (Fst).
Concordantly, we observe that some of the surviving XY gonocytes enter
meiosis, presumably in response to ovarian cues.
Timing is critical
These findings present an interesting paradox. We show that Fgf9
is required for the survival of gonocytes in a testis, but not an ovarian
environment. If the XY gonad is switching to the ovarian pathway in
Fgf9 mutants, why are XY gonocytes unable to survive there?
No differences have been shown to exist between early XX and XY germ cells
(reviewed by McLaren, 2003).
Furthermore, in several instances of complete male-to-female sex reversal, XY
germ cells are known to be competent to develop as oocytes
(Lovell-Badge and Robertson,
1990; Adams and McLaren,
2002). However, one formal possibility was that the heteromorphic
sex chromosomes are responsible for a germ cell intrinsic differential
response to FGF9 signals. To address this possibility, we investigated whether
XX gonocytes from the testes of SryMyc transgenic embryos
(Sekido et al., 2004) respond
to FGF9 in vitro. In SryMyc transgenics, Sry
expression is restricted to somatic cells of the gonad where it initiates
normal testis development; therefore, XX gonocytes first encounter a male
environment when they enter the testis. XX gonocytes isolated from the testes
of these transgenics responded to FGF9 in vitro and showed survival rates
similar to XY gonocytes. These data argue that dependence on FGF9 is conferred
by the male somatic environment and not by the XY chromosomal constitution of
the germ cells.
|
).
Consistent with these data, our results imply that the putative masculinizing
factors gradually confer dependence on FGF9 between 10.5 and 11.5 dpc such
that soon after 11.5 dpc, most gonocytes in the wild-type XY gonad require
FGF9 for their survival (Fig.
1A,B).
The male gonadal environment is initiated by expression of Sry in
somatic cells between 10.5 and 12.5 dpc
(Koopman et al., 1991;
Hacker et al., 1995). In XY
Fgf9–/– gonads, the male pathway is
transiently initiated in somatic cells
(Fig. 3). Other work in our
laboratory has revealed that Sox9 is also transiently expressed in
Fgf9–/– gonads (Y. Kim, A. Kobayashi, R.
Sekido, L.D., J. Brennan, M.-C. Chaboissier, F. Poulat, R. R. Behringer, R.
Lovell-Badge and B.C., unpublished). We hypothesize that transient expression
of Sry and Sox9 is sufficient to initiate masculinization of
germ cells in the Fgf9–/– XY gonad. In
Sox9–/– and
Sox9–/–;
Sox8–/– gonads, despite the fact that
Sry is initially expressed, Sertoli cells fail to differentiate,
testis development is aborted and markers of ovarian development are
activated, as in the Fgf9 mutants
(Chaboissier et al., 2004).
Interestingly, gonocyte numbers appear unaffected in these sex-reversed XY
gonads. By contrast, in Fgf9–/– XY gonads,
where both Sry and Sox9 are initially expressed, more than
95% of germ cells are lost. These data suggest that the stage of development
at which the male pathway is aborted is crucial to gonocyte survival, and
imply that the crucial signal conferring dependence on FGF9 is downstream of
Sox9. It is noteworthy that the majority of germ cell loss occurs in
the central region of the gonad. This may be a result of the fact that testis
differentiation is initiated in a center-to-pole pattern
(Bullejos and Koopman, 2001;
Albrecht and Eicher, 2001).
In Fgf9–/– gonads, some gonocytes escaped conversion to FGF9 dependence, survived and entered meiosis in a pattern similar to an XX gonocyte residing in an ovary. The number of such gonocytes may reflect the exact time at which the male pathway is aborted in XY Fgf9–/– gonads. It also seems likely that the establishment of ovarian differentiation seen by 12.5 dpc in the XY Fgf9-null mutants may be incomplete or delayed such that many gonocytes do not receive appropriate male or female survival signals at susceptible stages.
FGF9 as a survival factor in context
When 11.5 dpc Fgf9–/– gonads are cultured
in the presence of FBS, Sertoli cells are rescued but gonocytes are not. We
suspect that the fetal calf serum in the culture medium contains factors,
perhaps FGFs, that are sufficient to rescue Sertoli cells when administered
during the critical proliferative window
(Fig. 5)
(Schmahl et al., 2004).
However, these factors are not sufficient to rescue gonocyte numbers. Our
results suggest that gonocytes either require higher concentrations of the
factors in FBS or that specific factors required by gonocytes are missing. Our
experiments indicate that gonocytes are not responsive to all FGFs, but
selectively to members of the FGF9 subfamily. Nevertheless, the addition of
exogenous FGF9 to cultured gonads or purified cultured gonocytes in vitro
clearly supports a direct role of FGF9 as a pro-survival factor for XY
gonocytes (Figs 5,
6). FGF9 is the earliest
example of a sex-specific germ cell survival factor.
A number of factors have been identified that support PGC survival in
vitro, including Kit, Kit ligand (Scf; Kitl –
Mouse Genome Informatics), LIF and another FGF, bFGF
(Matsui et al., 1992)
(reviewed by Wylie, 1999;
McLaren, 2003). Null mutations
in Kit or Kitl lead to a total loss of PGCs in XX and XY
embryos by 9.5 dpc (reviewed by Besmer et
al., 1993). There are no in vivo data demonstrating a requirement
for LIF or bFGF in PGCs. Recently, it has been shown that the shared receptor
for the LIF cytokine family (GP130) plays a role in XY PGC development.
PGC-specific ablation of GP130 led to reduced gonocyte numbers in 13.5 dpc XY
animals (Molyneaux et al.,
2003). However, the basis for this effect was unclear, and,
interestingly, these GP130-null males are fertile. Pro-survival roles in other
cell types have been assigned to FGFs, including FGF8 and FGF4
(Trumpp et al., 1999;
Abu-Issa et al., 2002;
Morini et al., 2000).
These findings make Fgf9 one of a small but growing set of genes
that display a sex-specific embryonic germ cell phenotype. Mouse Vasa
homolog (Mvh) encodes an RNA helicase that plays a testis specific
role in gonocyte development (Tanaka et
al., 2000). In Mvh XY mutants, some gonocytes are
mis-localized to the interstitial space between cords. Specifically,
Mvh has been shown to act as a positive regulator of XY (but not XX)
germ cell proliferation between 11.5 and 12.5 dpc, and was the first molecular
evidence for dimorphic pathways regulating early gonocyte proliferation. Both
the Fgf9 and Mvh-null phenotypes point to the fundamental
importance of germ cell/somatic cell interactions. FGF9 is the first secreted
cell signaling molecule demonstrated to have a dimorphic effect on survival of
germ cells in a male (but not a female) environment.
Future analysis will determine which FGF receptor (FGFR) is mediating the
pro-survival effect. We have previously demonstrated the presence of FGFR1,
FGFR2, FGFR3 and FGFR4 in the gonad
(Schmahl et al., 2004). FGF9
can bind and activate the four major FGFRs, although it has greatest
specificity for the FGFR1c, FGFR2c, FGFR3b,and FGFR3c isoforms
(Ornitz et al., 1996).
However, it is unlikely to function solely through FGFR3 or FGFR4, as mice
with null mutations for either are at least partially fertile
(Colvin et al., 1996;
Deng et al., 1996;
Weinstein et al., 1998). It
has recently been shown that migratory germ cells express at least two FGFRs,
FGFR1-IIIc and FGFR2-IIIb (Takeuchi et
al., 2005). FGFR1-IIIc is thought to have high affinity for FGF9.
Given that gonocytes do not express any of the FGF receptors sex specifically
(Schmahl et al., 2004), how
does FGF9 confer a sex specific effect? It is possible that a receptor is
expressed at higher levels, or a differently spliced variant is present in the
XY gonad. Alternatively, or in addition, there may be sex specific co-factors,
e.g. extracellular heparin sulfate proteoglycans or intracellular signal
transducers, in masculinized XY gonocytes that mediate the effects of FGF9. In
addition, it is intriguing to speculate that there may be an ovarian specific
pro-survival signal that has yet to be identified.
Finally, it would be informative to screen for differentially regulated genes in XY gonocytes treated with and without exogenous FGF9. Dissection of the pathways that regulate germ cell and somatic cell coordination would greatly aid our understanding of germ cell development.
|
ACKNOWLEDGMENTS |
|---|
H2AX antibodies, respectively. We thank R. Lovell-Badge and R. Sekido
for providing the SryMyc transgenic animals. We thank Jeff
Mann for providing the Oct4:GFP transgenic animals. We also thank D.
Coveney, Y. Kim, A. Ross, and H. Tang for helpful comments on the manuscript.
Finally we thank S. Munger for his support. This work was funded by an NIH
grant to B.C. (HD39963). |
REFERENCES |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Abu-Issa, R., Smyth, G., Smoak, I., Yamamura, K. and Meyers, E.
N. (2002). Fgf8 is required for pharyngeal arch and
cardiovascular development in the mouse. Development
129,4613
-4625.
Adams, I. R. and McLaren, A. (2002). Sexually
dimorphic development of mouse primordial germ cells: switching from oogenesis
to spermatogenesis. Development
129,1155
-1164.
Albrecht, K. H. and Eicher, E. M. (2001). Evidence that Sry is expressed in pre-Sertoli cells and Sertoli and granulosa cells have a common precursor. Dev. Biol. 240,92 -107.[CrossRef][Medline]
Anderson, R., Fassler, R., Georges-Labouesse, E., Hynes, R. O., Bader, B. L., Kreidberg, J. A., Schaible, K., Heasman, J. and Wylie, C. (1999). Mouse primordial germ cells lacking beta1 integrins enter the germline but fail to migrate normally to the gonads. Development 126,1655 -1664.[Abstract]
Anderson, R., Copeland, T. K., Scholer, H., Heasman, J. and Wylie, C. (2000). The onset of germ cell migration in the mouse embryo. Mech. Dev. 91, 61-68.[CrossRef][Medline]
Bao, S., Wang, Y., Sweeney, P., Chaudhuri, A., Doseff, A. I.,
Marsh, C. B. and Knoell, D. L. (2005). Keratinocyte growth
factor induces Akt kinase activity and inhibits Fas-mediated apoptosis in A549
lung epithelial cells. Am. J. Physiol. Lung Cell Mol.
Physiol. 288,L36
-L42.
Behringer, R. R., Finegold, M. J. and Cate, R. L. (1994). Müllerian inhibiting substance function during mammalian sexual development. Cell 79,415 -425.[CrossRef][Medline]
Besmer, P., Manova, K., Duttlinger, R., Huang, E. J., Packer, A., Gyssler, C. and Bachvarova, R. F. (1993). The kit-ligand (steel factor) and its receptor c-kit/W: pleiotropic roles in gametogenesis and melanogenesis. Dev. Suppl.125 -137.
Bishop, C. E., Whitworth, D. J., Qin, Y., Agoulnik, A. I., Agoulnik, I. U., Harrison, W. R., Behringer, R. R. and Overbeek, P. A. (2000). A transgenic insertion upstream of Sox9 is associated with dominant XX sex reversal in the mouse. Nat. Genet. 26,490 -494.[CrossRef][Medline]
Bitgood, M. J., Shen, L. and McMahon, A. P. (1996). Sertoli cell signaling by Desert hedgehog regulates the male germline. Curr. Biol. 6, 298-304.[CrossRef][Medline]
Brennan, J. and Capel, B. (2004). One tissue, two fates: molecular genetic events that underlie testis versus ovary development. Nat. Rev. Genet. 5, 509-521.[Medline]
Brennan, J., Tilmann, C. and Capel, B. (2003).
Pdgfr-alpha mediates testis cord organization and fetal Leydig cell
development in the XY gonad. Genes Dev.
17,800
-810.
Bullejos, M. and Koopman, P. (2001). Spatially dynamic expression of Sry in mouse genital ridges. Dev. Dyn. 221,201 -205.[CrossRef][Medline]
Chaboissier, M. C., Kobayashi, A., Vidal, V. I., Lutzkendorf,
S., van de Kant, H. J., Wegner, M., de Rooij, D. G., Behringer, R. R. and
Schedl, A. (2004). Functional analysis of Sox8 and
Sox9 during sex determination in the mouse.
Development 131,1891
-1901.
Chiquoine, A. D. (1954). The identification, origin, and migration of the primordial germ cells in the mouse embryo. Anat. Rec. 118,135 -146.[CrossRef][Medline]
Colvin, J. S., Bohne, B. A., Harding, G. W., McEwen, D. G. and Ornitz, D. M. (1996). Skeletal overgrowth and deafness in mice lacking fibroblast growth factor receptor 3. Nat. Genet. 12,390 -397.[CrossRef][Medline]
Colvin, J. S., Green, R. P., Schmahl, J., Capel, B. and Ornitz, D. M. (2001). Male-to-female sex reversal in mice lacking fibroblast growth factor 9. Cell 104,875 -889.[CrossRef][Medline]
da Silva, S. M., Hacker, A., Harley, V., Goodfellow, P., Swain, A. and Lovell-Badge, R. (1996). Sox9 expression during gonadal development implies a conserved role for the gene in testis differentiation in mammals and birds. Nat. Genet. 14, 62-68.[CrossRef][Medline]
Deng, C. X., Wynshaw-Boris, A., Zhou, F., Kuo, A. and Leder, P. (1996). Fibroblast growth factor receptor 3 is a negative regulator of bone growth. Cell 84,911 -921.[CrossRef][Medline]
Ginsburg, M., Snow, M. H. and McLaren, A.
(1990). Primordial germ cells in the mouse embryo during
gastrulation. Development
110,521
-528.
Gubbay, J., Vivian, N., Economou, A., Jackson, D., Goodfellow,
P. and Lovell-Badge, R. (1992). Inverted repeat structure of
the Sry locus in mice. Proc. Natl. Acad. Sci.
USA 89,7953
-7957.
Hacker, A., Capel, B., Goodfellow, P. and Lovell-Badge, R. (1995). Expression of Sry, the mouse sex determining gene. Development 121,1603 -1614.[Abstract]
Hishikawa, Y., Tamaru, N., Ejima, K., Hayashi, T. and Koji, T. (2004). Expression of keratinocyte growth factor and its receptor in human breast cancer: its inhibitory role in the induction of apoptosis possibly through the overexpression of Bcl-2. Arch. Histol. Cytol. 67,455 -464.[CrossRef][Medline]
Itoh, N. and Ornitz, D. M. (2004). Evolution of the Fgf and Fgfr gene families. Trends Genet. 20,563 -569.[CrossRef][Medline]
Koopman, P., Gubbay, J., Vivian, N., Goodfellow, P. and Lovell-Badge, R. (1991). Male development of chromosomally female mice transgenic for Sry. Nature 351,117 -121.[CrossRef][Medline]
Koubova, J., Menke, D. B., Zhou, Q., Capel, B., Griswold, M. D.
and Page, D. C. (2006). Retinoic acid regulates sex-specific
timing of meiotic initiation in mice. Proc. Natl. Acad. Sci.
USA 10.1073/pnas.0510813103.
Lawson, K. A. and Hage, W. J. (1994). Clonal analysis of the origin of primordial germ cells in the mouse. Ciba Found. Symp. 182,68 -84[Medline]
Lawson, K. A., Dunn, N. R., Roelen, B. A., Zeinstra, L. M.,
Davis, A. M., Wright, C. V., Korving, J. P. and Hogan, B. L.
(1999). Bmp4 is required for the generation of
primordial germ cells in the mouse embryo. Genes Dev.
13,424
-436.
Lovell-Badge, R. and Robertson, E. (1990). XY female mice resulting from a heritable mutation in the primary testis-determining gene, Tdy. Development 109,635 -646.[Abstract]
Mackay, S., Nicholson, C. L., Lewis, S. P. and Brittan, M. (1999). E-cadherin in the developing mouse gonad. Anat. Embryol. (Berl). 200,91 -102.[CrossRef][Medline]
Mahadevaiah, S. K., Turner, J. M., Baudat, F., Rogakou, E. P., de Boer, P., Blanco-Rodriguez, J., Jasin, M., Keeney, S., Bonner, W. M. and Burgoyne, P. S. (2001). Recombinational DNA double-strand breaks in mice precede synapsis. Nat. Genet. 27,271 -276.[CrossRef][Medline]
Martineau, J., Nordqvist, K., Tilmann, C., Lovell-Badge, R. and Capel, B. (1997). Male-specific cell migration into the developing gonad. Curr. Biol. 7, 958-968.[CrossRef][Medline]
Matsui, Y., Zsebo, K. and Hogan, B. L. (1992). Derivation of pluripotential embryonic stem cells from murine primordial germ cells in culture. Cell 70,841 -847.[CrossRef][Medline]
McLaren, A. (1991). Development of the mammalian gonad: the fate of the supporting cell lineage. Bioessays 13,151 -156.[CrossRef][Medline]
McLaren, A. (2000). Germ and somatic cell lineages in the developing gonad. Mol. Cell. Endocrinol. 163,3 -9.[CrossRef][Medline]
McLaren, A. (2003). Primordial germ cells in the mouse. Dev. Biol. 262, 1-15.[CrossRef][Medline]
Menke, D. B., Koubova, J. and Page, D. C. (2003). Sexual differentiation of germ cells in XX mouse gonads occurs in an anterior-to-posterior wave. Dev. Biol. 262,303 -312.[CrossRef][Medline]
Mintz, B. and Russell, E. S. (1957). Gene-induced embryological modifications of primordial germ cells in the mouse. J. Exp. Zool. 134,207 -237.[CrossRef][Medline]
Molyneaux, K. A., Schaible, K. and Wylie, C.
(2003). GP130, the shared receptor for the LIF/IL6 cytokine
family in the mouse, is not required for early germ cell differentiation, but
is required cell-autonomously in oocytes for ovulation.
Development 130,4287
-4294.
Molyneaux, K. A., Wang, Y., Schaible, K. and Wylie, C. (2004). Transcriptional profiling identifies genes differentially expressed during and after migration in murine primordial germ cells. Gene Expr. Patterns 4,167 -181.[CrossRef][Medline]
Morini, M., Astigiano, S., Mora, M., Ricotta, C., Ferrari, N., Mantero, S., Levi, G., Rossini, M. and Barbieri, O. (2000). Hyperplasia and impaired involution in the mammary gland of transgenic mice expressing human FGF4. Oncogene 19,6007 -6014.[Medline]
Ornitz, D. M. and Itoh, N. (2001). Fibroblast growth factors. Genome Biol. 2, 3005.
Ornitz, D. M., Xu, J., Colvin, J. S., McEwen, D. G., MacArthur,
C. A., Coulier, F., Gao, G. and Goldfarb, M. (1996). Receptor
specificity of the fibroblast growth factor family. J. Biol.
Chem. 271,15292
-15297.
Palmer, S. J. and Burgoyne, P. S. (1991). In
situ analysis of fetal, prepuberal and adult XX
XY chimaeric mouse
testes: Sertoli cells are predominantly, but not exclusively, XY.
Development 112,265
-268.[Abstract]
Saitou, M., Barton, S. C. and Surani, M. A. (2002). A molecular programme for the specification of germ cell fate in mice. Nature 418,293 -300.[CrossRef][Medline]
Schmahl, J. and Capel, B. (2003). Cell proliferation is necessary for the determination of male fate in the gonad. Dev. Biol. 258,264 -276.[CrossRef][Medline]
Schmahl, J., Kim, Y., Colvin, J. S., Ornitz, D. M. and Capel,
B. (2004). Fgf9 induces proliferation and nuclear
localization of FGFR2 in Sertoli precursors during male sex determination.
Development 131,3627
-3636.
Sekido, R., Bar, I., Narvaez, V., Penny, G. and Lovell-Badge, R. (2004). SOX9 is up-regulated by the transient expression of SRY specifically in Sertoli cell precursors. Dev. Biol. 274,271 -279.[CrossRef][Medline]
Takeuchi, Y., Molyneaux, K., Runyan, C., Schaible, K. and Wylie,
C. (2005). The roles of FGF signaling in germ cell migration
in the mouse. Development
132,5399
-5409.
Tam, P. P. and Snow, M. H. (1981). Proliferation and migration of primordial germ cells during compensatory growth in mouse embryos. J. Embryol. Exp. Morphol. 64,133 -147.[Medline]
Tam, P. P. and Zhou, S. X. (1996). The allocation of epiblast cells to ectodermal and germ-line lineages is influenced by the position of the cells in the gastrulating mouse embryo. Dev. Biol. 178,124 -132.[CrossRef][Medline]
Tanaka, S. S., Toyooka, Y., Akasu, R., Katoh-Fukui, Y.,
Nakahara, Y., Suzuki, R., Yokoyama, M. and Noce, T. (2000).
The mouse homolog of Drosophila Vasa is required for the development
of male germ cells. Genes Dev.
14,841
-853.
Tilmann, C. and Capel, B. (1999). Mesonephric cell migration induces testis cord formation and Sertoli cell differentiation in the mammalian gonad. Development 126,2883 -2890.[Abstract]
Trumpp, A., Depew, M. J., Rubenstein, J. L., Bishop, J. M. and
Martin, G. R. (1999). Cre-mediated gene inactivation
demonstrates that FGF8 is required for cell survival and patterning of the
first branchial arch. Genes Dev.
13,3136
-3148.
Vidal, V. P., Chaboissier, M. C., de Rooij, D. G. and Schedl, A. (2001). Sox9 induces testis development in XX transgenic mice. Nat. Genet. 28,216 -217.[CrossRef][Medline]
Wang, G., Zhang, H., Zhao, Y., Li, J., Cai, J., Wang, P., Meng, S., Feng, J., Miao, C., Ding, M. et al. (2005). Noggin and bFGF cooperate to maintain the pluripotency of human embryonic stem cells in the absence of feeder layers. Biochem. Biophys. Res. Commun. 330,934 -942.[CrossRef][Medline]
Weinstein, M., Xu, X., Ohyama, K. and Deng, C. X. (1998). FGFR-3 and FGFR-4 function cooperatively to direct alveogenesis in the murine lung. Development 125,3615 -3623.[Abstract]
Wilkinson, D. G. and Nieto, M. A. (1993). Detection of messenger RNA by in situ hybridization to tissue sections and whole mounts. Methods Enzymol. 225,361 -373.[Medline]
Wright, E., Hargrave, M. R., Christiansen, J., Cooper, L., Kum, J., Evans, T., Gangadharan, U., Greenfeld, A. and Koopman, P. (1995). The Sry-related gene Sox9 is expressed during chrondrogenesis in mouse embryos. Nat. Genet. 9, 15-20.[CrossRef][Medline]
Wylie, C. (1999). Germ cells. Cell 96,165 -174.[CrossRef][Medline]
Xu, C., Rosler, E., Jiang, J., Lebkowski, J. S., Gold, J. D.,
O'Sullivan, C., Delavan-Boorsma, K., Mok, M., Bronstein, A. and Carpenter, M.
K. (2005). Basic fibroblast growth factor supports
undifferentiated human embryonic stem cell growth without conditioned medium.
Stem Cells 23,315
-323.
Yao, H. H., Whoriskey, W. and Capel, B. (2002).
Desert Hedgehog/Patched 1 signaling specifies fetal Leydig cell fate in testis
organogenesis. Genes Dev.
16,1433
-1440.
Yao, H. H., DiNapoli, L. and Capel, B. (2003).
Meiotic germ cells antagonize mesonephric cell migration and testis cord
formation in mouse gonads. Development
130,5895
-5902.
Yao, H. H., Matzuk, M. M., Jorgez, C. J., Menke, D. B., Page, D. C., Swain, A. and Capel, B. (2004). Follistatin operates downstream of Wnt4 in mammalian ovary organogenesis. Dev. Dyn. 230,210 -215.[CrossRef][Medline]
This article has been cited by other articles:
|
|
 |
|
  L. M. Cotton, M. K. O'Bryan, and B. T. Hinton Cellular Signaling by Fibroblast Growth Factors (FGFs) and Their Receptors (FGFRs) in Male Reproduction Endocr. Rev., April 1, 2008; 29(2): 193 - 216. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. DiNapoli and B. Capel SRY and the Standoff in Sex Determination Mol. Endocrinol., January 1, 2008; 22(1): 1 - 9. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Zhang, O. A. Ibrahimi, S. K. Olsen, H. Umemori, M. Mohammadi, and D. M. Ornitz Receptor Specificity of the Fibroblast Growth Factor Family: THE COMPLETE MAMMALIAN FGF FAMILY J. Biol. Chem., June 9, 2006; 281(23): 15694 - 15700. [Abstract] [Full Text] [PDF]
|
|
3 each. Scale bar: 50
µm.
