|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 15 August 2007
doi: 10.1242/dev.003905
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Division of Human Biology, Fred Hutchinson Cancer Research Center, Seattle,
Washington 98109, USA.
2 Department of Biological Sciences, University of Alberta, Edmonton, Alberta,
T6G2E9, Canada.
3 Howard Hughes Medical Institute and Division of Basic Science, Fred Hutchinson
Cancer Research Center, Seattle, Washington 98109, USA.
* Author for correspondence (e-mail: lmaves{at}fhcrc.org)
Accepted 13 July 2007
| SUMMARY |
|---|
|
|
|---|
Key words: Myod, Pbx, Muscle, Zebrafish
| INTRODUCTION |
|---|
|
|
|---|
Previous demonstrations of molecular interactions between the bHLH Myod
protein and the homeodomain proteins Pbx and Meis suggest that skeletal
myogenesis might be a good system to directly test the role of homeodomain
proteins in modulating bHLH-driven cell-type programs
(Knoepfler et al., 1999
;
Berkes et al., 2004
).
Furthermore, myogenesis is a model system in which to study the acquisition of
cellular phenotype diversity; for example, the generation of different fiber
types. Skeletal myogenesis in vertebrate embryos is coordinated by the bHLH
transcription factors Myod, Myf5, Myog and Mrf4
(Buckingham, 2001
). Myod is
sufficient to convert fibroblasts and other non-muscle cells into skeletal
muscle (Weintraub et al.,
1989
). Myod directly activates the expression of multiple
additional transcription factors, including Myog, and acts in a feed-forward
mechanism in cooperation with those factors to directly activate muscle genes
expressed later in the differentiation program
(Penn et al., 2004
;
Cao et al., 2006
). At a
portion of these later target genes, Myod appears necessary to initiate
chromatin remodeling before other transcription factors, such as Myog, can
bind to the promoters (Cao et al.,
2006
). Therefore, Myod has a crucial function of identifying and
remodeling the target genes that will subsequently be available for activation
by other factors. Because Myod directly regulates a broad suite of muscle
differentiation genes, one question that arises is how does Myod correctly
regulate promoters used in different skeletal muscle types, such as fast- or
slow-twitch muscle?
Mutations of the histidine- and cysteine-rich domain or the C-terminal
helix III domain of Myod prevent full activation of a subset of Myod target
genes and also prevent cooperative DNA binding with Pbx and Meis proteins on
specific Myod target promoters, including that of Myog
(Berkes et al., 2004
). Because
Pbx and Meis proteins are present on some of these promoters prior to Myod
expression, we suggested that a Pbx-Meis complex might mark a subset of genes
for Myod activation (Berkes et al.,
2004
; de la Serna et al.,
2005
). However, mutations in the Myod protein might alter
interactions with additional factors, and a requirement for Pbx-Meis in
skeletal myogenesis has not yet been demonstrated. Thus, it remains to be
determined whether a Pbx-Meis complex is necessary for Myod activity at
Myog or other specific genes in vivo and whether this subset of genes
regulates a specific aspect of muscle development.
Zebrafish embryos provide an attractive biological system in which to test
the role of Pbx proteins in skeletal myogenesis. Pbx (and Meis) proteins are
TALE (three amino acid loop extension)-class homeodomain proteins that are
best characterized as cofactors for Hox proteins. In mice, overlapping
expression and functional redundancy among the Pbx genes complicates the
analysis of their requirements, and skeletal muscle defects have not been
reported for knock-outs of individual Pbx genes
(Moens and Selleri, 2006
).
Zebrafish have five Pbx genes, but only pbx2 and pbx4 are
expressed during the period of early myogenesis
(Pöpperl et al., 2000
;
Waskiewicz et al., 2002
).
Knock-down of both pbx2 and pbx4 in zebrafish results in
severe hindbrain-patterning defects that reflect the role of Pbx proteins as
Hox cofactors (Waskiewicz et al.,
2002
), but skeletal muscle development was not assessed. The
Pbx-Meis binding site in the mouse Myog promoter is conserved in the
zebrafish myog gene (Berkes et
al., 2004
), providing an opportunity to test the developmental
role of Pbx in myogenesis. Here, we demonstrate that Pbx proteins are
necessary for the timely activation of myog by Myod, demonstrating
that Pbx has a necessary role in marking the myog gene for efficient
activation during development. Furthermore, we demonstrate that Pbx proteins
facilitate Myod activity to drive the expression of a subset of genes
necessary for fast-muscle differentiation, thus showing that homeodomain
proteins can direct bHLH proteins to establish a specific cell-type
identity.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Morpholino and mRNA injections
Morpholino injections were performed, and working concentrations were
determined, as previously described (Maves
et al., 2002
). Morpholinos (shown 5' to 3') were used
at the following working concentrations: pbx2-MO2
(Waskiewicz et al., 2002
),
CCGTTGCCTGTGATGGGCTGCTGCG, 0.25 mg/ml; pbx2-MO3,
GCTGCAACATCCTGAGCACTACATT, 0.5 mg/ml; pbx2-MO3 five-base mismatch
control (mismatched bases shown in lowercase), GCTcCAAgATCCTcAcCAgTACATT, 0.5
mg/ml; pbx4-MO1, AATACTTTTGAGCCGAATCTCTCCG, 0.5 mg/ml;
pbx4-MO2, CGCCGCAAACCAATGAAAGCGTGTT, 0.5 mg/ml; myod-splMO
E1I1, AATAAGTTTCTCACAATGCCATCAG, 5 mg/ml; myod-splMO E2I2,
TTTCGAGCAAACTTACCATTTGGTG, 2.5 mg/ml; myod-MO1,
GCAAGAAATGTACTTGAATGTTTCC, 0.5 mg/ml; myod-MO2,
GGAATAGTAAGACAAAGTCCTTCAG, 5 mg/ml; myf5-MO1,
GATTGGTTTGGTGTTGAAGGTTTCT, 0.25 mg/ml; myf5-MO2,
GATCTGGGATGTGGAGAATACGTCC, 0.25 mg/ml. pbx2-MO2, pbx2 MO3,
pbx4-MO1 and pbx4-MO2 were combined, myod-MO1 and
myod-MO2 were combined, and myf5-MO1 and myf5-MO2
were combined in order to knock down their respective gene products. Embryos
that are knocked-down for pbx2 and pbx4 function show a
developmental delay of approximately two somites during somitogenesis stages,
comparable to maternal-zygotic pbx4-/-; pbx2-MO embryos
(see Fig. S2 in the supplementary material; C.B.M., unpublished observations).
We somite-stage-matched sibling control and MO-treated embryos when collecting
embryos for staining or for RNA or protein analyses.
Injections of exd or shh (shha - ZFIN) mRNA were
performed as previously described
(Pöpperl et al., 2000
;
Barresi et al., 2000
).
RNA in situ hybridization and immunocytochemistry
RNA in situ hybridizations were performed as previously described
(Maves et al., 2002
). The
following cDNA probes were used: myod
(Weinberg et al., 1996
);
krox-20 [egr2b - Zebrafish Information Network
(Oxtoby and Jowett, 1993
)];
myog (Weinberg et al.,
1996
); myhc4 (EST fb27a08); aldh1a2
(Begemann et al., 2001
);
mylz2 (Xu et al.,
2000
); chrna1 (Sepich
et al., 1998
); tmem161a (IMAGE:7149790); ttnl
(EST eu247); atp2a1 (EST fc22f07); srl (EST fb94b10);
vmhc (Yelon et al.,
1999
); smyhc1
(Bryson-Richardson et al.,
2005
); and cxcr4a (EST cb824, Zebrafish International
Resource Center). We subcloned the desmin EST cb290 (Zebrafish
International Resource Center) into pCRII-TOPO, which was linearized with
BamHI and transcribed with T7 to make the antisense desmin
probe.
Whole-embryo immunostaining was performed with the following primary
antibodies: anti-pan zebrafish Pbx, 1:500
(Pöpperl et al., 2000
);
anti-Myf5, 1:100 [Santa Cruz, C-20, sc-302
(Hammond et al., 2007
)];
anti-myosin heavy chain F59, 1:10 [supernatant
(Devoto et al., 1996
)];
anti-myosin heavy chain MF20, 1:10 [supernatant
(Bader et al., 1982
)]; and
anti-fast myosin light chain F310, 1:10 [supernatant
(Hamade et al., 2006
)]. F59,
F310 and MF20 antibodies were developed by F. E. Stockdale and D. A. Fischman
and were obtained from the Developmental Studies Hybridoma Bank, maintained by
the University of Iowa. Stainings were performed as previously described
(Feng et al., 2006
) with the
following modifications: for anti-Pbx staining, embryos were fixed in 4% PFA
at 4°C for 4 hours and methanol dehydration was omitted; for anti-Myf5
(Myod) staining, embryos were fixed in 4% PFA for 1 hour at room temperature,
methanol dehydration was omitted, and washes and incubations were done in
PBS+1% Triton-X; for F59, F310 and MF20 staining, secondaries (Southern
Biotech) used were goat anti-mouse IgG1-FITC (1:100, F59 and F310) and goat
anti-mouse IgG2b-TRITC (1:100, MF20); for SYTOX Green staining, embryos were
rinsed in PBS following antibody staining, and then were incubated in a
1:10,000 dilution of SYTOX Green (Invitrogen) overnight at 4°C.
Embryos were photographed using a Zeiss Axioplan2 microscope, a SPOT RT digital camera (Diagnostic Instruments) and MetaMorph software or imaged using a Zeiss Pascal confocal microscope. Images were assembled using Adobe Photoshop.
Western analysis
Western analysis was performed as previously described
(Waskiewicz et al., 2001
).
Samples were run on NuPage 4-12% BIS-TRIS gels (Invitrogen). The equivalent of
approximately one embryo was loaded per lane. Antibodies were used at the
following dilutions: anti-pan zebrafish Pbx
(Pöpperl et al., 2000
),
1:2000; and anti-Histone H4 (Upstate Biotechnology), 1:1000.
Quantitative real-time RT-PCR
Dechorionated embryos were homogenized in TRIzol using a 1 cc insulin
syringe, and RNA was isolated following the TRIzol protocol (Invitrogen). 1
µg of RNA plus random hexamers were used in a reverse-transcriptase (RT)
reaction with SuperScriptII Reverse Transcriptase (Invitrogen). Real-time PCRs
were performed using an Applied Biosystems 7900HT System according to the
manufacturer's instructions. The relative expression levels were normalized to
those of ornithine decarboxylase 1 (odc1)
(Draper et al., 2001
). We used
the following probe and primer sets (sequences given are 5' to
3'): myogL1 forward, CTGGGGTGTCGTCCTCTAGT; myogR1 reverse,
TCGTCGTTCAGCAGATCCT; myogP1 probe, TGGAGCAGCGCGTCTGATCA; myodL2 forward,
TCAGACGAGAAGACGGAACA; myodR2 reverse, CACGATGCTGGACAGACAAT; myodP2 probe,
CACCAAATGCTGACGCACGG; odcL2 forward, GACTTTGACTTCGCCTTCCT; odcR2 reverse,
GAGGTGCTTCTTCAGGACATC; odcP1 probe; CGCGCGATATCGTGGAGCAG; desminL1 forward,
GAGGCCGAGGACTGGTATAA; desminR1 reverse, GGTGTAGGACTGGAGCTGGT; desminP1 probe,
AGCCAAGCAGGAGACCATGCAA.
cDNA microarray analysis
pbx2-MO; pbx4-MO embryos as well as their control
siblings (pbx2-MO3 mismatch control) were collected at the 10 somite
(10s) or 18s stage from three independent sets of injections. A subset of
embryos from each set of injections were used for in situ hybridization to
confirm somite staging (using myod) as well as the loss of
krox-20 expression and downregulation of myog expression in
pbx2-MO; pbx4-MO embryos (see
Fig. 1M,N for example). Total
RNA was harvested using TRIzol followed by Qiagen RNeasy clean-up according to
the Affymetrix recommendations. cRNA labeling and hybridization to Affymetrix
Zebrafish Genome arrays were performed using the manufacturer's protocols. The
perfect match (PM) probe intensities were corrected by robust multi-array
average, normalized by quantile normalization and summarized by medianpolish
using the Affymetrix package of Bioconductor. The gene expression profiles of
control versus pbx2-MO; pbx4-MO were compared using the
LIMMA package of Bioconductor. Array data are available at NCBI GEO
(www.ncbi.nlm.nih.gov/geo/),
accession GSE8428.
EMSA
Electrophoretic mobility shift assays (EMSAs) were performed as previously
described (Berkes et al.,
2004
). Pbx4 and Meis3 pCS2 expression constructs were as
previously described (Pöpperl et al.,
2000
; Vlachakis et al.,
2000
).
| RESULTS |
|---|
|
|
|---|
We first wanted to test whether Pbx is required for the activation of
myog expression. During somitogenesis stages in control embryos,
myod was expressed adjacent to the notochord in adaxial cells
(presumptive slow-muscle cells) as well as in more-lateral cells in the
posterior of each somite (presumptive fast-muscle cells). myog showed
a similar pattern of expression, which was delayed relative to myod
(Weinberg et al., 1996
;
Groves et al., 2005
)
(Fig. 1A,D,G,J). In comparison
to control embryos, myod expression was slightly increased in
pbx2-MO; pbx4-MO embryos, based on in situ hybridization
(Fig. 1A,B,G-H,M,N), and this
slight increase was confirmed by quantitative real-time reverse transcriptase
(RT)-PCR (qRT-PCR; Fig. 1S).
Despite the presence of increased levels of myod in
pbx2-MO; pbx4-MO embryos, expression of myog was
severely reduced at the 6-10 somite (s) stages
(Fig. 1D,E). As somitogenesis
proceeded, pbx2-MO; pbx4-MO embryos exhibited a delayed
pattern of myog expression (Fig.
1J,K,M,N). The reduction and delay of myog expression
were confirmed by qRT-PCR (Fig.
1T). By approximately 24 hours post fertilization (hpf),
myog expression approached its normal expression pattern but remained
at somewhat reduced levels (Fig.
1T and data not shown). These results show that Pbx function is
required for the efficient initiation of myog expression.
To demonstrate the specificity of the pbx MOs, we injected mRNA for the
Drosophila pbx gene ortholog, extradenticle (exd),
into pbx2-MO; pbx4-MO embryos. exd mRNA previously
was shown to rescue krox-20 expression in pbx4-/-
embryos (Pöpperl et al.,
2000
). We found that exd mRNA rescued krox-20
expression and rescued the reduced and delayed myog expression in
pbx2-MO; pbx4-MO embryos (see Fig. S2 in the supplementary
material). Additionally, knock-down of either pbx2 or pbx4
had little or no effect on myog expression, and a five-base mismatch
control MO for pbx2 caused no defects in myog expression
(data not shown). Therefore, the delay and reduction in myog
expression in pbx2-MO; pbx4-MO embryos is specific and
dependent upon the loss of function of both pbx genes.
We then addressed whether the requirements for Myod are similar to those
for Pbx in the activation of myog expression. We used two types of
MOs to knock down Myod: translation-blocking MOs (myod-MO) to knock
down all Myod activity, and splice-blocking MOs (myod-splMO) to knock
down the helix III-containing exon 3 of zebrafish myod, because the
helix III domain of Myod is necessary for cooperative binding with Pbx in
vitro (Berkes et al., 2004
).
myod-splMOs induced aberrantly spliced cDNAs that are predicted to
generate truncated proteins lacking the helix III domain but retaining the
activation and bHLH domains of Myod, whereas the myod-MOs caused the
loss of Myod protein (see Fig. S3 in the supplementary material). If the delay
in myog expression in pbx2-MO; pbx4-MO embryos was
due to requirements for an interaction between Pbx and Myod, then we expect
that knock-down of Myod would also result in a delay in myog
expression. Similar to pbx2-MO; pbx4-MO embryos,
myog expression was reduced and delayed with knock-down of Myod helix
III (Fig. 1F,L,T). Knock-down
of Myod protein caused a similar delay in myog activation and, at
later stages, myod-MO embryos maintained a slightly more severe
reduction of myog expression compared with pbx2-MO;
pbx4-MO embryos (Fig. 1O;
see also Fig. 4). These results
show that Myod is indeed required for the proper expression of myog
in zebrafish and, in particular, that it has similar requirements as Pbx for
the timely initiation of myog expression. These results thus support
our hypothesis that interaction with Pbx is necessary for Myod to properly
initiate myog expression.
To test whether Pbx or Myod knock-down cause a delay in all muscle gene
expression, we analyzed the expression of desmin (desm), one
of the earliest-expressed muscle-specific genes in zebrafish
(Xu et al., 2000
) and a known
direct transcriptional target of Myod that does not depend on Myod helix III
in cultured mouse cells (Bergstrom et al.,
2002
; Berkes et al.,
2004
). In control embryos, desm is expressed subsequent
to myod, mainly in adaxial cells
(Xu et al., 2000
)
(Fig. 1P). desm
expression appeared largely unaffected in pbx2-MO; pbx4-MO,
myod-splMO or myod-MO embryos, either by RNA in situ
hybridizations (Fig. 1P-R; see
also Figs 2 and
4) or by qRT-PCR
(Fig. 1U). We demonstrate below
(see Fig. 4) that zebrafish
desm is indeed Myod-regulated. These results show that Pbx is not
required for the proper initiation of all muscle gene expression.
|
|
|
Pbx function is required for efficient fast-muscle differentiation in zebrafish embryos
To further address the requirements for Pbx and Myod in the development of
fast and slow muscle in zebrafish, we examined additional markers that label
fast- or slow-muscle precursors. smyhc1, which encodes a slow myosin
heavy chain and is expressed specifically in adaxial cells/slow-muscle
precursors (Bryson-Richardson et al.,
2005
), was expressed normally in pbx2-MO;
pbx4-MO and in myod-MO embryos
(Fig. 2X-Z). Engrailed staining
labels muscle pioneers - an early-differentiating subset of the slow-muscle
cell population (Devoto et al.,
1996
; Hatta et al.,
1991
) - which appeared to develop normally in
pbx2-MO; pbx4-MO embryos (data not shown). The F59
anti-myosin heavy chain antibody, which specifically labels slow-muscle
precursors during somitogenesis stages
(Devoto et al., 1996
), was
expressed normally in pbx2-MO; pbx4-MO, in
myod-splMO and in myod-MO embryos
(Fig. 3A,B,E). The F310
anti-myosin light chain antibody labels fast-muscle myosins in zebrafish
(Hamade et al., 2006
). In
contrast to F59 staining, F310 staining was delayed and reduced in
pbx2-MO; pbx4-MO, in myod-splMO and in
myod-MO embryos (Fig.
3C,D,F and see Fig. S4 in the supplementary material).
myod-MO embryos showed slightly more reduced fast-muscle development
than pbx2-MO; pbx4-MO or myod-splMO embryos
(Fig. 3F and see Fig. S4 in the
supplementary material). Expression of a pan-muscle myosin marker MF20
(Bader et al., 1982
) initiated
on time, and its slow-muscle expression appeared normal in
pbx2-MO; pbx4-MO, in myod-splMO and in
myod-MO embryos (Fig.
3A-F and see Fig. S4 in the supplementary material). Thus, upon
loss of Pbx or Myod function, we observed delayed and reduced fast-muscle
differentiation, using multiple markers, and we observed no change, including
no delay, reduction, or increase, in slow-muscle-differentiation marker
expression. These results, combined with our microarray findings, show that
Pbx function is needed to promote efficient fast-muscle differentiation, as is
Myod.
|
We next looked for evidence that lateral somite cells are maintaining a
prolonged undifferentiated state in the absence of Pbx. Decreased fast-muscle
differentiation and loss of Myod function are associated with increased and
prolonged pax3 and pax7 expression, markers of
undifferentiated myogenic precursors
(Groves et al., 2005
;
Hammond et al., 2007
). We
could not identify a significant upregulation of pax3 or
pax7 in pbx2-MO; pbx4-MO embryos (data not shown).
However, our microarray analysis identified the upregulation of
cxcr4a in pbx2-MO; pbx4-MO embryos (see Table S2 in
the supplementary material). cxcr4a, the expression of which in the
anterior-lateral cells of each somite is initially very similar to
pax7, is normally downregulated in all but the most posterior somites
at the 18s stage (Hollway et al.,
2007
) (see Fig. S5 in the supplementary material). We observed
prolonged maintenance of cxcr4a in trunk somites in
pbx2-MO; pbx4-MO embryos as well as in myod-MO
embryos (see Fig. S5 in the supplementary material). These results suggest
that Pbx, as well as Myod, are important for the efficient differentiation of
lateral somite cells.
Pbx functions with Myod to promote fast-muscle, but not slow-muscle, differentiation
Previous work has shown that myod functions redundantly with
myf5 in slow-muscle development, because loss of myod
together with myf5 causes loss of slow-muscle myosin heavy chain
expression (Hammond et al.,
2007
). Redundancy with Myf5 might thus mask requirements for Pbx
acting with Myod. In particular, if Pbx is necessary for Myod to activate
slow-muscle gene expression, then knock-down of Myf5 together with Pbx should
cause slow-muscle defects. Alternatively, because the helix III
Pbx-interacting domain of Myod is conserved in Myf5
(Bergstrom and Tapscott, 2001
),
knock-down of Myod together with Pbx might cause slow-muscle defects. We found
that myf5-MO embryos showed no defects in myog or
desm expression (Fig.
4D,K), whereas myf5-MO; myod-MO embryos showed
complete loss of myog and desm expression
(Fig. 4E,L), confirming that
our myf5 and myod MOs were functioning.
myf5-MO; pbx2-MO; pbx4-MO embryos resembled
pbx2-MO; pbx4-MO embryos, in that myog expression
was delayed in lateral somite cells and desm expression was
unaffected (Fig. 4F,M).
myod-MO; pbx2-MO; pbx4-MO embryos, however, showed
almost complete loss of myog expression at 10s
(Fig. 4G), whereas
desm expression was unaffected
(Fig. 4N). By 18s, in
myod-MO; pbx2-MO; pbx4-MO embryos, myog
expression was still much reduced compared with myod-MO embryos (data
not shown). These results suggest that Pbx proteins are needed for both Myod
and Myf5 to activate myog expression.
|
Pbx is required downstream of Shh signaling for Myod to induce fast-muscle, but not slow-muscle, gene expression
To further demonstrate that Pbx directs Myod to drive fast-muscle, but not
slow-muscle, development, we tested whether Pbx and Myod are required for the
ability of Sonic hedgehog (Shh) signaling to drive slow- or fast-muscle gene
expression. Previous studies have shown that injecting shh mRNA into
wild-type embryos induces the upregulation of myod and slow-muscle
gene expression, such as smyhc1, causing expanded slow-muscle
differentiation across the lateral somites
(Currie and Ingham, 1996
;
Blagden et al., 1997
;
Du et al., 1997
)
(Fig. 5B). We tested whether
this slow-muscle expansion requires Myod and found that shh-induced
upregulation of smyhc1 was partially inhibited in myod-MO
embryos (Fig. 5D). However,
shh mRNA readily induced increased myod and smyhc1
expression in pbx2-MO; pbx4-MO embryos
(Fig. 5F), showing that Pbx is
not needed for Shh/Myod-induced slow-muscle development. Whereas shh
induces repression of fast-muscle markers at late stages (30 hpf)
(Blagden et al., 1997
;
Ju et al., 2003
) (data not
shown), we found that, at earlier stages, shh can induce the
expansion of fast-muscle markers, such as mylz2, in control embryos
(Fig. 5H and data not shown).
Shh-induced upregulation of fast-muscle markers was inhibited in
myod-MO embryos, even though myod expression was upregulated
(Fig. 5J and data not shown).
In contrast to smyhc1, Shh/Myod induction of fast-muscle markers was
inhibited in pbx2-MO; pbx4-MO embryos
(Fig. 5L and data not shown).
Thus, our experiments here show that the slow- or fast-muscle-inducing effects
of Shh are at least in part mediated by Myod, but that Pbx is required only
for the induction of fast-muscle markers. Taken together, these experiments
further demonstrate that Pbx functions specifically in regulating Myod
activation of fast-muscle gene expression.
|
Our microarray analysis identified the expression of aldh1a2,
which encodes an enzyme that is crucial for the synthesis of retinoic acid
(RA) (Begemann et al., 2001
;
Grandel et al., 2002
), as
Pbx-dependent (Table 1;
Fig. 2D). Because RA promotes
fast-muscle development in zebrafish
(Hamade et al., 2006
),
aldh1a2/RA signaling could be an effector of Pbx. Incubating
wild-type embryos in an RA bath induces the upregulation of myod and
myog expression, and precocious fast-muscle differentiation
(Hamade et al., 2006
). We
found that, although RA is still able to strongly increase myod
expression in pbx2-MO; pbx4-MO embryos, RA did not rescue
myog expression nor the defect in fast-muscle development in
pbx2-MO; pbx4-MO embryos (data not shown). Therefore, Pbx is
required for the efficient activation of fast-muscle genes by Myod in a manner
that is independent of its role in RA synthesis. Taken together, our findings
are consistent with the hypothesis that Pbx not only recruits Myod to the
myog promoter (Berkes et al.,
2004
) but also to additional fast-muscle gene promoters.
To determine whether Pbx directly regulates fast-muscle gene expression, we have initiated an analysis of fast-muscle gene promoters. We identified a near-consensus Pbx-Meis binding site in the mylz2 promoter and determined that in vitro-translated Pbx-Meis heterodimers bind to this site in electrophoretic mobility shift assays (see Fig. S6 in the supplementary material). Although additional studies are necessary to test the biological relevance of this site, the presence of a Pbx-binding site in the mylz2 promoter suggests a direct role for Pbx in the regulation of fast-muscle gene expression.
| DISCUSSION |
|---|
|
|
|---|
Our work demonstrates that Pbx is needed for the activity of a
non-homeodomain protein. Pbx proteins are most-characterized for their role as
Hox cofactors, but Pbx proteins also physically and functionally interact with
other homeodomain proteins, including with Pdx1
(Peers et al., 1995
;
Kim et al., 2002
) and
Engrailed (Peltenburg and Murre,
1996
; Kobayashi et al.,
2003
; Erickson et al.,
2007
). Our demonstration that Pbx proteins modulate the set of
genes regulated by the bHLH protein Myod suggests that Pbx proteins could have
more-widespread interactions than previously appreciated. Indeed, the
increasing data on the requirements for Pbx in mice and zebrafish underscore
the expanding roles for Pbx beyond that of Hox cofactors
(Moens and Selleri, 2006
;
Erickson et al., 2007
) (this
work). Although previous studies in worms have shown that Pbx homologs are
required for muscle development via their roles in mesoderm development
(Liu and Fire, 2000
), our
study is the first to show that Pbx is required for vertebrate myogenesis.
Although we had hypothesized that Pbx would be required for a subset of
Myod activity and therefore for the differentiation of a subset of muscle cell
types, it is unexpected that Pbx is needed specifically for fast-muscle
differentiation. Pbx proteins are expressed in presumptive slow- (adaxial) and
fast- (lateral somite) muscle cells along with Myod. The Pbx- and
Myod-dependent genes identified in our study are expressed in both of these
cell populations. Adaxial cells thus express both Pbx-dependent and
non-Pbx-dependent genes. Therefore, Pbx and Myod appear to be acting at the
level of promoter activity and not in specific cell types. If Pbx proteins are
ubiquitously expressed, how does Pbx help target Myod to specific promoters?
Pbx and Myod directly bind the mouse Myog promoter
(Berkes et al., 2004
), and we
found that Pbx can bind the zebrafish myog (A.T. and L.M.,
unpublished observations) and mylz2 promoters, suggesting a direct
role for Pbx in recruiting Myod to fast-muscle gene promoters. An alternative,
although not necessarily mutually exclusive, hypothesis is that additional
Pbx-dependent intermediates might exist that modulate the activity of Myod on
fast-muscle gene regulatory regions. In support of this hypothesis, our
microarray analysis identified at least seven genes whose expression was
Pbx-dependent but not Myod-dependent (Table
1), although the functions of these genes in muscle development is
unknown. Whether acting directly or indirectly, Pbx is necessary for the
efficient expression of myog and fast-muscle genes, but not for the
entire myogenic program. Therefore, our results provide the first evidence
that homeodomain proteins directly modulate the activity of a bHLH protein in
directing the phenotype of a general differentiation program.
What happens to cells that are delayed in differentiating into fast muscle
in the absence of Pbx? We did not find any evidence for an increase in
slow-muscle differentiation in the absence of Pbx, and we did not find a
severe loss of cells, because myod was still expressed strongly in
the somites. Thus, these cells might remain in a prolonged undifferentiated
state. In the absence of Fgf8 signaling, lateral somite cells fail to properly
activate myod, myog and fast-muscle gene expression but show
increased expression of pax3 and pax7, suggesting prolonged
maintenance of an undifferentiated state
(Groves et al., 2005
;
Hammond et al., 2007
). Loss of
Myod and Myf5 function also leads to increased pax3 and pax7
expression (Hammond et al.,
2007
). pax3 and pax7 expression does not
normally decline in the somites until after pbx2-MO; pbx4-MO
embryos have started to recover fast-muscle differentiation; thus, we have not
been able to identify a significant upregulation of pax3 or
pax7 in pbx2-MO; pbx4-MO embryos. We did, however,
see prolonged maintenance of cxcr4a expression in
pbx2-MO; pbx4-MO embryos and in myod-MO embryos.
Thus, Pbx function might be important for the efficient progression of
fast-muscle differentiation. Perhaps the upregulation of aldh1a2
expression in the tail of pbx2-MO; pbx4-MO embryos
(Fig. 2D) further reflects a
defect in differentiation.
The delayed differentiation of a specific muscle type in
pbx2-MO; pbx4-MO embryos is reminiscent of that observed for
Myod or Myf5 knock-outs in mice. Whereas loss of
Myod and Myf5 together in mice causes a loss of all skeletal
muscle development (Rudnicki et al.,
1993
), loss of Myod alone results in delayed hypaxial
muscle differentiation, and loss of Myf5 alone results in delayed
epaxial muscle differentiation (Braun et
al., 1994
; Kablar et al.,
1997
). Such studies analyzing muscle-differentiation delays have
revealed that Myod and Myf5 can play unique roles, and, thus, have had
significant impacts on our understanding of muscle development.
Our demonstration that Pbx is needed for the activity of a bHLH protein, in
addition to previous examples of homeodomain-bHLH interactions, suggests that
homeodomain modulation of bHLH activity could be a widespread mechanism to
modulate cell-type diversity. Previous studies have shown interactions between
homeodomain proteins and bHLH proteins at specific promoters
(Westerman et al., 2003
). In
particular, the bHLH protein NeuroD1, along with its bHLH heterodimer partner
E47, binds with the homeodomain protein Pdx1 to synergistically activate the
insulin promoter in B cells within the pancreas
(Glick et al., 2000
). Mouse
Pbx1-/- embryos have defects in pancreas differentiation,
and Pbx1 interacts with Pdx1 (Kim et al.,
2002
), but it is not known whether Pbx modulates bHLH activity in
the pancreas. In addition to their biochemical interactions, genetic
interactions have suggested that bHLH and homeodomain proteins can modulate
the activity of each other. Interactions between the homeodomain Nkx2-2 and
Olig bHLH proteins in the mouse spinal cord regulate a cell-fate decision
between an interneuron fate and a glial fate
(Sun et al., 2001
). This study
suggested that the activity of Olig is dependent on its context with a
homeodomain protein. Also, a Hairy-related bHLH protein can inhibit the
activity of a Hox protein in regulating epidermal cell fates in
Caenorhabditis elegans (Alper and
Kenyon, 2001
). However, in these cases, the mechanism by which
these modulations occur is not known.
Our results provide a novel demonstration of how interactions between
different types of `master regulatory' factors control cell-type diversity.
Homeodomain factors control positional identities, whereas bHLH proteins
control cell-type identities. We propose that these identity programs merge
together such that homeodomain proteins modulate the set of bHLH-activated
genes to achieve region-specific cellular phenotypes. Recent studies are
continuing to underscore the role of homeodomain proteins in modulating
cellular diversity within a cell type, because Hox proteins are now understood
to modulate skin-cell phenotype in different regions of the body
(Rinn et al., 2006
). We
propose that homeodomain proteins, by instructing bHLH proteins to regulate a
subset of their target genes, provide competence for a cell to execute a
region-specific differentiation program.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/18/3371/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Alper, S. and Kenyon, C. (2001). REF-1, a protein with two bHLH domains, alters the pattern of cell fusion in C. elegans by regulating Hox protein activity. Development 128,1793 -1804.[Abstract]
Bader, D., Masaki, T. and Fischman, D. A.
(1982). Immunochemical analysis of myosin heavy chain during
avian myogenesis in vivo and in vitro. J. Cell Biol.
95,763
-770.
Bárány, M. (1967). ATPase
activity of myosin correlated with speed of muscle shortening. J.
Gen. Physiol. Suppl.
50,197
-216.
Barresi, M. J. F., Stickney, H. L. and Devoto, S. H. (2000). The zebrafish slow-muscle-omitted gene product is required for Hedgehog signal transduction and the development of slow muscle identity. Development 127,2189 -2199.[Abstract]
Begemann, G., Schilling, T. F., Rauch, G. J., Geisler, R. and Ingham, P. W. (2001). The zebrafish neckless mutation reveals a requirement for raldh2 in mesodermal signals that pattern the hindbrain. Development 128,3081 -3094.[Medline]
Bergstrom, D. A. and Tapscott, S. J. (2001).
Molecular distinction between specification and differentiation in the
myogenic basic helix-loop-helix transcription factor family. Mol.
Cell. Biol. 21,2404
-2412.
Bergstrom, D. A., Penn, B. H., Strand, A., Perry, R. L., Rudnicki, M. A. and Tapscott, S. J. (2002). Promoter-specific regulation of MyoD binding and signal transduction cooperate to pattern gene expression. Mol. Cell 9,587 -600.[CrossRef][Medline]
Berkes, C. A., Bergstrom, D. A., Penn, B. H., Seaver, K. J., Knoepfler, P. S. and Tapscott, S. J. (2004). Pbx marks genes for activation by MyoD indicating a role for a homeodomain protein in establishing myogenic potential. Mol. Cell 14,465 -477.[CrossRef][Medline]
Blagden, C. S., Currie, P. D., Ingham, P. W. and Hughes, S.
M. (1997). Notochord induction of zebrafish slow muscle
mediated by Sonic hedgehog. Genes Dev.
11,2163
-2175.
Braun, T., Bober, E., Rudnicki, M. A., Jaenisch, R. and Arnold, H.-H. (1994). MyoD expression marks the onset of skeletal myogenesis in homozygous Myf-5 mutant mice. Development 120,3083 -3092.[Abstract]
Bryson-Richardson, M. J., Daggett, D. F., Cortes, F., Neyt, C., Keenan, D. G. and Currie, P. D. (2005). Myosin heavy chain expression in zebrafish and slow muscle composition. Dev. Dyn. 233,1018 -1022.[CrossRef][Medline]
Buckingham, M. (2001). Skeletal muscle formation in vertebrates. Curr. Opin. Genet. Dev. 11,440 -448.[CrossRef][Medline]
Cao, Y., Kumar, R. M., Penn, B. H., Berkes, C. A., Kooperberg, C., Boyer, L. A., Young, R. A. and Tapscott, S. J. (2006). Global and gene-specific analyses show distinct roles for Myod and Myog at a common set of promoters. EMBO J. 25,502 -511.[CrossRef][Medline]
Currie, P. D. and Ingham, P. W. (1996). Induction of a specific muscle cell type by a hedgehog-like protein in zebrafish. Nature 382,452 -455.[CrossRef][Medline]
de la Serna, I. L., Ohkawa, Y., Berkes, C. A., Bergstrom, D. A.,
Dacwag, C. S., Tapscott, S. J. and Imbalzano, A. N. (2005).
MyoD targets chromatin remodeling complexes to the myogenin locus prior to
forming a stable DNA-bound complex. Mol. Cell. Biol.
25,3997
-4009.
Devoto, S. H., Melancon, E., Eisen, J. S. and Westerfield, M. (1996). Identification of separate slow and fast muscle precursor cells in vivo, prior to somite formation. Development 121,439 -451.
Draper, B. W., Morcos, P. A. and Kimmel, C. B. (2001). Inhibition of zebrafish fgf8 pre-mRNA splicing with morpholino oligos: a quantifiable method for gene knockdown. Genesis 30,154 -156.[CrossRef][Medline]
Du, S. J., Devoto, S. H., Westerfield, M. and Moon, R. T.
(1997). Positive and negative regulation of muscle cell identity
by members of the hedgehog and TGF-beta gene families. J. Cell
Biol. 139,145
-156.
Erickson, T., Scholpp, S., Brand, M., Moens, C. B. and Waskiewicz, A. J. (2007). Pbx proteins cooperate with Engrailed to pattern the midbrain-hindbrain and diencephalic-mesencephalic boundaries. Dev. Biol. 301,504 -517.[CrossRef][Medline]
Feng, X., Adiarte, E. G. and Devoto, S. H. (2006). Hedgehog acts directly on the zebrafish dermomyotome to promote myogenic differentiation. Dev. Biol. 300,736 -746.[CrossRef][Medline]
Gehring, W. J. (1996). The master control gene for morphogenesis and evolution of the eye. Genes Cells 1,11 -15.[Abstract]
Glick, E., Leshkowitz, D. and Walker, M. D.
(2000). Transcription factor BETA2 acts cooperatively with E2A
and PDX1 to activate the insulin gene promoter. J. Biol.
Chem. 275,2199
-2204.
Grandel, H., Lun, K., Rauch, G. J., Rhinn, M., Piotrowski, T., Houart, C., Sordino, P., Kuchler, A. M., Schulte-Merker, S., Geisler, R. et al. (2002). Retinoic acid signalling in the zebrafish embryo is necessary during pre-segmentation stages to pattern the anterior-posterior axis of the CNS and to induce a pectoral fin bud. Development 129,2851 -2865.[Medline]
Groves, J. A., Hammond, C. L. and Hughes, S. M.
(2005). Fgf8 drives myogenic progression of a novel lateral fast
muscle fibre population in zebrafish. Development
132,4211
-4222.
Hamade, A., Deries, M., Begemann, G., Bally-Cuif, L., Genêt, C., Sabatier, F., Bonnieu, A. and Cousin, X. (2006). Retinoic acid activates myogenesis in vivo through Fgf8 signalling. Dev. Biol. 289,127 -140.[CrossRef][Medline]
Hammond, C. L., Hinits, Y., Osborn, D. P. S., Minchin, J. E. N., Tettamanti, G. and Hughes, S. M. (2007). Signals and myogenic regulatory factors restrict pax3 and pax7 expression to dermomyotome-like tissue in zebrafish. Dev. Biol. 302,504 -521.[CrossRef][Medline]
Hatta, K., Bremiller, R., Westerfield, M. and Kimmel, C. B. (1991). Diversity of expression of engrailed-like antigens in zebrafish. Development 112,821 -832.[Abstract]
Hollway, G. E., Bryson-Richardson, R. J., Berger, S., Cole, N. J., Hall, T. E. and Currie, P. D. (2007). Whole-somite rotation generates muscle progenitor cell compartments in the developing zebrafish embryo. Dev. Cell 12,207 -219.[CrossRef][Medline]
Ju, B., Chong, S. W., He, J., Wang, X., Xu, Y., Wan, H., Tong, Y., Yan, T., Korzh, V. and Gong, Z. (2003). Recapitulation of fast skeletal muscle development in zebrafish by transgenic expression of GFP under the mylz2 promoter. Dev. Dyn. 227, 14-26.[CrossRef][Medline]
Kablar, B., Krastel, K., Ying, C., Asakura, A., Tapscott, S. J. and Rudnicki, M. A. (1997). MyoD and Myf-5 differentially regulate the development of limb versus trunk skeletal muscle. Development 124,4729 -4738.[Abstract]
Kim, S. K., Selleri, L., Lee, J. S., Zhang, A. Y., Gu, X., Jacobs, Y. and Cleary, M. L. (2002). Pbx1 inactivation disrupts pancreas development and in Ipf1-deficient mice promotes diabetes mellitus. Nat. Genet. 30,430 -435.[CrossRef][Medline]
Knoepfler, P. S., Bergstrom, D. A., Uetsuki, T., Dac-Korytko,
I., Sun, Y. H., Wright, W. E., Tapscott, S. J. and Kamps, M. P.
(1999). A conserved motif N-terminal to the DNA-binding domains
of myogenic bHLH transcription factors mediates cooperative DNA binding with
Pbx-Meis1/Prep1. Nucleic Acids Res.
27,3752
-3761.
Kobayashi, M., Fujioka, M., Tolkunova, E. N., Deka, D.,
Abu-Shaar, M., Mann, R. S. and Jaynes, J. B. (2003).
Engrailed cooperates with extradenticle and homothorax to repress target genes
in Drosophila. Development
130,741
-751.
Lee, J. E. (1997). Basic helix-loop-helix genes in neural development. Curr. Opin. Neurobiol. 7, 13-20.[CrossRef][Medline]
Liu, J. and Fire, A. (2000). Overlapping roles of two Hox genes and the exd ortholog ceh-20 in diversification of the C. elegans postembryonic mesoderm. Development 127,5179 -5190.[Abstract]
Maves, L., Jackman, W. and Kimmel, C. B. (2002). FGF3 and FGF8 mediate a rhombomere 4 signaling activity in the zebrafish hindbrain. Development 129,3825 -3837.[Medline]
Moens, C. B. and Selleri, L. (2006). Hox cofactors in vertebrate development. Dev. Biol. 291,193 -206.[CrossRef][Medline]
Ohlendieck, K., Frömming, G. R., Murray, B. E., Maguire, P. B., Leisner, E., Traub, I. and Pette, D. (1999). Effects of chronic low-frequency stimulation on Ca2+-regulatory membrane proteins in rabbit fast muscle. Pflugers Arch. 438,700 -708.[CrossRef][Medline]
Oxtoby, E. and Jowett, T. (1993). Cloning of
the zebrafish krox-20 gene (krx-20) and its expression during hindbrain
development. Nucleic Acids Res.
21,1087
-1095.
Pearson, J. C., Lemons, D. and McGinnis, W. (2005). Modulating Hox gene functions during animal body patterning. Nat. Rev. Genet. 6, 893-904.[CrossRef][Medline]
Peers, B., Sharma, S., Johnson, T., Kamps, M. and Montminy, M. (1995). The pancreatic islet factor STF-1 binds cooperatively with Pbx to a regulatory element in the somatostatin promoter: importance of the FPWMK motif and of the homeodomain. Mol. Cell. Bi