|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 13 December 2006
doi: 10.1242/dev.02704
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Developmental and Cell Biology, University of California,
Irvine, 5210 McGaugh Hall, Irvine, CA 92697-2300, USA.
2 Department of Anatomy and Cell Biology, University of Iowa College of
Medicine, 1-532 Bowen Science Building, 51 Newton Rd., Iowa City, Iowa 52242,
USA.
* Author for correspondence (e-mail: tschilli{at}uci.edu)
Accepted 18 October 2006
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key words: Ednra, Craniofacial, Pharyngeal arch, Neural crest, Danio rerio, Zebrafish
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). Although
cranial NC cells carry some positional information from their origins, they
receive many patterning cues from surrounding cells of the pharyngeal
ectoderm, mesoderm and endoderm (Couly et
al., 2002; David et al.,
2002; Noden, 1983;
Schilling et al., 2001;
Seufert and Hall, 1990;
Trainor and Krumlauf, 2000).
These interactions establish the final skeletal pattern, including the size,
location and attachments of each bone
(Creuzet et al., 2004;
Knight and Schilling,
2006).
Recent genetic studies have revealed conserved requirements for Endothelin
1 (Edn1) signaling in dorsoventral (DV) patterning of the pharyngeal skeleton
(Clouthier et al., 1998;
Clouthier and Schilling, 2004;
Clouthier et al., 2000;
Kimmel et al., 2003;
Miller and Kimmel, 2001;
Miller et al., 2000;
Miller et al., 2003;
Thomas et al., 1998;
Walker et al., 2006;
Yanagisawa et al., 1998). Edn1
is one of three known Endothelin peptides, each synthesized as a larger
prepropeptide and subsequently modified by furin proteases and endothelin
converting enzymes (ECEs) to form a mature ligand. These signal through two G
protein-coupled receptors, Ednra and Ednrb, both of which regulate NC
development (Arai et al., 1990;
Sakurai et al., 1990).
Targeted mutations in Edn1, Ednra or Ece1 in mice cause severe ventral bone
malformations in the jaw and throat, while the dorsal skeleton is less
affected (Clouthier et al.,
1998; Kurihara et al.,
1994; Yanagisawa et al.,
1998). Mosaic studies using Ednra-/- chimeric
mice have shown that loss-of-function mutations in Ednra are cell autonomous
in NC (Clouthier et al., 2003).
Edn1 signaling is required for expression of transcription factors such as
Hand2, Msx1, Dlx3 and Dlx6 in the ventral arches
(Charite et al., 2001;
Fukuhara et al., 2004;
Miller et al., 2000). Like
Dlx5;Dlx6-/- double-mutant mice
(Depew et al., 2002), ectopic
dorsal bones form in the lower jaw and ectopic whisker barrels form in the
ectoderm covering the mandible in Edn1-/- and
EdnrA-/- mutants, consistent with a DV transformation
within the arch (Ozeki et al.,
2004; Ruest et al.,
2004).
Insights into the timing and action of Edn1 signaling in NC have come from
studies in zebrafish, particularly analysis of the sucker
(suc;edn1-/-) mutation. Like Edn1-/-
or EdnrA-/- mutant mice, suc;edn1-/-
eliminates the lower jaw and joints in the mandibular and hyoid arches
(Miller et al., 2000). NC
forms and migrates normally in suc;edn1-/- mutants, but
later expression of gsc, msxe, epha4b, hand2, dlx2a and
dlx3b is reduced in the ventral arches. Skeletal defects in
suc;edn1-/- mutants are rescued by Edn1 protein injections
directly into the arch primordium, demonstrating that the requirement is after
migration. suc;edn1-/- mutants also show variable
duplications of dorsal (opercular) bones in the ventral hyoid arch when
injected with Edn1 protein or cDNA
(Clouthier and Schilling, 2004;
Kimmel et al., 2003).
Likewise, mutations in hand2, called hands off (han), also
disrupt ventral cartilages but not dlx3b or epha4b
expression, suggesting that Edn1 acts through Hand2 to regulate expression of
a subset of its targets (Miller et al.,
2003; Yelon et al.,
2000).
Despite intensive studies of the requirements for Edn1 during craniofacial
and cardiovascular development, its important sources remain unclear. Edn1 is
expressed throughout the pharyngeal endoderm, mesoderm at the arch `core' and
surface ectoderm, but not in NC. Cell transplantation in zebrafish has shown
that suc;edn1-/- mutant NC cells can form ventral arch
cartilage in wild-type hosts, consistent with a cell non-autonomous function
(Miller et al., 2000).
Requirements for Edn1 have not been examined carefully in the facial ectoderm,
where specialized domains of oral and pharyngeal ectoderm interact with NC
during facial outgrowth, similar to the apical ectoderm of the limb bud
(Eberhart et al., 2006;
Haworth et al., 2004;
Hu and Helms, 1999;
Knight et al., 2005;
Knight and Schilling, 2006;
Wada et al., 2005;
Wall and Hogan, 1995). The
pharyngeal ectoderm can induce cartilage in mammals
(Hall, 1980), and may also
play a patterning role as it expresses extracellular signaling molecules (e.g.
Edn1, Fgf8, Shh, Bmp4) involved in craniofacial development. In mice,
Fgf8 expression maintains Edn1 expression in posterior arch
ectoderm, suggesting that multiple ectodermal signals converge on NC to
control skull growth and patterning
(Trumpp et al., 1999).
Here we report the cloning and characterization of two zebrafish ednra genes, expressed in cranial NC, and demonstrate their redundant roles in DV patterning of pharyngeal arches. Antisense morpholino oligonucleotides (MOs) targeted against ednra1 eliminate the jaw joint, suggesting that disrupting Edn1 signaling leads to misspecification of joint precursors. The combined depletion of both Ednra1 and Ednra2 eliminates the lower jaw, phenocopying the loss of Edn1. Grafts of wild-type ectoderm into suc;edn1-/- mutants rescue hand2 expression, indicating that Edn1 from the ectoderm acts in a paracrine manner to pattern NC. This ectoderm also expresses ednra1 in an Edn1-dependent manner, suggesting that Edn1 autoregulates its own expression. These are the first experiments pinpointing a crucial source of Edn1 as the pharyngeal ectoderm, and they suggest that this ectoderm controls many aspects of the final skeletal pattern.
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). Homozygous sucker (suctf216)
mutants were isolated from their siblings by jaw morphology at 72 hours
post-fertilization (hpf) (Piotrowski et
al., 1996).
Cloning of zebrafish ednra1 and ednra2
ednra1 was obtained by screening a Zebrafish Embryo Late
Somitogenesis (ZFLS) cDNA library (RZPD) with the mouse Ednra. An 820
bp mouse Ednra radioactive probe (Amersham Multiprime) was hybridized
to cDNA libraries on filters at 55°C. Of the 19 candidate clones, one was
a full-length ednra1. Sequencing was performed using the ABI Big Dye
Terminator Sequencing reagent and run on an ABI prism 310 sequencer (PE
Applied Biosystems). A full-length ednra2 clone was obtained by
5' RACE on a partial clone AB057355 (First-Choice RLM-RACE kit Ambion).
Protein sequences were analyzed using the MegAlign module of DNASTAR LaserGene
v6. Protein sequences were aligned using ClustalX and the phylogenetic tree
viewed using TreeView.
Morpholinos
MOs targeting splice donor sites in ednra1 and ednra2
were designed as reported previously (Gene Tools Inc.)
(Nasevicius and Ekker, 2000).
Ednra1 MO (AGTGGTGTGTTCACCTGTTTGAGGT) was designed to target the sixth
transmembrane domain at amino acid position 288 by comparing the cDNA sequence
to the corresponding genomic contig Zv4_NA2883.1
(www.ensembl.org/D_rerio).
Ednra2 MO (ATCAGACTTTTCTTTACCTGCTTAA) was also designed to target the sixth
transmembrane domain at amino acid position 298 by comparing AB057355 to the
corresponding genomic sequence AL928968.7 on chromosome 1. For all single MO
experiments, ednra1 MO was injected at 2.5 ng per embryo,
ednra2 MO at 5.0 ng per embryo. Co-injections were done at 2.5 ng per
embryo of each MO.
Morpholino efficacy was verified by RT-PCR to detect alternatively spliced products. Total RNA was extracted from approximately 60 control or morphant embryos at 30 hpf and cDNA synthesized using the SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen). PCR amplification was performed with the following primers: ednra1, 5'-GACGGCCTTCAGGATCCTCCTCC-3' (F) and 5'-CAGTTGTAGCTGTCCTTGCGCTG-3' (R); ednra2, 5'-CACCTCATCTGGAAATCAAAGAGCGG-3' (F) and 5'-TGACTTCCTTTCTTCTCATCGGACAGTGAC-3' (R).
Phenotypic analysis and whole-mount RNA in situ hybridization
For skeletal analysis, larvae were fixed at 96 hpf and stained for
cartilage with Alcian Blue, after which they were dissected and flat-mounted
as described (Javidan and Schilling,
2004). In situ hybridization was performed as described previously
(Thisse et al., 1993).
Antisense riboprobe for ednra1 was synthesized using SP6 RNA
polymerase after linearization with EcoRI. For ednra2 a 1600
bp fragment was PCR amplified from wild-type cDNA using primers described
above and cloned into pBS-SK+. Antisense riboprobe was synthesized using T7
RNA polymerase after linearization with SalI. Additional riboprobes
used were bapx1 (Miller et al.,
2003), dlx2a (Akimenko
et al., 1994), hand2
(Yelon et al., 2000),
edn1 (Miller et al.,
2000), gsc
(Schulte-Merker et al., 1994),
sox9a (Yan et al.,
2002) and eng2 (Hatta
et al., 1991; Miller et al.,
2003).
Cell transplantation
Donor embryos were injected with a 3% TRITC-dextran and 3% biotin-dextran
mixture at the one- to two-cell stage and cells were transplanted into
unlabeled hosts at late blastula stages. Cells were grafted to the animal pole
to target ectoderm. Host embryos were sorted at 24 hpf for those containing
fluorescent cells in the pharyngeal arches, and not in the neural tube. These
were reared individually for either in situ hybridization at 30 hpf for
hand2 expression in NC, or Alcian Blue staining for cartilage at 96
hpf. Biotin-labeled donor cells were detected histochemically after fixation
(Vectastain ABC kit). suc;edn1-/- mutant donors were
identified by lack of a jaw at 96 hpf. To target endoderm, donor embryos were
co-injected with lineage tracers and TaramA sense mRNA
(David et al., 2002).
Wild-type cells were transplanted to the gastrula margin in
suc;edn1-/- mutant hosts and reared for either in situ
hybridization for hand2 or Alcian Blue staining. To confirm the
locations of transplanted cells, mosaic embryos were sectioned at 14 µm
using a cryostat.
|
RESULTS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). To further characterize the Edn1 signaling pathway in
zebrafish we isolated two ednra genes, ednra1 and
ednra2. ednra1 was obtained by screening a zebrafish cDNA library
with mouse Ednra as a probe; ednra2 was identified by
homology searches of genomic and cDNA databases, followed by RT-PCR and
5'-RACE experiments. Both Ednra1 and Ednra2 share highly conserved
transmembrane domains (TMD) characteristic of all Ednr proteins
(Fig. 1A, blue). Additionally,
Ednra2 contains an extra, predicted Ednrb-like TMD near its N-terminus that
may be a signal sequence (Fig.
1A, red). Sequence distance and phylogenetic analyses reveal that
Ednra1 and Ednra2 group with Ednras from other species, and are more closely
related to one another (67.9%) than to their mammalian orthologs
(Fig. 1B). The Fugu
rubripes genome also contains two Ednra receptors, suggesting that these
are probably duplicates that arose in the teleost lineage. ednra1 is first expressed during early somitogenesis in migrating cranial NC cells, and expression spreads posteriorly (Fig. 2A). By 16 hpf the three cranial NC streams, as well as NC cells migrating through the somites, all express ednra1 (Fig. 2B,C). Expression persists in postmigratory NC cells of the pharyngeal arches and the trunk between 24 and 36 hpf, and includes the cranial sensory ganglia (Fig. 2D,E). Transverse cryosections through the arches reveal that ednra1 is also expressed in the ectodermal epithelium (Fig. 2F). This ectodermal expression coincides with that of edn1 between 22 and 24 hpf. ednra1 is no longer expressed after 40 hpf.
By contrast, ednra2 is not expressed in premigratory or migrating NC cells and is first detected at 20 hpf in the cranial vasculature (Fig. 2G). Expression in NC begins at 24 hpf in postmigratory cranial NC cells within the arches (Fig. 2H). Transverse cryosections through the arches of embryos double labeled for ednra2 and dlx2a show that, like ednra1, ednra2 is expressed by NC cells throughout the DV extent of each arch (Fig. 2I). However, unlike ednra1, ednra2 is not expressed in the ectodermal epithelium (Fig. 2I). ednra2 expression persists in NC and in both head and trunk vasculature until 72 hpf (Fig. 2J,K).
|
90% (7-15 cells). These results suggest that ednrA1 is
required for a subset of NC cells that form the joints, and that
ednra1 and ednra2 have redundant roles in ventral arch
development. Lower amounts of both MOs, co-injected at 0.75 ng and 1.5 ng
each, did not cause any detectable cartilage defects (data not shown).
|
Reductions in Edn1 signaling in zebrafish are thought to cause partial
transformations of ventral arch cells to more dorsal fates
(Kimmel et al., 2003). To
address this hypothesis, we examined a dorsal arch muscle marker,
eng2, in Ednra morphants (Fig.
4). In uninjected controls at 30 hpf, eng2 marks a small
group of mesodermal cells in the dorsal mandibular arch
(Fig. 4M)
(Hatta et al., 1991;
Hatta et al., 1990). In Ednra1
morphants, eng2 expression often expanded ventrally (82%, 28/34
embryos) (Fig. 4N), while
expression in Ednra2 morphants remained unaffected
(Fig. 4O). In Ednra1;Ednra2
double morphants, ventral expansion of eng2 expression (68%, 25/37
embryos) was always accompanied by a pronounced spread along the
anteroposterior axis (Fig. 4P).
These results are consistent with a partial transformation along the DV axis
and support the hypothesis that Edn1 acts as a ventralizing factor that
patterns the pharyngeal arch along the DV axis.
Widespread NC cell death is thought to be a major cause of the craniofacial
defects in Ednra-/- mutant mice
(Clouthier et al., 2000;
Clouthier and Schilling, 2004).
To examine apoptosis, we stained Ednra-deficient zebrafish with Acridine
Orange, which fluorescently labels the condensed nuclei of dying cells. At 26
hpf, a few dying cells were labeled in the surface ectoderm in uninjected
controls. Similar numbers of Acridine Orange-stained cells were detected in
suc;edn1-/- and in Ednra-deficient embryos (data
not shown), suggesting that the craniofacial skeleton phenotypes in zebrafish
cannot simply be accounted for by cell death.
ednra1 is required for joint development
Ednra1 morphants lack the jaw joint
(Fig. 3D-F). Alcian Blue
staining of Ednra1 morphants at 96 hpf revealed that D1 and V1 were fused in
the mandibular arch, as were D2 and V2 in the hyoid
(Fig. 5J-M). Double morphants
lacked ventral cartilages, but in cases where ventral cartilage remained it
fused to the dorsal cartilages and lacked any signs of joints
(Fig. 5N,O).
|
).
Two-color in situ hybridization revealed that bapx1+ cells lie just
dorsal to hand2 expression in the mandibular arch
(Fig. 5A)
(Miller et al., 2003). In
Ednra1 morphants, the number of bapx1+ cells was reduced, and this
correlated with a later loss of the jaw joint
(Fig. 5B). In double morphants,
ventral hand2 as well as bapx1 expression were eliminated
(Fig. 5C). By 54 hpf,
bapx1 marks multiple domains within the arches. These include the
bilateral joints that form between D1 and V1 and surrounding cells in the
mandibular arch, as well as joints at the ventral midline in both mandibular
and hyoid arches (Fig. 5D)
(Miller et al., 2003). In
Ednra1 morphants, bapx1 expression persisted bilaterally, presumably
in cells that normally surround the mandibular joints
(Fig. 5E). However, Ednra1
morphants lacked the two ventral midline domains of bapx1 expression
in the mandibular and hyoid arches. Instead, a single larger midline domain
formed (Fig. 5E), possibly
leading to the later aberrant fusions between these arches
(Fig. 3E). By contrast,
Ednra1;Ednra2 double morphants showed severe reductions in bapx1
expression in the bilateral jaw joint domains and at the midline
(Fig. 5F).
We also assessed joint loss by sox9a expression, a marker for
prechondrogenic cartilage condensations
(Yan et al., 2002). At 48 hpf,
sox9a marks condensing NC cells in D1 and V1 in the mandibular arch.
Sandwiched between these two domains is a small cell group that downregulates
sox9a, does not differentiate into cartilage and consequently forms
the joint between D1 and V1 (Fig.
5G). In Ednra1 morphants there was no obvious downregulation of
sox9a in presumptive joint cells in the mandibular arch
(Fig. 5H). In Ednra1;Ednra2
double morphants, only a prechondrogenic condensation in the position of D1
remained in the mandibular arch (Fig.
5I). These defects correlate precisely with the cartilage loss or
fusions found in morphant larvae at later stages, and suggest that with slight
reductions in Edn1 signaling the joint region is not maintained. In the
complete absence of the signal, neither the joint nor the entire ventral arch
is specified.
Reciprocal interactions maintain expression of Edn1 and Ednra receptors
To investigate the dependence of ednra expression on the presence
of edn1, we examined receptor expression in
suc;edn1-/- mutants
(Fig. 6). Compared to wild-type
siblings, ednra1 expression appeared unaffected at 20-22 hpf in
mutants (data not shown), but was clearly reduced at 28 hpf in the ventral NC
cells of the mandibular and hyoid arches
(Fig. 6A,B). At the same
stages, ednra2 expression was also reduced in
suc;edn1-/- mutants
(Fig. 6C,D). Thus edn1
maintains ednra1 and ednra2 expression in cranial NC
cells.
|
Cranial ectoderm is a crucial source of Edn1
In all vertebrates that have been examined, edn1 is expressed in
surface ectoderm covering the arches, as well as in the endoderm and mesoderm,
and all three could be important sources in NC patterning
(Clouthier et al., 1998;
Maemura et al., 1996;
Miller et al., 2000). Mosaics
have been performed with edn1 and Ednra mutant NC cells, but
to date no mosaic analyses have tested requirements in other tissues. To
investigate this, we transplanted cells from wild-type donors injected with
lineage tracers into endoderm or ectoderm in suc;edn1-/-
mutants, and analyzed hand2 expression and cartilage formation
(Fig. 7). Our previous mosaic
studies suggested that suc;edn1-/- is not required in
cranial mesoderm (Miller et al.,
2000). To target cells to the endoderm, we co-injected donors with
lineage tracers and the activated form of the activin receptor,
Tarama* (Acvr1b - Zebrafish Information Network), and transplanted
cells at blastula stage (David et al.,
2002). These transplants often filled the entire lining of the
mutant pharynx with wild-type cells, but did not rescue cartilage (data not
shown) or hand2 expression in the arches
(Fig. 7I).
By contrast, wild-type ectodermal cells rescued hand2 expression
in the ventral arch NC in suc;edn1-/- mutants
(Fig. 7). Transplants were
targeted to the animal pole of the blastula, which forms ectoderm
(Kimmel et al., 1990). In 25%
of the transplants, we successfully targeted ventral arch ectoderm on one side
of the head, leaving the other side as an internal control
(Fig. 7C,F,G,H,L). In 6/6
(100%) transplants, wild-type ectoderm unilaterally restored hand2
expression on the transplanted side (Fig.
7C,F,G). In dorsolateral views, hand2 expression in
wild-type embryos marked rings of NC cells surrounding mesodermal cores in the
ventral arches, with small additional expression domains laterally near arch
borders (Fig. 7A,D). In
suc;edn1-/- mutants these rings were abolished, while
expression near arch borders persisted
(Fig. 7B,E). Transplantation of
ectodermal cells consistently rescued hand2 expression in underlying
mesenchyme adjacent to the grafts (Fig.
7C,F,G). Transverse cryosections through the arches of rescued
suc;edn1-/- mutants confirmed that transplanted wild-type
donor cells were confined to pharyngeal ectoderm
(Fig. 7F). Arch cartilages were
also partially rescued in 9/52 cases (17%) of transplants in which large
numbers of donor cells contributed to ectoderm overlying the ventral arch.
Ventral arch elements were completely lost in suc;edn1-/-
mutants, although in 25% of mutants a small remnant of V1 (7-15 cells
when compared to 100-120 cells in control embryos) remained attached to
D1 (Fig. 7J,K). In 1/5 rescued
mutants, a larger V1 element formed on the transplanted side (data not shown).
In 4/5 rescued mutants, some cartilage cells were restored in the ventral
hyoid arch (Fig. 7L). Mosaic
analysis was also done using ectodermal cells overexpressing edn1
mRNA. This resulted in similar rescue of the hyoid arch in 4/4 rescued
mutants. Considering the robust rescue we achieved for hand2
expression with similar transplants, we were surprised to see such weak
effects on cartilage, as we discuss below. However, these results are
consistent with a role for Edn1 produced in the ectoderm in patterning NC
cells along the DV axis of the arch.
|
|
|
DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
), and treatments with Ednra antagonists in both rat
and chick embryos (Kempf et al.,
1998; Spence et al.,
1999). However, unlike the mouse we find no evidence for elevated
apoptosis as a cause of the skeletal phenotype, and instead show that there
are early defects in the specification of NC cells, similar to
suc;edn1-/- mutants, particularly in joint precursors. In
addition, with cell transplantations between wild type and
suc;edn1-/- mutants we show for the first time that an
important source of Edn1 in ventral NC patterning is the pharyngeal ectoderm.
Here edn1 autoregulates its own expression through coexpression of
ednra1, and expression of each gene depends on the other. We propose
that different levels of Edn1 signaling from the ectoderm, acting through two
ednra receptors, pattern ventral and joint domains within the pharyngeal
arches (Fig. 9). Joint domains
require a higher level of Edn1, which may be achieved in part by
autoregulation of Edn1 by Ednra1 globally in the pharyngeal ectoderm.
|
). By contrast, edn1 is expressed in surrounding
tissues of the ventral arch ectoderm, pharyngeal pouch endoderm, core paraxial
mesoderm and endothelia of the aortic arches, but not in NC
(Clouthier et al., 1998;
Maemura et al., 1996;
Miller et al., 2000).
Expression of ednra1 and edn1 overlaps in the pharyngeal
ectoderm.
Our results suggest that early NC migration is unaffected in
suc;edn1-/- or Ednra1;Ednra2 morphant embryos, but that
later development of skeletogenic NC is disrupted. This idea is supported by
the fact that injection of Edn1 protein directly into arch primordia of
suc;edn1-/- mutants as late as 28 hpf partially rescues
their skeletal defects (Miller et al.,
2000). Based on these rescue experiments, as well as the
phenotypes of edn1 and Ednra mutant embryos in various
species, Edn1 appears to act on NC cells after they arrive in the arches
(Clouthier and Schilling,
2004).
Loss of either Edn1 or Ednra function in mice leads to dramatic reductions
in Dlx3, Dlx/6, Hand1, Hand2, Msx1, Gsc and Barx1
expression, and defects in NC survival. Hand2 expression depends on
direct transcriptional regulation by Dlx5 and Dlx6 in response to Edn1
(Beverdam et al., 2002;
Charite et al., 2001;
Depew et al., 2002). Similar
defects in dlx2a, hand2 and gsc expression in
suc;edn1-/- mutants
(Miller et al., 2000) and
Ednra1;Ednra2 morphant zebrafish suggest that these mechanisms of pharyngeal
arch patterning are conserved. While Ednra1 or Ednra2 morphants alone show no
appreciable defects in any of these markers, double morphants lack all
hand2 expression in mandibular and hyoid arches, and ventral domains
of dlx2a and gsc expression are severely reduced.
One model, based on changes in the bony elements in
suc;edn1-/- mutant zebrafish that have been partially
rescued with exogenous Edn1, suggests that Edn1 acts in a graded fashion, with
higher activity ventrally (Kimmel et al.,
2003). Homeotic changes along the DV axis in these embryos
(ventral duplications of dorsal opercular bones) correlate with a loss of
ventral-specific gene expression. Expression of eng2, which marks
dorsal mandibular mesoderm, spreads ventrally in the absence of Edn1
signaling, and similar expansion of eng2 expression occurs in
Ednra1;Ednra2 double morphants. A lack of other dorsal-specific markers,
particularly for NC cells, has precluded a definitive test of the model. One
piece of evidence against the model is the fact that crude injection of Edn1
protein into the arch primordium in suc;edn1-/- mutants
restores relatively normal DV patterning and development of the lower jaw
(Miller et al., 2000). Thus,
rather than a gradient-dependent action of Edn1, NC cells may differ in their
competence to respond to Edn1.
|
; Miller et
al., 2000; Miller et al.,
2003). However, the mechanisms that achieve this specification are
unclear. Our studies demonstrate that Ednra1 is required for proper formation
of mandibular and hyoid joints, and support the hypothesis that Edn1 acts
directly on Ednra+ NC cells to delineate the joint domain. A potential
mechanism by which this occurs is the specification and/or maintenance of
bapx1 expression in presumptive joint domains in the mandibular arch.
Reductions in the expression of bapx1 in Ednra1 morphants correlate
with cartilage fusions and resemble bapx1 morphants
(Miller et al., 2003).
Although Bapx1 is not required for the tympanomandibular joint in mice
(Akazawa et al., 2000;
Tribioli and Lufkin, 1999),
aberrant joints in Edn1-/- and
Ednra-/- mutant mice (the dentary articulates with the
jugal of the zygomatic arch rather than with the squamosal) suggest that roles
for Edn1 signaling in joint formation are partially conserved. With two-color
in situ hybridization we confirmed that bapx1 expression is
restricted to a subset of mandibular mesenchyme dorsal to the hand2
expression domain. While bapx1 expression spreads ventrally in
hand2 mutants (Miller et al.,
2003; Yelon et al.,
2000), expression is reduced or lost in
suc;edn1-/- mutants and Ednra1;Ednra2 double morphants.
These results suggest that Edn1 signals reiteratively delineate joint domains
within the arches directly by regulating expression of bapx1 as well
as indirectly by regulating hand2, which represses bapx1 in
the ventral regions of the arch.
|
q and G11
result in downregulation of known Edn1 targets
(Ivey et al., 2003). This
hypothesis can be addressed by examination of expression of these proteins in
Edn1 and Ednra-deficient embryos.
Ectoderm as a crucial functional source of Edn1 in the arches
Edn1 is a soluble factor, and mosaic studies suggest that it acts in a
non-cell-autonomous manner in NC cells
(Miller et al., 2000). By
contrast, Ednra in mice is required cell autonomously in NC, as
Ednra-deficient cells are excluded from cartilage condensations by wild-type
cells in genetic mosaics (Clouthier et al.,
2003). Edn1 may act as a morphogen emanating from a local, ventral
source to pattern the pharyngeal DV axis
(Kimmel et al., 2003), but it
has remained unclear where the crucial source is located (endoderm, mesoderm
or surface ectoderm). Our results suggest a more important role for the
surface ectoderm than the endoderm. Only grafts of wild-type ectoderm into
suc;edn1-/- mutants rescued hand2 expression and,
conversely, ectodermal cells from suc;edn1-/- donors
disrupted hand2 expression in wild-type host embryos. Every host
animal in which this occurred contained transplanted mutant ectodermal cells
in the vicinity of the ventral arch, further supporting the notion that Edn1
acts upon postmigratory NC cells within the arches.
However, the weak rescue of cartilage that we observed in similar mosaics
at 4 days post-fertilization (dpf) suggests that Edn1 from other tissues may
act together with the ectodermally derived signal in later arch development.
Thus Edn1 may act in multiple steps in NC patterning within an arch: (1) early
Edn1 signaling acting through two Ednras first delineates joints and ventral
`domains'; (2) downstream targets such as bapx1 and hand2
and reinforced Edn1 signaling from the arch endoderm and mesoderm maintains
joints and ventral fates. It is also possible that the ectodermally derived
Edn1 is insufficient to activate the full repertoire of downstream effectors
required for normal cartilage development. Other Edn1 effectors, such as
dlx2a, msxE, gsc and later markers of prechondrogenic cartilage such
as sox9a, may not be rescued in ectodermal mosaics, but this is
difficult to assay as their expression is never entirely lost in the absence
of Edn1. Edn1 may regulate its own expression in the facial ectoderm, as we
have shown that this ectoderm expresses Ednra1. In the absence of ednra1,
edn1 expression is reduced in the ectoderm. This autocrine signaling
mechanism may help explain the apparent discrepancies between autonomous and
non-autonomous functions for Edn1 and Ednra
(Clouthier et al., 2003).
Recent studies suggest that patterning of the cranial ectoderm is one of
the earliest steps in DV patterning of the mandible. In some Edn1 mutant mice,
the skin covering the ventral mandibular arch forms whisker barrels normally
only found dorsally, suggesting a D to V transformation of the ectoderm
(Ozeki et al., 2004). Our
results suggest that precursors of the ventral arch ectoderm are a crucial
source of Edn1, which induces the mandible and jaw joint. This domain of Edn1
expression may be an intrinsic property of the early ectoderm before arch
formation, as DV domains of other ectodermal signals such as Fgf8 and Bmp4 in
mice are established remarkably early, before NC cell migration
(Haworth et al., 2004), and
expression in these ectodermal domains is maintained in the absence of NC
cells in chick (Veitch et al.,
1999). There is growing evidence that the ectoderm imparts
patterning on underlying NC cells. For example, AP-2 transcription factors are
also required in ectoderm for patterning the craniofacial skeleton, and this
interaction appears to involve Fgf signaling
(Knight et al., 2003;
Knight et al., 2004;
Knight et al., 2005). Thus,
future studies of cranial skeletal development and human craniofacial
syndromes should focus more attention on the specialized epithelia of the
facial ectoderm.
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Akazawa, H., Komuro, I., Sugitani, Y., Yazaki, Y., Nagai, R. and Noda, T. (2000). Targeted disruption of the homeobox transcription factor Bapx1 results in lethal skeletal dysplasia with asplenia and gastroduodenal malformation. Genes Cells 5, 499-513.[Abstract]
Akimenko, M. A., Ekker, M., Wegner, J., Lin, W. and Westerfield, M. (1994). Combinatorial expression of three zebrafish genes related to distal-less: part of a homeobox gene code for the head. J. Neurosci. 14,3475 -3486.[Abstract]
Arai, H., Hori, S., Aramori, I., Ohkubo, H. and Nakanishi, S. (1990). Cloning and expression of a cDNA encoding an endothelin receptor. Nature 348,730 -732.[CrossRef][Medline]
Beverdam, A., Merlo, G. R., Paleari, L., Mantero, S., Genova, F., Barbieri, O., Janvier, P. and Levi, G. (2002). Jaw transformation with gain of symmetry after Dlx5/Dlx6 inactivation: mirror of the past? Genesis 34,221 -227.[CrossRef][Medline]
Charite, J., McFadden, D. G., Merlo, G., Levi, G., Clouthier, D.
E., Yanagisawa, M., Richardson, J. A. and Olson, E. N.
(2001). Role of Dlx6 in regulation of an endothelin-1-dependent,
dHAND branchial arch enhancer. Genes Dev.
15,3039
-3049.
Clouthier, D. E. and Schilling, T. F. (2004). Understanding endothelin-1 function during craniofacial development in the mouse and zebrafish. Birth Defects Res. C Embryo Today 72,190 -199.[CrossRef][Medline]
Clouthier, D. E., Hosoda, K., Richardson, J. A., Williams, S. C., Yanagisawa, H., Kuwaki, T., Kumada, M., Hammer, R. E. and Yanagisawa, M. (1998). Cranial and cardiac neural crest defects in endothelin-A receptor-deficient mice. Development 125,813 -824.[Abstract]
Clouthier, D. E., Williams, S. C., Yanagisawa, H., Wieduwilt, M., Richardson, J. A. and Yanagisawa, M. (2000). Signaling pathways crucial for craniofacial development revealed by endothelin-A receptor-deficient mice. Dev. Biol. 217, 10-24.[CrossRef][Medline]
Clouthier, D. E., Williams, S. C., Hammer, R. E., Richardson, J. A. and Yanagisawa, M. (2003). Cell-autonomous and nonautonomous actions of endothelin-A receptor signaling in craniofacial and cardiovascular development. Dev. Biol. 261,506 -519.[CrossRef][Medline]
Couly, G., Creuzet, S., Bennaceur, S., Vincent, C. and Le Douarin, N. M. (2002). Interactions between Hox-negative cephalic neural crest cells and the foregut endoderm in patterning the facial skeleton in the vertebrate head. Development 129,1061 -1073.
Creuzet, S., Schuler, B., Couly, G. and Le Douarin, N. M.
(2004). Reciprocal relationships between Fgf8 and neural crest
cells in facial and forebrain development. Proc. Natl. Acad. Sci.
USA 101,4843
-4847.
David, N. B., Saint-Etienne, L., Tsang, M., Schilling, T. F. and
Rosa, F. M. (2002). Requirement for endoderm and FGF3 in
ventral head skeleton formation. Development
129,4457
-4468.
Depew, M. J., Lufkin, T. and Rubenstein, J. L.
(2002). Specification of jaw subdivisions by Dlx genes.
Science 298,381
-385.
Eberhart, J. K., Swartz, M. E., Crump, J. G. and Kimmel, C.
B. (2006). Early Hedgehog signaling from neural to oral
epithelium organizes anterior craniofacial development.
Development 133,1069
-1077.
Fukuhara, S., Kurihara, Y., Arima, Y., Yamada, N. and Kurihara, H. (2004). Temporal requirement of signaling cascade involving endothelin-1/endothelin receptor type A in branchial arch development. Mech. Dev. 121,1223 -1233.[CrossRef][Medline]
Hall, B. K. (1980). Tissue interactions and the initiation of osteogenesis and chondrogenesis in the neural crest-derived mandibular skeleton of the embryonic mouse as seen in isolated murine tissues and in recombinations of murine and avian tissues. J. Embryol. Exp. Morphol. 58,251 -264.[Medline]
Hatta, K., Schilling, T. F., BreMiller, R. A. and Kimmel, C.
B. (1990). Specification of jaw muscle identity in zebrafish:
correlation with engrailedhomeoprotein expression.
Science 250,802
-805.
Hatta, K., Bremiller, R., Westerfield, M. and Kimmel, C. B. (1991). Diversity of expression of engrailed-like antigens in zebrafish. Development 112,821 -832.[Abstract]
Haworth, K. E., Healy, C., Morgan, P. and Sharpe, P. T.
(2004). Regionalisation of early head ectoderm is regulated by
endoderm and prepatterns the orofacial epithelium.
Development 131,4797
-4806.
Hosoda, K., Hammer, R. E., Richardson, J. A., Baynash, A. G., Cheung, J. C., Giaid, A. and Yanagisawa, M. (1994). Targeted and natural (piebald-lethal) mutations of endothelin-B receptor gene produce megacolon associated with spotted coat color in mice. Cell 79,1267 -1276.[CrossRef][Medline]
Hu, D. and Helms, J. A. (1999). The role of sonic hedgehog in normal and abnormal craniofacial morphogenesis. Development 126,4873 -4884.[Abstract]
Ivey, K., Tyson, B., Ukidwe, P., McFadden, D. G., Levi, G., Olson, E. N., Srivastava, D. and Wilkie, T. M. (2003). Galphaq and Galpha11 proteins mediate endothelin-1 signaling in neural crest-derived pharyngeal arch mesenchyme. Dev. Biol. 255,230 -237.[CrossRef][Medline]
Javidan, Y. and Schilling, T. F. (2004). Development of cartilage and bone. Methods Cell Biol. 76,415 -436.[Medline]
Kempf, H., Linares, C., Corvol, P. and Gasc, J. M. (1998). Pharmacological inactivation of the endothelin type A receptor in the early chick embryo: a model of mispatterning of the branchial arch derivatives. Development 125,4931 -4941.[Abstract]
Kimmel, C. B., Warga, R. M. and Schilling, T. F.
(1990). Origin and organization of the zebrafish fate map.
Development 108,581
-594.
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F. (1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203,253 -310.[Medline]
Kimmel, C. B., Ullmann, B., Walker, M., Miller, C. T. and Crump,
J. G. (2003). Endothelin 1-mediated regulation of pharyngeal
bone development in zebrafish. Development
130,1339
-1351.
Knight, R. D. and Schilling, T. F. (2006). Cranial neural crest and development of the head skeleton. In Neural Crest Induction and Differentiation (Advances in Experimental Medicine and Biology). Vol.589 (ed. J.-P. Saint-Jeannet), pp.120 -133. Georgetown, TX: Landes Bioscience.
Knight, R. D., Nair, S., Nelson, S. S., Afshar, A., Javidan, Y.,
Geisler, R., Rauch, G. J. and Schilling, T. F. (2003).
lockjaw encodes a zebrafish tfap2a required for early neural crest
development. Development
130,5755
-5768.
Knight, R. D., Javidan, Y., Nelson, S., Zhang, T. and Schilling, T. (2004). Skeletal and pigment cell defects in the lockjaw mutant reveal multiple roles for zebrafish tfap2a in neural crest development. Dev. Dyn. 229,87 -98.[CrossRef][Medline]
Knight, R. D., Javidan, Y., Zhang, T., Nelson, S. and Schilling,
T. F. (2005). AP2-dependent signals from the ectoderm
regulate craniofacial development in the zebrafish embryo.
Development 132,3127
-3138.
Kurihara, Y., Kurihara, H., Suzuki, H., Kodama, T., Maemura, K., Nagai, R., Oda, H., Kuwaki, T., Cao, W. H., Kamada, N. et al. (1994). Elevated blood pressure and craniofacial abnormalities in mice deficient in endothelin-1. Nature 368,703 -710.[CrossRef][Medline]
Le Douarin, N. (1982). The Neural Crest. Cambridge, New York: Cambridge University Press.
Maemura, K., Kurihara, H., Kurihara, Y., Oda, H., Ishikawa, T., Copeland, N. G., Gilbert, D. J., Jenkins, N. A. and Yazaki, Y. (1996). Sequence analysis, chromosomal location, and developmental expression of the mouse preproendothelin-1 gene. Genomics 31,177 -184.[Medline]
Miller, C. T. and Kimmel, C. B. (2001). Morpholino phenocopies of endothelin 1 (sucker) and other anterior arch class mutations. Genesis 30,186 -187.[CrossRef][Medline]
Miller, C. T., Schilling, T. F., Lee, K., Parker, J. and Kimmel, C. B. (2000). sucker encodes a zebrafish Endothelin-1 required for ventral pharyngeal arch development. Development 127,3815 -3828.[Abstract]
Miller, C. T., Yelon, D., Stainier, D. Y. and Kimmel, C. B.
(2003). Two endothelin 1 effectors, hand2 and bapx1, pattern
ventral pharyngeal cartilage and the jaw joint.
Development 130,1353
-1365.
Nasevicius, A. and Ekker, S. C. (2000). Effective targeted gene `knockdown' in zebrafish. Nat. Genet. 26,216 -220.[CrossRef][Medline]
Noden, D. M. (1983). The role of the neural crest in patterning of avian cranial skeletal, connective, and muscle tissues. Dev. Biol. 96,144 -165.[CrossRef][Medline]
Ozeki, H., Kurihara, Y., Tonami, K., Watatani, S. and Kurihara, H. (2004). Endothelin-1 regulates the dorsoventral branchial arch patterning in mice. Mech. Dev. 121,387 -395.[CrossRef][Medline]
Piotrowski, T., Schilling, T. F., Brand, M., Jiang, Y. J., Heisenberg, C. P., Beuchle, D., Grandel, H., van Eeden, F. J., Furutani-Seiki, M., Granato, M. et al. (1996). Jaw and branchial arch mutants in zebrafish II: anterior arches and cartilage differentiation. Development 123,345 -356.[Abstract]
Ruest, L. B., Xiang, X., Lim, K. C., Levi, G. and Clouthier, D.
E. (2004). Endothelin-A receptor-dependent and -independent
signaling pathways in establishing mandibular identity.
Development 131,4413
-4423.
Sakurai, T., Yanagisawa, M., Takuwa, Y., Miyazaki, H., Kimura, S., Goto, K. and Masaki, T. (1990). Cloning of a cDNA encoding a non-isopeptide-selective subtype of the endothelin receptor. Nature 348,732 -735.[CrossRef][Medline]
Schilling, T. F., Prince, V. and Ingham, P. W. (2001). Plasticity in zebrafish hox expression in the hindbrain and cranial neural crest. Dev. Biol. 231,201 -216.[CrossRef][Medline]
Schulte-Merker, S., Hammerschmidt, M., Beuchle, D., Cho, K. W., De Robertis, E. M. and Nusslein-Volhard, C. (1994). Expression of zebrafish goosecoid and no tail gene products in wild-type and mutant no tail embryos. Development 120,843 -852.[Abstract]
Seufert, D. W. and Hall, B. K. (1990). Tissue interactions involving cranial neural crest in cartilage formation in Xenopus laevis (Daudin). Cell Differ. Dev. 32,153 -165.[Medline]
Spence, S., Anderson, C., Cukierski, M. and Patrick, D. (1999). Teratogenic effects of the endothelin receptor antagonist L-753,037 in the rat. Reprod. Toxicol. 13, 15-29.[CrossRef][Medline]
Thisse, C., Thisse, B., Schilling, T. F. and Postlethwait, J. H. (1993). Structure of the zebrafish snail1 gene and its expression in wild-type, spadetail and no tail mutant embryos. Development 119,1203 -1215.[Abstract]
Thomas, T., Kurihara, H., Yamagishi, H., Kurihara, Y., Yazaki, Y., Olson, E. N. and Srivastava, D. (1998). A signaling cascade involving endothelin-1, dHAND and msx1 regulates development of neural-crest-derived branc
