|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online October 12, 2007
doi: 10.1242/10.1242/dev.007930
1 Laboratory of Mammalian Molecular Embryology, RIKEN Center for Developmental
Biology, 2-2-3 Minatojima Minamimachi, Chuo-ku, Kobe 650-0047, Japan.
2 Institute of Pathology, University of Munich, Thalkirchner Str. 36, 80337
Munich, Germany.
3 Roche Diagnostics GmbH, Nonnenwald 2, D-82372 Penzberg, Germany.
Author for correspondence (e-mail:
tony{at}cdb.riken.jp)
Accepted 8 August 2007
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key words: Phospholipase C-zeta (PLCZ1), Oocyte activation, Fertilisation, Tumour, Embryo, Transgene
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
) and database searching presumptive of the involvement of
phospholipase C (PLC) identified an erstwhile uncharacterised mammalian
isoform, PLC-zeta (PLCZ1) (Saunders et
al., 2002). PLCZ1 expression was reportedly restricted to the
testis (Saunders et al., 2002)
and shown by protein correlation profiling to be present in demembranated
sperm (Fujimoto et al., 2004).
PLCZ1 is unusual among PLCs because it lacks pleckstrin homology (PH) and Src
homology (SH) domains; proceeding from the N- to the C-terminus, it comprises
four EF hand domains, X and Y domains and a C-terminal C2 region
(Saunders et al., 2002). PLCZ1
deletion analyses suggest that EF hand domains 1 and 2 (EF1 and EF2) are
primarily responsible for phosphatidylinositol 4,5-bisphosphate
(PIP2) hydrolysis, whereas EF3 mediates its exquisite
Ca2+ sensitivity (Kouchi et
al., 2005). PIP, but not PIP2, binding is mediated in
vitro by the C2 domain, which may coordinate with Ca2+ sensing to
regulate pulsatile Ca2+ release from oocyte stores
(Kouchi et al., 2005).
Oscillations in the concentration of intracellular free Ca2+,
referred to as [Ca2+]i, initiate 1-3 minutes after mouse
gamete membrane fusion (Jones et al.,
1995; Lawrence et al.,
1997) and are thought to modulate the activity of calmodulin
kinase II (CAMK2) towards the cytostatic factor FBXO43 (also known as EMI2),
potentiating secondary FBXO43 phosphorylation by PLK1 and targeting it for
proteolytic degradation to induce meiotic exit
(Lorca et al., 1993;
Rauh et al., 2005;
Shoji et al., 2006).
This model of PLCZ1 activity leaves several issues open. The PH domains of
other PLC family members mediate their interactions with phosphoinositides,
but PLCZ1 does not possess a PH domain and the PLCZ1 C2 domain does not bind
to PIP2 in vitro (Kouchi et
al., 2005). PLCZ1 phospholipid targeting remains poorly understood
and a simple interaction might not account for the generation of
IP3 - a prelude to Ca2+ release. Moreover, although
1.25-2.5 fg of native PLCZ1 (corresponding to 3-6% of the amount in
a single sperm) efficiently induces oocyte activation, a 120-240-fold
excess of baculovirus-expressed PLCZ1 (300 fg) is required to induce
[Ca2+]i oscillations resembling those of fertilisation
(Fujimoto et al., 2004;
Kouchi et al., 2004).
Premature attenuation or hyperstimulation of [Ca2+]i
oscillations does not prevent development to term
(Ozil et al., 2006), showing
that embryogenesis in the mouse is tolerant of a range of
[Ca2+]i dynamics during oocyte activation. Finally,
distinct sperm-borne entities reduce the PLCZ1 signalling threshold
(Perry et al., 1999b;
Perry et al., 2000;
Fujimoto et al., 2004) and
play unresolved roles in meiotic exit
(Manandhar and Toshimori,
2003; Sutovsky et al.,
2003; Wu et al.,
2007). These findings raise the possibility that multiple factors
play a role in sperm-dependent meiotic resumption.
Sperm-independent meiotic resumption (parthenogenetic activation) can be
induced by exposing mature mII oocytes to one of a multiplicity of exogenous
non-physiological challenges in vitro, including electrical stimulation
(Tarkowski et al., 1970),
ethanol (Cuthbertson, 1983)
and strontium chloride (Whittingham and
Siracusa, 1978). In vivo, the two best-known models of
sperm-independent meiotic interference are LT/Sv
(Stevens and Varnum, 1974) and
gene-targeted Mos-null mouse strains
(Colledge et al., 1994).
Independently targeted MOS-deficient oocytes exhibit aberrant spindle
migration to produce an abnormally large and persistent first polar body
(Pb1) (Choi et al.,
1996), deregulation of MAPK activity during oocyte maturation
(Araki et al., 1996) and
pronucleus formation following Pb1 extrusion
(Colledge et al., 1994); all
reflect dysfunctional meiosis I, in contrast to parthenogenetic activation in
vitro, which acts upon mature mII oocytes. Mice lacking MOS develop ovarian
teratomas, which are accordingly likely to be a consequence of first meiotic
deregulation. Teratomas occur in 30% of MOS-deficient females when they
are 4-8 months old, but not outside this age range; occasionally, the tumours
are malignant and metastatic (Furuta et
al., 1995).
Teratomas also occur in the other well-known model of maternal meiotic
dysfunction, LT/Sv, although their incidence is slightly higher (37-52%) in
females of 3-4 months, with tumours appearing as early as 2 months
(Stevens and Varnum, 1974).
LT/Sv oocytes frequently undergo mI arrest and/or fail to establish mII arrest
(Hampl and Eppig, 1995), and
it has been concluded that parthenogenetic activation potentiates teratoma
formation (Stevens and Varnum,
1974). However, experiments aimed at rederiving LT/Sv from its
progenitor strains (BALB and C58) revealed that mI arrest is necessary but not
sufficient to elicit parthenogenetic activation
(Eppig et al., 1996).
Furthermore, some LT/Sv-related strains undergo mI arrest and parthenogenesis
without developing teratomas (Eppig et
al., 1996), showing that meiotic failure does not necessarily
result in tumour formation. LT/Sv thus possesses a complex and polygenic
phenotype and predisposing loci have been mapped to chromosomes 1, 6 and 9
(Lee et al., 1997;
Everett et al., 2004). The
single mouse Plcz gene, Plcz1, lies on chromosome 6.
We here evaluated PLCZ1 specificity by forcing its ectopic expression in a broad range of tissues, enabling us to determine whether this interfered with maternal meiosis. These experiments reveal that endogenous PLCZ1 induces activation of mature mII oocytes with a high degree of specificity in vivo, linking fertilisation to tumourigenesis and representing a unique model of parthenogenesis.
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
), and an IRES-Venus (IRES, internal
ribosome entry site) cassette (our unpublished data), were introduced
downstream of this. For the CV series (PLCZ1ctVenus), a Plcz1
amplimer generated with the primers ACATGCATGCACTAGTATGGAAAGCCAACTTCATGAGCTC
and GGAATTCCATATCCCCGGGCCCTCTCTGAAGTACCAAACATA was used to generate a fusion
protein with the junction sequence YVWYFREARGSTMVS; the linker
between the C-terminus of PLCZ1 (...FRE) and the start of Venus (MVS...) is
underlined. For the generation of promoter-mapping constructs (see Fig. S1B in
the supplementary material), a 4.5 kb Plcz1 putative promoter
fragment (pPlcz1) was amplified with TCAGAGGTCACCCAACACGG and
TCCCCCGGGATTTCATGATCTGGGCCGC and used to generate
pPlcz1
Cre. A 4.1 kb Plcz1 fragment was
removed from pPlcz1Cre to produce
pPlcz1Plcz1-FLAG and
pPlcz1Plcz1-FLAG-IRES-Venus. All transgene (tg)
constructs were introduced by mII transgenesis
(Perry et al., 1999a) to
produce founder (F0) B6C3F2 lines that were subsequently
crossed with C57BL/6 unless stated otherwise. Mice were maintained according
to local institutional guidelines.
Culture, manipulation and analysis of oocytes and embryos
Oocyte and embryo retrieval, manipulation and culture were essentially as
described previously (Shoji et al.,
2006; Yoshida and Perry,
2007). For movies, oocytes were transferred to a chamber
(37°C, 5% CO2) on the stage of a Zeiss Axiovert 200 microscope
and collected as described (Shoji et al.,
2006). Nuclear transfer was into B6D2F1 mII oocytes
essentially as described (Yoshida et al., 2007).
PCR
Analysis of mRNA was by PCR as described
(Shoji et al., 2006;
Amanai et al., 2006b).
Plcz1 transcripts in testis and brain samples
(Fig. 1A) were amplified for 25
and 30 cycles, respectively. Amplification of Cre or recombinant
Plcz1 (rPlcz1) mRNAs in pPlcz1 transgenic lines was
with 30 or 35 cycles, respectively. RNA from clinical paraffin sections was
isolated using a High Pure RNA Paraffin Kit (Roche) according to the
manufacturer's instructions. First-strand cDNA was synthesized from 1 µg of
isolated RNA using a Transcriptor First Strand cDNA Synthesis Kit (Roche)
primed with 1 µl of 50 pmol/µl oligo(dT)18 and 2 µl of 600
pmol/µl random hexamer in a final volume of 20 µl. One microlitre of
each cDNA reaction was used per standard 25 µl PCR reaction. PCR reactions
were typically accompanied by RT-minus (lacking reverse transcriptase)
controls, performed on at least two independent preparations and where
appropriate were examined following 2% (w/v) agarose gel electrophoresis.
Ratiometric quantification of mRNAs (qPCR) was as described
(Shoji et al., 2006;
Amanai et al., 2006b).
Amplification of Venus and Plcz1 tgs (with Plcz1
intron-flanking primers to avoid native gene amplification) in 8 ng of tumour
or control genomic DNA was performed to estimate their relative genomic
complements. The ratio of tg signal to endogenous control Actb or
H2afz genomic DNA levels in (diploid) somatic tissue from hemizygotes
was normalised to 1.0 and used as a calibrator for tumours. PCR primer
sequences are given in Table
1.
|
For histopathology, resected tumours were acutely fixed in 4% buffered PFA
(pH 7.0) and embedded in paraffin by standard methods. Sections (1-2 µm)
were deparaffinised, dried and stained with Haematoxylin and Eosin.
Bright-field visualisation and image capture to enable classification (WHO)
was on a Leica Microsystems Application Suite (Leica). Tumours were scored
according to established parameters (World
Health Organization, 2003).
Fluorimetric calcium imaging
Relative levels of ooplasmic [Ca2+]i were determined
for immature germinal vesicle (GV) and mI oocytes or mature mII oocytes.
Immature oocytes were collected 48 hours after equine chorionic gonadotropin
injection and analysed within 2 hours (GV oocytes) or 8-10 hours (mI oocytes)
after collection. Mature, mII oocytes were analysed 14.5 hours after
human chorionic gonadotropin (hCG) injection. Prior to recording, oocytes were
loaded for 30 minutes with 5 mM Fura 2 acetoxymethyl ester (Fura 2-AM;
Molecular Probes) in a humidified atmosphere of 5% (v/v) CO2 in air
at 37°C in KSOM. Oocytes were then placed on the 37°C-heated stage of
an Eclipse TE2000-U inverted fluorescence microscope (Nikon). Fluorescence
images were obtained at 10 second intervals following exposure at 340 and 380
nm (0.2 seconds apart), collected through a 490-530 nm emission filter and
processed with AQUA COSMOS ratio imaging application software (Hamamatsu
Photonics).
Antibodies and immunoblotting
Rabbit polyclonal antibodies against a C-terminal fragment of mouse PLCZ1
(PLCZ1ct, residues 111-648) were affinity-purified from immune serum using
protein G-sepharose beads (Amersham).
For western blotting, tissues were extracted in HBS lysis buffer,
containing 0.1% (w/v) sodium dodecyl sulphate (SDS), 0.5% (w/v) deoxycholate,
1.0% (v/v) Nonidet P40, 150 mM NaCl, 10% (w/v) glycerol and 50 mM HEPES (pH
8.0) and 20 µg protein analysed per sample. For immunoprecipitation, 1
mg/ml protein preparations were mixed with anti-FLAG-conjugated beads (Sigma)
for CS, or anti-PLCZ1ct-conjugated protein G-sepharose beads (Amersham) for
CV, at 4°C overnight. Beads were washed with HBS (CS) or a wash buffer
containing 150 mM NaCl, 2 mM CaCl2, 5 mM MgCl2, 0.05%
(v/v) Nonidet P40, protease inhibitor cocktail and 10 mM Tris-Cl, pH 7.5 (CV).
Bound material was removed by boiling in sample buffer for 5 minutes.
Immunoblotting was typically using enhancer with a LumiGLO Reserve
Chemiluminescent Substrate Kit (Kirkegard and Perry Laboratories) as described
previously (Shoji et al.,
2006).
Epifluorescence microscopy
For immunofluorescence imaging, oocytes were fixed in 4% PFA for 15 minutes
at room temperature following brief (1-2 minute) serial washes in 1% and then
2% PFA. Fixed oocytes were labelled with mouse anti-TUBA (also known as
-tubulin) antibodies (Sigma; 1:9000) followed by anti-mouse IgG
Alexa488 conjugate (Molecular Probes; 1:500) and stained with propidium iodide
(Sigma). Fluorescence was visualised on a Nikon Eclipse E600 microscope
equipped with a Radiance 2100 laser scanning confocal system (BioRad).
Microarray profiling
RNA was recovered from acutely isolated samples using the mirVana
miRNA isolation kit (Ambion) and analysed essentially as described previously
(Amanai et al., 2006a). Data
sets were deposited at the NCBI Gene Expression Omnibus
(http://www.ncbi.nlm.nih.gov/projects/geo/)
with the series accession number GSE4822.
|
RESULTS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
).
To map the promoter elements responsible for this restricted expression,
transgenic mice were generated in which genomic DNA fragments 4.5 and 4.1 kb
upstream of the putative Plcz1 translational start codon respectively
directed transcription of either a Cre or Plcz1 cassette
(Fig. 1B). Each fragment
included the Plcz1 transcriptional start mapped by 5'-RACE
(Fig. 1B)
(Fujimoto et al., 2004).
Transgene (tg) constructs were expressed in the brains of males and females
and the testes of males, with a high degree of tissue but not developmental
specificity in three out of the five independent lines analysed (see Table S1
in the supplementary material). This suggests that the 4.1 kb Plcz1
promoter fragment directs spatial, but not temporal, restriction of
Plcz1 expression. In addition to a 67 nucleotide region
(5'-CATGTG...ACACAG-3') of strong Z-DNA potential
(Champ et al., 2004), the
fragment harbours canonical recognition motifs for sex-determining region Y
(SRY) protein (Harley et al.,
1992) and a perfect repeat of the palindromic cAMP-responsive
element binding protein (CREBP; also known as CREB5) cognate sequence
(Fig. 1B)
(Maekawa et al., 1989). A
similar configuration directs thimet oligopeptidase (Thop1) gene
expression in spermatid-derived cell lines
(Morrison and Pierotti,
2003).
|
Founder ovarian Plcz1 transcript levels were quantified (not shown). Adult males and females of lines CV3 and CS16 expressed tg transcripts and recombinant PLCZ1 (rPLCZ1) protein in multiple tissues (Fig. 1D). Protein expression in the CV3 F1, CV3-13, was higher than that of subsequent outbred generations.
CV3 and CS16 individuals of either sex appeared healthy for the first
3 months, indicating that PLCZ1 is largely inert at the levels found in
these lines. Male hemizygotes outcrossed with C57BL/6 produced litter sizes
within the control range (7.91±0.29, n=105,
P>0.05), but female CV3 or CS16 hemizygotes crossed with C57BL/6
males produced litter sizes significantly smaller than those of controls
(0.85±0.348, n=26, P<0.0001). Such disruption of
female reproductive function by rPLCZ1 was consistent with maternal meiotic
abnormalities.
Oocytes from PLCZ1-expressing females undergo meiotic maturation to mII, followed by parthenogenetic activation
Immature oocytes collected from rPlcz1 transgenic females
underwent GV breakdown and entered mI before extruding a Pb1 and
forming an mII spindle (Fig.
2A). Time-lapse imaging (see Movie 1 in the supplementary
material) showed normal kinetics of Pb1 extrusion in hemizygotes
(P=0.81) en route to mII (Fig.
2A-D); the mean Pb1 extrusion time for hemizygotes was
12.80±0.42 hours post-collection (n=34 oocytes), and for
non-transgenic littermates it was 12.65±0.47 hours (n=24
oocytes). Spindle and chromosome behaviour during maturation were
indistinguishable in oocytes from hemizygotes and controls
(Fig. 2A). Injection of
wild-type GV oocytes with sperm-derived active PLCZ1
(Fujimoto et al., 2004) did
not interfere with meiotic progression (n=38). Superovulated oocytes
from hemizygotes analysed 13 hours after human chorionic gonadotropin
(hCG) administration possessed an mII plate
(Fig. 2A,C,D), a clear
Pb1, condensed metaphase chromosomes attached to spindles and
Fbxo43 mRNA at 99.7±9.8% of control levels (n=6)
(Shoji et al., 2006). During
maturation, oocytes from transgenic (GV, n=18; mI, n=18) and
non-transgenic (GV, n=17; mI, n=18) females exhibited a
similar pattern of [Ca2+]i oscillations
(Fig. 2E) reminiscent of that
previously described for wild-type oocytes
(Carroll et al., 1994).
Oscillation amplitudes in GV oocytes from transgenic females were greater than
those of controls (Fig. 2E).
Although PLCZ1 may boost [Ca2+]i oscillation amplitude
at the GV stage, these findings indicate in different ways that PLCZ1 does not
functionally interfere with meiotic maturation and that most, or all, oocytes
establish mII in the presence of rPLCZ1.
|
13 hours post-hCG), metaphase
arrays were observed to rotate and/or separate in preparation for cytokinesis
(Sun and Schatten, 2006),
indicating meiotic exit (Fig.
2D). Collected oocytes exhibited spontaneous
[Ca2+]i rises of variable (and often very large)
amplitude with first-to-second recorded peak intervals of 12.48±0.82
minutes (n=16) initiated by a basal pacemaker rise characteristic of
fertilisation (Jones et al.,
1995; Perry et al.,
2000) (Fig. 2E).
Parthenogenotes emitted a Pb2, formed a single maternal pronucleus
of normal size and developed efficiently to the morula/blastocyst stage in
vitro (Fig. 2F,G).
|
60% of cases; this level approximates to
the proportion of oocytes activated by 1.25 fg of sperm-derived PLCZ1 (50%)
(Fujimoto et al., 2004),
suggesting that a similar amount of rPLCZ1 was transferred with each cumulus
cell nucleus. Nuclear transfer zygotes cleaved efficiently and developed in
vitro (Fig. 2H,I). Thus, rPLCZ1
produced in vivo directly stimulates the parthenogenetic activation of mII
oocytes. The level of rPlcz1 mRNA in mature mII oocytes from hemizygotes was only 12.3±11.3% of that of GV oocytes (n=8, P=0.0001). Consistent with this, maturing ovarian (but not mII) oocytes of the line CS16 exhibited clear Venus epifluorescence (Fig. 3A); Venus is encoded by the same bicistronic mRNA as rPLCZ1 in the line CS16 (Fig. 1C). This suggests that meiotic exit was induced by PLCZ1 that had been produced prior to mII.
Oviductal parthenogenotes at later cleavage stages, including blastocysts, were recovered from transgenic females 16 hours post-hCG (Fig. 3B), showing that activation occurred independently of superovulation.
Highly penetrant ovarian tumourigenesis in PLCZ1 transgenic females
Hemizygous CS16 and CV3 ovaries were typically of healthy appearance at 3-4
months. However, histochemical sectioning of one intact transgenic ovary
revealed an early-stage follicular choriocarcinoma or yolk sac tumour
(Fig. 3C).
Most young rPLCZ1-expressing individuals were overtly asymptomatic, but by
5-6 months, many females had developed abdominal swellings caused by ovarian
tumours (Fig. 4A).
Tumourigenesis exhibited a typical latency of 
3 months, although onset was
apparent macroscopically as early as 61 days. Age-matched rPLCZ1-expressing
males remained largely asymptomatic. Tumour formation in females was highly
penetrant (Fig. 4B) and
occurred bilaterally or unilaterally (Fig.
4A). Hemizygous females occasionally (14.7%, n=116)
contained abortive implantation fossa (Fig.
4C) without evidence of uterine tumourigenesis. Development of
ovarian tumours was also highly penetrant in ICR outcrosses; 92.9% of females
from ICRxCS16 crosses developed tumours (n=14). Tumour
development was therefore not highly restricted by genetic background.
The rPlcz1 tg integrant dosage in most (69%, n=13)
tumours was generally 1.0-1.5 per diploid genome complement as determined
by qPCR (Fig. 4D). Apparent tg
dosages were generally conserved even when genomic DNA samples were taken from
multiple (up to six) sites in the same growth
(Fig. 4D) and thus did not
reflect an averaging of 0.0 and 2.0 integrations per genome across the
entirety of a given tumour.
Tumours contained elevated levels of rPlcz1 mRNA relative to
controls (P=0.0046) and decreased levels of Mos and
Fbxo43 transcripts (P
0.00023), which are downregulated
post-activation (Fig. 5A)
(Shoji et al., 2006). Whereas
miRNA profiles are the signatures of some solid tumours
(Lu et al., 2005;
Volinia et al., 2006), the
profiles of teratomas were diverse, reflecting teratoma heterogeneity (see
Fig. S1 in the supplementary material).
Imprinted gene expression in tumours was found to be segregated, with
paternally-expressed transcripts present at significantly lower levels
(P<0.05 for seven out of the ten genes examined) than in controls,
whereas steady-state levels of seven out of nine maternally-expressed mRNAs
were 1.0 or >1.0 compared with controls
(Fig. 5B). Transcripts for
placental markers Plac1, Gcm1, Zfp36l3, Plib and Tpbpa
(Fig. 5C) were not detected.
These profiles are expected for parthenogenetic tumours in which paternally
imprinted alleles and placental tissue are depleted or absent.
Histopathology of tumours at 4-6 months revealed mature cystic teratoma
(epidermoid cyst), cystadenoma with borderline malignancy, and mixed germ cell
tumours (Fig. 6). Histological
heterogeneity reflects the extensive capacity for multipotent differentiation
of parthenogenetic lineages (Stevens,
1978). The presence of mature cystic teratoma may represent
remnants of incompletely regressed Wolfian duct, and cystadenomas are also
found in aging mice, either of which might be due to somatic cell
differentiation. However, we never observed ovarian tumours in age-matched,
non-transgenic littermates.
|
The relationship between PLCZ1 expression, ataxia and different contexts of ovarian tumourigenesis
We addressed the possibility that LT/Sv oocytes contain active PLCZ1. With
the exception of the brain, a site of wild-type Plcz1 expression
(Fig. 1A), Plcz1
transcript levels in other female LT/Sv tissues (including ovaries) at 8 weeks
were undetectable (Fig. 5D). We
verified this result by sequencing the 4.5 kb Plcz1 promoter region
(Fig. 1B) of LT/Sv and that of
its presumptive relative, the non-parthenogenetic strain BALB/c
(Eppig et al., 1996); the
sequences were identical (not shown). Promoter sequence conservation and the
lack of ovarian Plcz1 mRNA indicate that LT/Sv phenotypes are not due
to anomalous Plcz1 expression.
rPlcz1 transgenic mice exhibited occasional (n=7) hind limb ataxia (see Movie 2 in the supplementary material). The high-level expresser, CV3-13, was ataxic and although no CS16 hemizygotes exhibited the phenotype, two homozygotes did. Of the remaining four affected members of the CV3 line, two were male and two female. These data show that the phenotype was not sex-specific and may correlate with PLCZ1 expression levels.
Some cases of human ovarian cancer also present with ataxia
(Geomini et al., 2001). We
investigated whether human tumours contained elevated levels of PLCZ1
mRNA in common with the tumours of CV3 and CS16 lines (not shown). However, we
found no evidence for genetically predisposed PLCZ1 expression in
human breast epithelial (n=15), or ovarian epithelial (n=15)
or benign ovarian germline (n=22) tumours
(Fig. 5E and not shown).
|
DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The principal phenotypes induced by rPlcz1 tg expression -
parthenogenesis, tumourigenesis and, to a lesser extent, ataxia in both sexes
- are thus apparently associated with those tissues in which Plcz1 is
normally expressed (Fig. 1A).
This argues that the cellular machinery required to transduce PLCZ1 signalling
is restricted to the same tissues: oocytes and the brain. Our preliminary data
suggest that within the brain, Plcz1 mRNA is predominantly localised
to the telencephalon (not shown). In one model, the presence of telencephalic
PLCZ1 signal-transducing machinery would render the telencephalon susceptible
to PLCZ1 overexpression, resulting in motor function defects that account for
sporadic ataxia. A plausible role for this machinery (and its counterpart in
the oocyte) would be to facilitate the targeting of PLCZ1 to PIP2
(as its C2 domain is insufficient to do so) in a manner similar to the
interaction of PLCB1 with GNAQ (Wang et
al., 1999; Kouchi et al.,
2005). The possibility remains open that higher levels of ectopic
PLCZ1 expression overcome the requirement for an adaptor to induce broader
(lethal) embryonic phenotypes not investigated here.
|
).
Teratomas in males are more likely to be malignant than those in females
(Stevens, 1967), so although a
male meiotic role for FBXO43 is presumptive, PLCZ1-FBXO43 signalling in the
testis could perturb the cell cycle and result in catastrophic neoplastic germ
cell transformation, implying the stringent need to avoid it. In summary, the data presented here suggest that PLCZ1 activity in vivo requires tissue-specific accessory factors. These might include adaptors that bind to PLCZ1, thereby compensating for its inherent lack of PH or SH domains.
PLCZ1-induced parthenogenesis and its relationship to other in vivo models of parthenogenesis
Several lines of evidence suggest that oocytes in rPlcz1
transgenic lines CV3 and CS16 complete meiotic maturation before undergoing
activation. Ectopic rPLCZ1 expression during oogenesis thus represents the
first in vivo model in which the normal program of coordinated maternal
cytoplasmic and nuclear maturation precedes autonomous parthenogenetic
activation.
Endogenous expression from rPlcz1 tgs induced meiotic exit in a
manner characteristic of normal fertilisation. Demonstration of this faculty
in vivo circumvents some drawbacks of injection experiments, which do not
completely eliminate the possibility that non-physiological RNA or exogenous
impurities act as co-factors; enzymes such as telomerase have an RNA component
(Greider and Blackburn, 1987)
and non-DNA-metabolising signalling enzymes such as DNA protein kinase require
DNA (Carter et al., 1990).
Parthenogenesis occurs in both Mos-deficient and LT/Sv oocytes. In
the absence of MOS, MAPK signalling is not established during mI
(Araki et al., 1996;
Choi et al., 1996). LT/Sv
oocytes frequently arrest at mI (Hampl and
Eppig, 1995); this failure is associated with precocious cell
cycle progression but is not sufficient to induce it
(Eppig et al., 1996). LT/Sv
females heterozygous for the polymorphic marker Gpi1 produce
homozygous tumours and, although it was inferred from this that the teratomas
arose from oocytes that completed meiosis I
(Eppig et al., 1977),
reductive division of tetraploid cells at any stage in early tumourigenesis,
followed by clonal selection (or other pathways), could produce the same
result. Moreover, tumour cells of rPlcz1 transgenic mice are
apparently hemizygous. Finally, LT/Sv oocytes efficiently induce activation
when fused to wild-type mII oocytes
(Ciemerych and Kubiak, 1998),
yet this is not owing to expression of PLCZ1
(Fig. 5D). Previous in vivo
models of parthenogenesis reflect aberrant mI and differ from the one
described here.
|
The model does not explain the apparent hemizygosity of most tumours within
hemizygous females, as the clonal generation of diploid cells from haploid
parthenogenotes (Kaufman et al.,
1983) would generally result in homozygosity [as it does in LT/Sv,
where tumours arise from meiosis I failure and are homozygous in 90% of
cases (Eppig et al., 1977)].
This objection is addressed if a primary tumour in rPLCZ1-expressing females
impeded subsequent ovulation, thereby increasing the likelihood of
supernumerary tumours in the same ovary and enabling the fusion of the cells
of different early teratomas. Tumour cells generally (but not always)
contained the rPlcz1 tg, implying a post-activation selective
advantage of PLCZ1 expression.
Tumourigenesis could have followed failure of meiosis I and subsequent
cytoplasmic maturation, allowing activation by rPLCZ1 of an oocyte containing
four genomic complements (Mehlmann and
Kline, 1994; Carroll et al.,
1996). We found no evidence to support this model and several
observations argue against it. PLCZ1 expression did not interfere with oocyte
maturation (Fig. 2A-E and see
Movie 1 in the supplementary material), and even where parthenogenesis due to
the failure of meiosis I occurs at high frequency [100% in the case of
Mos-null oocytes (Colledge et
al., 1994)], the frequency of tumour formation is markedly lower:
30% for Mos-null mice versus 60% for ectopic rPLCZ1 expression
(Furuta et al., 1995)
(Fig. 4B). Parthenogenesis in
LT/Sv is not sufficient to induce tumour formation
(Eppig et al., 1996) and the
genotype predisposing to the LT/Sv phenotype maps to at least three unascribed
loci (Lee et al., 1997;
Everett et al., 2004), none of
which is Plcz1 (Fig.
5D).
Although wild-type parthenogenotes exhibit retarded extra-embryonic
development, they are able to develop for 10 days in vivo
(Kaufman et al., 1977) and, in
keeping with this, we observed uterine implantation in transgenic virgins
(Fig. 4C). Implantation can
occur ectopically (McLaren and Tarkowski,
1963) and embryonal carcinoma cells generate tumours in vivo
(Stevens, 1970). The ovary is
clearly not a unique niche for teratoma development and the failure of uterine
tumours to develop suggests either that growth was too slow or that uterine
mechanisms exist to prevent parthenogenic tumour development.
We found no evidence of metastasis in rPLCZ1-expressing mice, although the
pronounced growth of ovarian tumours indicated angiogenesis
(Folkman and Klagsbrun, 1987)
and at least one tumour from the CS line
(Fig. 5C) expressed all four
signature genes (Ereg, Ptgs2, Mmp1a and Mmp2) for lung
tumourigenesis and metastasis (Gupta et
al., 2007). We were unable to detect expression of the cancer stem
cell marker protein PROM1 (CD133) (Hemmati
et al., 2003) immunohistochemically in teratomas (not shown).
Although this suggests that in general, cell fate commitment was an early
event in ovarian tumour establishment
(Avilion et al., 2003;
Kania et al., 2005), the
presence of NM_026894 and Pou5f1 transcripts in tumours
(Fig. 5A) is consistent with a
small population of relatively undifferentiated cells
(Monk and Holding, 2001;
Tai et al., 2005).
These data collectively demonstrate that oocytes exposed to endogenous PLCZ1 mature normally and establish mII. PLCZ1 is sufficient to induce meiotic exit, parthenogenetic development and teratoma formation with exquisite specificity. The studies establish a novel relationship between fertilisation and tumourigenesis and imply a tractable model with which to study the dysregulation (and thereby the productive orchestration) of embryogenesis.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/21/3941/DC1
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
|
REFERENCES |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Amanai, M., Brahmajosyula, M. and Perry, A. C. F.
(2006a). A restricted role for sperm-borne microRNAs in mammalian
fertilization. Biol. Reprod.
75,877
-884.
Amanai, M., Shoji, S., Yoshida, N., Brahmajosyula, M. and Perry,
A. C. F. (2006b). Injection of mammalian metaphase II oocytes
with short interfering RNAs to dissect meiotic and early mitotic events.
Biol. Reprod. 75,891
-898.
Araki, K., Naito, K., Haraguchi, S., Suzuki, R., Yokoyama, M., Inoue, M., Aizawa, S., Toyoda, Y. and Sato, E. (1996). Meiotic abnormalities of c-mos knockout mouse oocytes: activation after first meiosis or entrance into third meiotic metaphase. Biol. Reprod. 55,1315 -1324.[Abstract]
Avilion, A. A., Nicolis, S. K., Pevny, L. H., Perez, L., Vivian,
N. and Lovell-Badge, R. (2003). Multipotent cell lineages in
early mouse development depend on SOX2 function. Genes
Dev. 17,126
-140.
Carroll, J., Swann, K., Whittingham, D. and Whitaker, M. (1994). Spatiotemporal dynamics of intracellular [Ca2+]i oscillations during the growth and meiotic maturation of mouse oocytes. Development 120,3507 -3517.[Abstract]
Carroll, J., Jones, K. T. and Whittingham, D. G. (1996). Ca2+ release and the development of Ca2+ release mechanisms during oocyte maturation: a prelude to fertilization. Rev. Reprod. 1, 137-143.[Abstract]
Carter, T., Vancurova, I., Sun, I., Lou, W. and DeLeon, S.
(1990). A DNA-activated protein kinase from HeLa cell nuclei.
Mol. Cell. Biol. 10,6460
-6471.
Champ, P. C., Maurice, S., Vargason, J. M., Camp, T. and Ho, P.
S. (2004). Distributions of Z-DNA and nuclear factor I in
human chromosome 22, a model for coupled transcriptional regulation.
Nucleic Acids Res. 32,6501
-6510.
Choi, T., Fukasawa, K., Zhou, R., Tessarollo, L., Borror, K.,
Resau, J. and Vande Woude, G. F. (1996). The
Mos/mitogen-activated protein kinase (MAPK) pathway regulates the size and
degradation of the first polar body in maturing mouse oocytes.
Proc. Natl. Acad. Sci. USA
93,7032
-7035.
Ciemerych, M. A. and Kubiak, J. Z. (1998). Cytostatic activity develops during meiosis I in oocytes of LT/Sv mice. Dev. Biol. 200,198 -211.[CrossRef][Medline]
Colledge, W. H., Carlton, M. B., Udy, G. B. and Evans, M. J. (1994). Disruption of c-mos causes parthenogenetic development of unfertilized mouse eggs. Nature 370, 65-68.[CrossRef][Medline]
Cuthbertson, K. S. R. (1983). Parthenogenetic activation of mouse oocytes in vitro with ethanol and benzyl alcohol. J. Exp. Zool. 226,311 -314.[CrossRef][Medline]
Eppig, J. J., Kozak, L. P., Eicher, E. M. and Stevens, L. C. (1977). Ovarian teratomas in mice are derived from oocytes that have completed the first meiotic division. Nature 269,517 -518.[CrossRef][Medline]
Eppig, J. J., Wigglesworth, K., Varnum, D. S. and Nadeau, J.
H. (1996). Genetic regulation of traits essential for
spontaneous ovarian teratocarcinogenesis in strain LT/Sv mice: aberrant
meiotic cell cycle, oocyte activation, and parthenogenetic development.
Cancer Res. 56,5047
-5054.
Everett, C. A., Auchincloss, C. A., Kaufman, M. H., Abbott, C.
M. and West, J. D. (2004). Genetic influences on ovulation of
primary oocytes in LT/Sv strain mice. Reproduction
128,565
-571.
Folkman, J. and Klagsbrun, M. (1987).
Angiogenic factors. Science
235,442
-447.
Fujimoto, S., Yoshida, N., Fukui, T., Amanai, M., Isobe, T.,
Itagaki, C., Izumi, T. and Perry, A. C. F. (2004). Mammalian
phospholipase C
induces oocyte activation from the sperm perinuclear
matrix. Dev. Biol. 274,370
-383.[CrossRef][Medline]
Furuta, Y., Shigetani, Y., Takeda, N., Iwasaki, K., Ikawa, Y. and Aizawa, S. (1995). Ovarian teratomas in mice lacking the protooncogene c-mos. Jpn. J. Cancer Res. 86,540 -545.
Geomini, P. M., Dellemijn, P. L. and Bremer, G. L. (2001). Paraneoplastic cerebellar degeneration: neurological symptoms pointing to occult ovarian cancer. Gynecol. Obstet. Invest. 52,145 -146.[CrossRef][Medline]
Greider, C. W. and Blackburn, E. H. (1987). The telomere terminal transferase of Tetrahymena is a ribonucleoprotein enzyme with two kinds of primer specificity. Cell 51,887 -898.[CrossRef][Medline]
Gupta, G. P., Nguyen, D. X., Chiang, A. C., Bos, P. D., Kim, J. Y., Nadal, C., Gomis, R. R., Manova-Todorova, K. and Massague, J. (2007). Mediators of vascular remodelling co-opted for sequential steps in lung metastasis. Nature 446,765 -770.[CrossRef][Medline]
Hampl, A. and Eppig, J. J. (1995). Analysis of the mechanism(s) of metaphase I arrest in maturing mouse oocytes. Development 121,925 -933.[Abstract]
Harley, V. R., Jackson, D. I., Hextall, P. J., Hawkins, J. R.,
Berkovitz, G. D., Sockanathan, S., Lovell-Badge. R. and Goodfellow, P. N.
(1992). DNA binding activity of recombinant SRY from normal males
and XY females. Science
255,453
-456.
Hemmati, H. D., Nakano, I., Lazareff, J. A., Masterman-Smith,
M., Geschwind, D. H., Bronner-Fraser, M. and Kornblum, H. I.
(2003). Cancerous stem cells can arise from pediatric brain
tumors. Proc. Natl. Acad. Sci. USA
100,15178
-15183.
Jones, K. T., Carroll, J. and Whittingham, D. G.
(1995). Ionomycin, thapsigargin, ryanodine, and sperm induced
Ca2+ release increase during meiotic maturation of mouse oocytes.
J. Biol. Chem. 270,6671
-6677.
Kania, G., Corbeil, D., Fuchs, J., Tarasov, K. V., Blyszczuk,
P., Huttner, W. B., Boheler, K. R. and Wobus, A. M. (2005).
Somatic stem cell marker prominin-1/CD133 is expressed in embryonic stem
cell-derived progenitors. Stem Cells
23,791
-804.
Kaufman, M. H., Barton, S. C. and Surani, M. A. (1977). Normal postimplantation development of mouse parthenogenetic embryos to the forelimb bud stage. Nature 265,53 -55.[CrossRef][Medline]
Kaufman, M. H., Robertson, E. J., Handyside, A. H. and Evans, M. J. (1983). Establishment of pluripotential cell lines from haploid mouse embryos. J. Embryol. Exp. Morphol. 73,249 -261.[Medline]
Kouchi, Z., Fukami, K., Shikano, T., Oda, S., Nakamura, Y.,
Takenawa, T. and Miyazaki, S. (2004). Recombinant
phospholipase C has high Ca2+ sensitivity and induces
Ca2+ oscillations in mouse eggs. J. Biol.
Chem. 279,10408
-10412.
Kouchi, Z., Shikano, T., Nakamura, Y., Shirakawa, H., Fukami, K.
and Miyazaki, S. (2005). The role of EF-hand domains and C2
domain in regulation of enzymatic activity of phospholipase C.
J. Biol. Chem. 280,21015
-21021.
Lawrence, Y., Whitaker, M. and Swann, K. (1997). Sperm-egg fusion is the prelude to the initial Ca2+ increase at fertilization in the mouse. Development 124,233 -241.[Abstract]
Lee, G. H., Bugni, J. M., Obata, M., Nishimori, H., Ogawa, K.
and Drinkwater, N. R. (1997). Genetic dissection of
susceptibility to murine ovarian teratomas that originate from parthenogenetic
oocytes. Cancer Res. 57,590
-593.
Lorca, T., Cruzalegui, F. H., Fesquet, D., Cavadore, J. C., Mery, J., Means, A. and Doree, M. (1993). Calmodulin-dependent protein kinase II mediates inactivation of MPF and CSF upon fertilization of Xenopus eggs. Nature 366,270 -273.[CrossRef][Medline]
Lu, J., Getz, G., Miska, E. A., Alvarez-Saavedra, E., Lamb, J., Peck, D., Sweet-Cordero, A., Ebert, B. L., Mak, R. H., Ferrando, A. A. et al. (2005). MicroRNA expression profiles classify human cancers. Nature 435,834 -838.[CrossRef][Medline]
Maekawa, T., Sakura, H., Kanei-Ishii, C., Sudo, T., Yoshimura, T., Fujisawa, J., Yoshida, M. and Ishii, S. (1989). Leucine zipper structure of the protein CRE-BP1 binding to the cyclic AMP response element in brain. EMBO J. 8,2023 -2028.[Medline]
Manandhar, G. and Toshimori, K. (2003). Fate of
postacrosomal perinuclear theca recognized by monoclonal antibody MN13 after
sperm head microinjection and its role in oocyte activation in mice.
Biol. Reprod. 68,655
-663.
McLaren, A. and Tarkowski, A. K. (1963). Implantation of mouse eggs in the peritoneal cavity. J. Reprod. Fertil. 6,385 -392.[Medline]
Mehlmann, L. M. and Kline, D. (1994). Regulation of intracellular calcium in the mouse egg: calcium release in response to sperm or inositol trisphosphate is enhanced after meiotic maturation. Biol. Reprod. 51,1088 -1098.[Abstract]
Monk, M. and Holding, C. (2001). Human embryonic genes re-expressed in cancer cells. Oncogene 20,8085 -8091.[CrossRef][Medline]
Morrison, L. S. and Pierotti, A. R. (2003). Thimet oligopeptidase expression is differentially regulated in neuroendocrine and spermatid cell lines by transcription factor binding to SRY (sex-determining region Y), CAAT and CREB (cAMP-response-element-binding protein) promoter consensus sequences. Biochem. J. 376,89 -197.
Ozil, J. P., Banrezes, B., Toth, S., Pan, H. and Schultz, R. M. (2006). Ca2+ oscillatory pattern in fertilized mouse eggs affects gene expression and development to term. Dev. Biol. 300,534 -544.[CrossRef][Medline]
Perry, A. C. F., Wakayama, T., Kishikawa, H., Kasai, T., Okabe,
M., Toyoda, Y. and Yanagimachi, R. (1999a). Mammalian
transgenesis by intracytoplasmic sperm injection.
Science 284,1180
-1183.
Perry, A. C. F., Wakayama, T. and Yanagimachi, R.
(1999b). A novel trans-complementation assay suggests
full mammalian oocyte activation is coordinately initiated by multiple,
submembrane sperm compartments. Biol. Reprod.
60,747
-755.
Perry, A. C. F., Wakayama, T., Cooke, I. M. and Yanagimachi, R. (2000). Mammalian oocyte activation by the synergistic action of discrete sperm head components: induction of calcium transients and involvement of proteolysis. Dev. Biol. 217,386 -393.[CrossRef][Medline]
Rauh, N. R., Schmidt, A., Bormann, J., Nigg, E. A. and Mayer, T. U. (2005). Calcium triggers exit from meiosis II by targeting the APC/C inhibitor XErp1 for degradation. Nature 437,1048 -1052.[CrossRef][Medline]
Runft, L. L., Jaffe, L. A. and Mehlmann, L. M. (2002). Egg activation at fertilization: where it all begins. Dev. Biol. 245,237 -254.[CrossRef][Medline]
Saunders, C. M., Larman, M. G., Parrington, J., Cox, L. J.,
Royse, J., Blayney, L. M., Swann, K. and Lai, F. A. (2002).
PLC: a sperm-specific trigger of Ca2+ oscillations in eggs
and embryo development. Development
129,3533
-3544.
Shoji, S., Yoshida, N., Amanai, M., Ohgishi, M., Fukui, T., Fujimoto, S., Nakano, Y., Kajikawa, E. and Perry, A. C. F. (2006). Mammalian Emi2 mediates cytostatic arrest and transduces the signal for meiotic exit via Cdc20. EMBO J. 25,834 -845.[CrossRef][Medline]
Stevens, L. C. (1967). The biology of teratomas. Adv. Morphog. 6, 1-31.[Medline]
Stevens, L. C. (1970). The development of transplantable teratocarcinomas from intratesticular grafts of pre- and postimplantation mouse embryos. Dev. Biol. 21,364 -382.[CrossRef][Medline]
Stevens, L. C. (1978). Totipotent cells of parthenogenetic origin in a chimaeric mouse. Nature 276,266 -267.[CrossRef][Medline]
Stevens, L. C. and Varnum, D. S. (1974). The development of teratomas from parthenogenetically activated ovarian mouse eggs. Dev. Biol. 37,369 -380.[CrossRef][Medline]
Sun, Q. Y. and Schatten, H. (2006). Regulation
of dynamic events by microfilaments during oocyte maturation and
fertilization. Reproduction
131,193
-205.
Sutovsky, P., Manandhar, G., Wu, A. and Oko, R. (2003). Interactions of sperm perinuclear theca with the oocyte: implications for oocyte activation, anti-polyspermy defense, and assisted reproduction. Microsc. Res. Tech. 61,362 -378.[CrossRef][Medline]
Tai, M. H., Chang, C. C., Kiupel, M., Webster, J. D., Olson, L.
K. and Trosko, J. E. (2005). Oct4 expression in adult human
stem cells: evidence in support of the stem cell theory of carcinogenesis.
Carcinogenesis 26,495
-502.
Takada, T., lida, K., Awaji, T., Itoh, K., Takahashi, R., Shibui, A., Yoshida, K., Sugano, S. and Tsujimoto, G. (1997). Selective production of transgenic mice using green fluorescent protein as a marker. Nat. Biotechnol. 15,458 -461.[CrossRef][Medline]
Tarkowski, A. K., Witkowska, A. and Nowicka, J. (1970). Experimental parthenogenesis in the mouse. Nature 226,162 -165.[CrossRef][Medline]
Volinia, S., Calin, G. A., Liu, C. G., Ambs, S., Cimmino, A.,
Petrocca, F., Visone, R., Iorio, M., Roldo, C., Ferracin, M. et al.
(2006). A microRNA expression signature of human solid tumors
defines cancer gene targets. Proc. Natl. Acad. Sci.
USA 103,2257
-2261.
Wang, T., Pentyala, S., Elliott, J. T., Dowal, L., Gupta, E.,
Rebecchi, M. J. and Scarlata, S. (1999). Selective
interaction of the C2 domains of phospholipase C-ß1 and -ß2 with
activated Gq subunits: an alternative function for C2-signaling
modules. Proc. Natl. Acad. Sci. USA
96,7843
-7846.
Whittingham, D. G. and Siracusa, G. (1978). The involvement of calcium in the activation of mammalian oocytes. Exp. Cell Res. 113,311 -317.[CrossRef][Medline]
World Health Organization (2003). Tumours of the Breast and Female Genital Organs (ed F. A. Tavassoli and P. Devilee) Lyon: IARCPress-WHO.
Wu, A. T., Sutovsky, P., Manandhar, G., Xu, W., Katayama, M.,
Day, B. N., Park, K. W., Yi, Y. J., Xi, Y. W., Prather, R. S. et al.
(2007). PAWP, a sperm-specific WW domain-binding protein,
promotes meiotic resumption and pronuclear development during fertilization.
J. Biol. Chem. 282,12164
-12175.
Yoshida, N. and Perry, A. C. F. (2007). Piezo-actuated mouse intracytoplasmic sperm injection (ICSI). Nat. Protoc. 2,296 -304.[CrossRef][Medline]
|
|
