QUICK SEARCH:   [advanced] Author: Keyword(s):
Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents

First published online 24 October 2007
doi: 10.1242/dev.012385

This Article Summary Figures Only Full Text (PDF) Supplementary Material All Versions of this Article: dev.012385v1 134/23/4147    most recent Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bertrand, J. Y. Articles by Traver, D. Search for Related Content PubMed PubMed Citation Articles by Bertrand, J. Y. Articles by Traver, D.

Definitive hematopoiesis initiates through a committed erythromyeloid progenitor in the zebrafish embryo

Julien Y. Bertrand^*, Albert D. Kim^*, Emily P. Violette, David L. Stachura, Jennifer L. Cisson and David Traver

Section of Cell and Developmental Biology, Division of Biological Sciences, University of California, San Diego, La Jolla, CA 92093-0380, USA

Author for correspondence (e-mail: dtraver{at}ucsd.edu)

Accepted 5 September 2007

	SUMMARY

TOP SUMMARY INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Shifting sites of blood cell production during development is common across widely divergent phyla. In zebrafish, like other vertebrates, hematopoietic development has been roughly divided into two waves, termed primitive and definitive. Primitive hematopoiesis is characterized by the generation of embryonic erythrocytes in the intermediate cell mass and a distinct population of macrophages that arises from cephalic mesoderm. Based on previous gene expression studies, definitive hematopoiesis has been suggested to begin with the generation of presumptive hematopoietic stem cells (HSCs) along the dorsal aorta that express c-myb and runx1. Here we show, using a combination of gene expression analyses, prospective isolation approaches, transplantation, and in vivo lineage-tracing experiments, that definitive hematopoiesis initiates through committed erythromyeloid progenitors (EMPs) in the posterior blood island (PBI) that arise independently of HSCs. EMPs isolated by coexpression of fluorescent transgenes driven by the lmo2 and gata1 promoters exhibit an immature, blastic morphology and express only erythroid and myeloid genes. Transplanted EMPs home to the PBI, show limited proliferative potential, and do not seed subsequent hematopoietic sites such as the thymus or pronephros. In vivo fate-mapping studies similarly demonstrate that EMPs possess only transient proliferative potential, with differentiated progeny remaining largely within caudal hematopoietic tissue. Additional fate mapping of mesodermal derivatives in mid-somitogenesis embryos suggests that EMPs are born directly in the PBI. These studies provide phenotypic and functional analyses of the first hematopoietic progenitors in the zebrafish embryo and demonstrate that definitive hematopoiesis proceeds through two distinct waves during embryonic development.

Key words: Erythromyeloid progenitor, Hematopoiesis, Hematopoietic progenitor cells, Zebrafish

	INTRODUCTION

TOP SUMMARY INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The genesis of the blood-forming system is complex, with shifting sites of hematopoiesis occurring during development. The ontogeny of blood cells from multiple hematopoietic organs appears to be a feature common to all organisms with multiple hematopoietic lineages, including both invertebrates and vertebrates (Evans et al., 2003; Hartenstein, 2006). Whereas the specific organs that transiently host blood cell production can be divergent between species, hematopoiesis can be roughly divided into two major waves in vertebrates based on the cell types generated. Primitive hematopoiesis is characterized by a relatively rapid commitment of embryonic mesoderm to monopotent hematopoietic precursors (Keller et al., 1999). These cells give rise to embryonic erythrocytes and macrophages that are respectively required to oxygenate and remodel growing tissues of the embryo (Palis and Yoder, 2001). Definitive hematopoiesis is characterized by the emergence of multipotent hematopoietic stem and progenitor cells (Cumano and Godin, 2007).

The multiple waves of blood cell development have been best studied in the mouse, where hematopoiesis initiates with the formation of primitive erythrocytes and macrophages in the extraembryonic yolk sac (Palis et al., 1999). It is widely believed that definitive hematopoiesis subsequently begins in the midgestation embryo with the formation of HSCs in a region bounded by the aorta, gonads and mesonephros (AGM) (Dzierzak, 2005; Cumano and Godin, 2007). However, recent studies have demonstrated the presence of definitive progenitors within the yolk sac (Yoder et al., 1997a; Yoder et al., 1997b; Palis et al., 1999; Bertrand et al., 2005a; Yokota et al., 2006; Yokomizo et al., 2007) and placenta (Gekas et al., 2005; Ottersbach and Dzierzak, 2005; Zeigler et al., 2006) that arise either before, or concomitant with, HSC formation in the AGM region. Several reports have shown that a common marker of definitive hematopoietic stem and progenitor cells in each of these tissues is the integrin, CD41 (Mitjavila-Garcia et al., 2002; Ferkowicz et al., 2003; Mikkola et al., 2003; Ottersbach and Dzierzak, 2005). Before embryonic day (E) 9.5, CD41⁺ yolk sac cells generate multiple myeloid and erythroid lineages, but lack lymphoid potential in co-culture assays (Yokota et al., 2006). Similar results were obtained at E10.5 using yolk sac cells purified by combined CD41⁺ c-Kit⁺ CD45^- expression (Bertrand et al., 2005b). In addition, studies utilizing a transgenic mouse expressing GFP under control of the Gata1 promoter showed that Gata1⁺ cells purified from E7.5 yolk sacs could generate granulocytes, monocytes, macrophages and erythrocytes upon OP9 stromal cells (Yokomizo et al., 2007). Together, these studies suggest that the definitive hematopoietic program may first generate committed erythromyeloid progenitors in the yolk sac before HSCs arise. The lineage relationships and relative contributions of definitive precursors in the yolk sac to later hematopoietic sites, such as the fetal liver, fetal spleen and bone marrow remain to be clarified.

In the zebrafish, primitive hematopoiesis also produces macrophages and erythrocytes. The first functional hematopoietic cells born in the embryo are primitive macrophages. These cells arise from anterior, cephalic mesoderm then migrate onto the yolk syncitial layer before colonizing embryonic tissues (Herbomel et al., 1999). Primitive erythrocytes develop from bilateral stripes of ventral mesoderm, which, upon migration to the midline, form a structure termed the intermediate cell mass (ICM) (Detrich et al., 1995; Thompson et al., 1998). Endothelial cells encapsulate this mass of maturing erythroid precursors to form the cardinal vein and, upon initiation of heart contractions at approximately 24 hours post-fertilization (hpf), primitive erythroblasts enter circulation. Based on the appearance of cells expressing HSC-associated genes such as c-myb and runx1 along the ventral wall of the dorsal aorta, definitive hematopoiesis has been presumed to initiate in this zebrafish equivalent of the AGM region between 28 and 48 hpf (Thompson et al., 1998; Burns et al., 2002; Kalev-Zylinska et al., 2002). Lineage-tracing studies have recently shown that cells residing between the aorta and vein could subsequently colonize the thymus and pronephros, the major definitive hematopoietic organs in zebrafish (Murayama et al., 2006; Jin et al., 2007).

The vertebrate AGM is not a hematopoietic organ per se, because differentiation is not observed in this region (Godin et al., 1999). Rather, the differentiation of embryonic HSCs into multiple definitive lineages occurs only after the seeding of other tissues, such as the fetal liver in mammals. Until recently, it was thought that HSCs born in the zebrafish AGM colonized the pronephros to initiate definitive hematopoiesis (Hsia and Zon, 2005). Recent fate-mapping studies of Murayama et al. showed that presumptive HSCs targeted along the aorta first migrate to a region in the tail they termed caudal hematopoietic tissue (CHT) (Murayama et al., 2006). At earlier stages, before 36 hpf, this region has also been referred to as the posterior ICM (Detrich, 3rd et al., 1995; Thompson et al., 1998), ventral vein region (Liao et al., 1998; Willett et al., 1999) and more conventionally as the posterior blood island (PBI) (Crowhurst et al., 2002; Rombout et al., 2005; Kinna et al., 2006; Renshaw et al., 2006; Jin et al., 2007) based on localization of hematopoietic markers to the ventral portion of the tail immediately caudal to the yolk tube extension. Electron microscopy studies showed that definitive myeloid cells, such as neutrophilic granulocytes, are first detected in this region at 34 hpf (Willett et al., 1999). It is not clear whether these cells migrate here from other hematopoietic sites, or whether they arise in situ from resident stem or progenitor cells. Murayama and colleagues (Murayama et al., 2006) hypothesized that the CHT is generated by migration of HSCs from the AGM to act as a fetal liver equivalent in bridging definitive blood cell production until the pronephros becomes the final hematopoietic site.

In the present study, we describe a previously uncharacterized hematopoietic precursor that arises in the PBI to initiate definitive hematopoiesis. This precursor can be prospectively isolated by flow cytometry as early as 24 hpf based on the expression of fluorescent transgenes. Molecular characterization showed promiscuous expression of erythroid and myeloid genes. Accordingly, functional studies showed that these cells have erythroid and myeloid differentiation potential but lack lymphoid potential. We have therefore termed these cells erythromyeloid progenitors (EMPs). EMPs arise before HSCs were detected in the AGM, and fate-mapping studies suggest that they arise directly from lmo2⁺ posterior lateral plate mesoderm (LPM) derivatives. Taken together, these results demonstrate that the EMP serves as a transient progenitor that is born independently of HSCs to initiate definitive hematopoiesis in the developing zebrafish embryo.

	MATERIALS AND METHODS

TOP SUMMARY INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Zebrafish stocks and embryos
Zebrafish were mated, staged and raised as described (Westerfield, 1994) and maintained in accordance with UCSD IACUC guidelines. Transgenic lines Tg(gata1:DsRed) (Traver et al., 2003), Tg(CD41:eGFP) (Lin et al., 2005), Tg(lmo2:DsRed) (Zhu et al., 2005) and Tg(lmo2:eGFP) (Zhu et al., 2005) were used. Tg(mpx:eGFP) animals were generously provided by S. A. Renshaw (Renshaw et al., 2006). Hereafter, transgenic lines will be referred to without the Tg(xxx:xxx) nomenclature for clarity. Embryos were processed as described (Westerfield, 1994).

Whole-mount RNA in situ hybridization
Embryos were treated with PTU, then fixed in 4% or 10% paraformaldehyde (PFA). Whole-mount in situ hybridization was carried out as described (Thisse et al., 1993). The zebrafish CD45 homologue was identified on chromosome 22 (Ensembl #ENSDARG00000030937), and a 1.2 kb probe generated from genomic DNA by PCR using the following primers: CD45-FP: AATGAAAAGGCTGTAATCGG; CD45-RP: GTCCTTGTTTTCTTCGCTGC.

Fluorescence in situ hybridization (FISH)
Antisense mRNA probes were prepared as previously reported for gata1, pu.1 (also known as spi1 - ZFIN) and mpx (Rhodes et al., 2005) using digoxigenin (DIG)- or fluorescein (FITC)-labeled UTPs according to the manufacturer's instructions (Roche, Palo Alto, CA). Two-color FISH was carried out as previously described (Kosman et al., 2004) with minor modifications. The 90% xylene/10% ethanol wash was omitted and proteinase K treatments were adjusted to 25 minutes for optimal permeabilization. Hybridization with 500 ng DIG-labeled and FITC-labeled probes was performed at 70°C. mpx-FITC probes were detected with a mouse anti-FITC antibody (Roche) followed by a donkey anti-mouse Alexa Fluor 555 antibody (Molecular Probes). Reactions were developed using anti-DIG-horseradish peroxidase (HRP) antibody. gata1-FITC was detected with a mouse anti-FITC antibody (Roche) followed by a goat anti-mouse-HRP antibody (Molecular Probes, Carlsbad, CA). Alexa Fluor 488 or 594 tyramide substrates were used according to the manufacturer's instructions (Molecular Probes) to further amplify gata1-DIG and pu.1-DIG or gata1-FITC signals, respectively. Fluorescence images were acquired on an Olympus Fluoview 1000 confocal microscope at 200x and 400x magnification (Center Valley, PA).

Cell suspension preparation
PTU-treated whole or dissected embryos were dissociated between 24 and 72 hpf. Embryos were treated with 10 mM DTT in E3 medium then transferred to Hank's balanced salt solution (with calcium) and digested with Liberase Blendzyme II (Sigma Aldrich, St Louis, MO) for at least 1 hour at 33°C. Cell suspensions were then filtered through 40 µm nylon mesh, washed twice and pelleted by centrifugation at 250 g for 5 minutes.

Flow cytometry
Embryonic cell suspensions were prepared as described above and fluorescence-activated cell sorting (FACS) was performed as previously described (Traver et al., 2003) using a FACS Aria flow cytometer (Becton Dickinson, San Jose, CA). Data analyses were performed using FlowJo software (TreeStar, Ashland, OR).

Cytology
Blood cells were collected by tail dissection of embryos, then homogenized using the embryonic cell collection protocol described above. Hematopoietic cells were concentrated by cytocentrifugation at 250 g for 5 minutes onto glass slides using a Shandon Cytospin 4 (Thermo Fischer Scientific, Waltham, MA). Slides were then processed through May-Grünwald and Giemsa stains according to the manufacturer's instructions (Fluka, Buchs, Switzerland).

Microscopy
Embryos were imaged using a Leica DMI6000 inverted fluorescent microscope (Wetzlar, Germany), a Hamamatsu C7780 digital camera (Hamamatsu, Japan) and Volocity Acquisition and Restoration software (Improvision, Lexington, MA).

RT-PCR analyses
For RT-PCR analysis, RNA was isolated from cells sorted from lmo2:eGFP and gata1:DsRed dual-positive embryos using Trizol (Invitrogen, Philadelphia, PA). Total RNA (2-5 µg) was reverse transcribed into cDNA using a Superscript III RT-PCR kit (Invitrogen, Philadelphia, PA). The following primers were used: c-mpl-FP: ATGGATCCAGTTTTCATCTGGTGG, c-mpl-RP: TATAGGTAGACGTCACTTGGTGGG; l-plastin-FP: GTCGATGTGGATGGGAACGG, l-plastin-RP: CCTCCTCGGAGTATGAGTGC; CD41-FP: TTACTACGACCTATATCTGGG, CD41-RP: GATGACCTGGACATACTGGG; c-myb-FP: AGTTACTTCCGGGAAGAACCG, c-myb-RP: AGAGCAAGTGGAAATGGCACC; runx1-FP: TTGGGACGCCAAATACGAACC, runx1-RP: ATATCACCAAGGGCAACCACC; ef1a-FP: CGGTGACAACATGCTGGAGG, ef1a-RP: ACCAGTCTCCACACGACCCA.Primersformpx, pu.1 and gata1 transcripts were used as described (Hsu et al., 2004).

View larger version (42K): [in this window] [in a new window]   Fig. 1. Genes associated with multilineage hematopoiesis are expressed in the posterior blood island as early as 30 hpf. (A,B) By 30 hpf, expression of the pan-leukocyte markers CD45 and l-plastin are observed throughout the PBI. (G,H) By 36 hpf, the number of cells expressing each gene has increased in the PBI, and expressing cells begin to migrate throughout the embryo. Localized expression of lmo2 is observed in the PBI at 30 hpf (C) and 36 hpf (I). (D,J) Expression of gata1 is also observed in cells within the vascular plexus of the PBI at both timepoints. (E,F,K,L) Expression of genes associated with myelopoiesis is also observed within the PBI, including pu.1 and mpx. Rare pu.1+ cells are observed at 30 hpf in the PBI (E) that increase in number by 36 hpf (K), whereas mpx expression is not observed until 36 hpf (F,L), consistent with it being a marker of relatively mature myelomonocytic cell types. Magnification: 100x in whole-embryo images; 300x in PBI images.

Fate mapping
One- to eight-cell-stage CD41:eGFP or lmo2:eGFP transgenic embryos were injected with 0.5 nl of a 0:1 or 1:1 mix of caged fluorescein-dextran 10,000 MW and caged rhodamine-dextran 10,000 MW (Molecular Probes, Carlsbad, CA). Uncaging was performed using a 365 nm Micropoint laser system (Photonic Instruments, St Charles, IL) routed through the epifluorescence port and 20x objective of a Leica DMI6000 inverted microscope. Ten GFP⁺ target cells were uncaged per embryo following laser pulses of 10-20 seconds each. Uncaged embryos injected with rhodamine-dextran were subsequently observed using fluorescence microscopy whereas uncaged FITC was detected by immunohistochemistry, as previously described (Murayama et al., 2006).

Generation of zebrafish kidney stromal (ZKS) cell lines
Kidneys were isolated from wild-type AB^* fish by dissection and bleached for 5 minutes in 0.000525% Sodium Hypochlorite (Fisher Scientific, Pittsburgh, PA). Tissue was then rinsed in sterile Dulbecco's phosphate-buffered saline (PBS; Mediatech, Herndon, VA) and mechanically dissociated by trituration. Dissociated cells were passed through a 0.45 µM filter (BD Biosciences, San Jose, CA) and discarded. The remaining stromal cells were cultured in 12.5 cm² flasks at 32°C, 5% CO₂. Cells were maintained until reaching 50-80% confluency, then trypsinized (0.25%; Invitrogen, Grand Island, NY) for 10 minutes at 32°C, and split at 1:3 for expansion.

ZKS cells defined in this report were maintained in a mixture of 50% L-15, 35% DMEM, 15% Ham's F-12 media (Mediatech) supplemented with 10% FBS (American Type Culture Collection, Manassas, VA), 2% penicillin/streptomycin (10 U/ml stock), 0.1 mg/ml gentamicin sulfate, 1% L-glutamine, 150 mg/l sodium bicarbonate and 1.5% HEPES (All supplements from Mediatech).

In vitro differentiation assay
EMPs were purified by flow cytometry and plated onto confluent ZKS cells at a density of 1x10⁴ cells/well in 12-well plates using 2 ml medium per well. For morphological analyses, wells were gently aspirated and 200 µl removed for cytocentrifugation onto glass slides. Cells were stained with May-Grünwald/Giemsa stains as described above, or for myeloperoxidase activity according to the manufacturer's instructions (Sigma Aldrich). Light microscopy images were obtained using an Olympus BX51 light microscope, Olympus DP70 camera, and Olympus DP Controller software (Center Valley, PA).

	RESULTS

TOP SUMMARY INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The posterior blood island is a site of hematopoiesis
We wished to determine when and where the first definitive hematopoietic precursors arise in the zebrafish embryo. Early gene expression studies suggested that the most posterior portion of the ICM contained hematopoietic precursors distinct from the primitive erythroblasts that arise in the ICM (Thompson et al., 1998). To determine what types of blood cells are found in the PBI, we performed whole-mount in situ hybridization (WISH) with a panel of hematopoietic genes at 30 and 36 hpf. We first identified the zebrafish homologue of CD45, which in mammals is expressed in all hematopoietic cell lineages except for erythrocytes. Expression of the zebrafish CD45 gene was observed as early as 30 hpf, and positive cells increased in number by 36 hpf in the ventral part of the tail (Fig. 1A,G). Although some studies have treated l-plastin (also known as lcp1 - ZFIN) as a macrophage-specific marker in the zebrafish, it is expressed in all murine leukocytes, including hematopoietic progenitors (Arpin et al., 1994; Bertrand et al., 2005b) and in zebrafish granulocytes (Meijer et al., 2007). Expression of l-plastin was observed in a pattern similar to that of CD45 (Fig. 1B,H), suggesting that both genes similarly mark zebrafish leukocytes.

To assess further the possible presence of hematopoietic progenitors, we analyzed expression of lmo2, gata1 and pu.1. lmo2 is expressed by both vascular and hematopoietic precursors. In addition to widespread vascular staining in the tail, a small population of lmo2⁺ cells was observed in the PBI (Fig. 1C,I). Similarly, expression of a canonical marker of erythroid potential, gata1, was observed in small numbers of cells in the PBI at both time points (Fig. 1D,J). These cells did not appear to be within vessels, but rather within the vascular plexus of the PBI. pu.1 is a transcription factor that acts as a master regulator of myeloid commitment (Tenen et al., 1997). We first observed a small population of pu.1⁺ cells in the PBI at 30 hpf that increased in number by 36 hpf (Fig. 1E,K). Myeloperoxidase (mpx) is expressed specifically in cells of the myelomonocytic lineages, and is transcriptionally controlled by Pu.1 (Tenen et al., 1997). Accordingly, pu.1 expression precedes transcription of mpx in the PBI by at least 6 hours, because pu.1 and mpx expression are first detected at 30 and 36 hpf, respectively (Fig. 1E,F,K,L). Expression of all genes appeared to localize to the region between the aorta and the caudal vein, just posterior to the yolk tube extension. Taken together, these data indicate that both erythroid and myeloid cells are present in the PBI at 30 hpf and are consistent with the hypothesis that the PBI is an early site of multilineage hematopoiesis.

We next took a cytological approach to determine whether definitive hematopoietic cell types could be recognized morphologically from PBI preparations. Tails were dissected from embryos at time points ranging from 24 to 72 hpf and single-cell suspensions prepared following enzymatic digestion. At 24 hpf, the only hematopoietic lineages observed were erythroblasts and rare monocytes or macrophages (see Fig. S1 in the supplementary material), each probably originating from primitive hematopoiesis. At 30 hpf another cell subset appeared that showed characteristics of early hematopoietic precursors, including blastic morphology, open chromatin structure and basophilic cytoplasm. Eosinophilic and neutrophilic granulocytes were first observed by 36 and 48 hpf, respectively. Cells of the thrombocytic series were first observed at 48 hpf, with mature thrombocytes appearing only after 72 hpf. Finally, cells displaying a lymphoblastic morphology (relatively small, round cells with scant cytoplasm) appeared at 48 hpf. Since circulating lymphocytes are not present at this time, these cells may be HSCs that have immigrated from the AGM region, consistent with the migration hypothesis of Murayama and colleagues (Murayama et al., 2006).

We performed similar analyses of hematopoietic cells present in dissected embryonic trunk and head segments. Before 48 hpf, we did not observe definitive cell types in regions other than the tail (not shown). Collectively, these hematological results demonstrate that multiple lineages of hematopoietic cells are present in the PBI, corroborating our WISH data.

Coexpression of lmo2 and gata1 defines a novel hematopoietic population in the PBI
One possible explanation for the presence of definitive myeloid and erythroid cells uniquely in the PBI at 30 hpf is that they arise from local progenitor cells. In murine bone marrow, only hematopoietic stem or progenitor cells express a combination of both Lmo2 and Gata1 (Miyamoto et al., 2002). Since both lmo2 and gata1 are expressed in the PBI, we analyzed their coexpression in animals carrying lmo2:eGFP and gata1:DsRed transgenes. As shown in Fig. 2A, cells expressing high levels of both transgenes were observed in the PBI from 30-48 hpf. Flow cytometric analysis of double transgenic embryos showed a distinct population of lmo2⁺gata1⁺ cells (Fig. 2B). This population peaks in number per embryo between 30-36 hpf, the time at which the first myeloid precursors were observed by morphology (see Fig. S1 in the supplementary material). After 72 hpf, lmo2⁺gata1⁺ cells could no longer be detected (not shown).

Before 30 hpf, a population of lmo2^lowgata1⁺ cells was observed by flow cytometry that expressed approximately 15 times lower levels of GFP than lmo2⁺gata1⁺ cells (Fig. 2B). Cell sorting showed that the lmo2^lowgata1⁺ fraction consisted entirely of primitive erythroblasts (Fig. 2C, left panel). Unlike purified primitive erythoblasts, purified lmo2⁺gata1⁺ cells showed morphologies characteristic of earlier hematopoietic progenitors (Fig. 2C, middle and right panels). At 30 hpf, two morphological subtypes were present in purified lmo2⁺gata1⁺ cells. Approximately half of this population displayed a morphology characteristic of immature myelomonocytic progenitors, including asymmetric oval or bean-shaped nuclei with lightly stained cytoplasm containing darker granules (Fig. 2C, middle panel). The remaining half displayed a morphology characteristic of immature erythroid progenitors, including centered, round nuclei with stippled staining patterns and basophilic cytoplasm (Fig. 2C, right panel).

lmo2⁺gata1⁺ cells express both erythroid and myeloid genes
Hematopoietic progenitor cells frequently express lineage markers for multiple mature cell types, reflecting their multilineage differentiation potential (Hu et al., 1997; Miyamoto et al., 2002). We therefore profiled the gene expression pattern of purified lmo2⁺gata1⁺ cells. At 30 hpf, we isolated four populations of cells defined by differential expression of lmo2:eGFP and gata1:dsRed transgenes in double transgenic embryos, including lmo2^lowgata1⁺, lmo2⁺gata1⁺, lmo2⁺gata1^- and lmo2^-gata1^- fractions. In addition to expressing high levels of the erythroid-associated gata1 reporter gene, RT-PCR analyses showed that purified lmo2⁺gata1⁺ cells expressed the pan-leukocyte marker, l-plastin, and the myelomonocytic genes, mpx and pu.1 (`LG', Fig. 3A). By contrast, expression of these genes in purified primitive erythoblasts (lmo2<sup>low</sup>gata1<sup>+</sup> cells) was undetectable (`G', Fig. 3A). This expression pattern suggests that, despite expression of the gata1:dsRed transgene, the lmo2⁺gata1⁺ population is not committed to the erythroid lineage. Accordingly, these cells also express scl and runx1, genes associated with early hematopoietic progenitors. Expression of the mpx and runx1 genes was found in the lmo2⁺gata1^- fraction (`L', Fig. 3A). runx1 is known to be expressed in endothelial cells (Kalev-Zylinska et al., 2002), the most abundant cell type marked by the lmo2:eGFP transgene. The presence of mpx transcripts may be due to low-level expression of the lmo2:eGFP transgene in primitive macrophages (not shown).

We also analyzed CD41 (also known as itga2b - ZFIN) in each isolated subset, since its expression appears to be one of the first markers of mesoderm commitment to definitive hematopoiesis in mammals (Mitjavila-Garcia et al., 2002; Ferkowicz et al., 2003; Mikkola et al., 2003). In 30 hpf embryos, CD41 expression was only detected within lmo2⁺gata1⁺ cells. This result supports the hypothesis that lmo2⁺gata1⁺ cells represent an early definitive hematopoietic progenitor population.

View larger version (75K): [in this window] [in a new window]   Fig. 2. Coexpression of lmo2 and gata1 reveals immature hematopoietic precursors in the PBI. (A) Fluorescence microscopy reveals cells within the vascular plexus of the PBI that expressed both gata1:DsRed and lmo2:eGFP fluorophores (arrowheads) in double transgenic animals. Blue boxes in embryonic images in upper panels denote the regions shown at 200x magnification in middle and 400x magnification in lower panels at 30, 36 and 48 hpf. Lower panels show a single, deconvolved z slice, demonstrating coexpression of each transgene in single cells (arrowheads). (B) Cells coexpressing the gata1:DsRed and lmo2:eGFP transgenes prospectively isolated by flow cytometry. Double-positive cells peak in number at 30 hpf, with approximately 160 cells per embryo (left panel). (C) Compared with purified primitive erythroblasts sorted by low levels of lmo2:eGFP and high levels of gata1:DsRed (red gate in 30 hpf plot in B), cytological staining of purified 30 hpf lmo2+ gata1+ cells (black gate) showed immature morphologies indicative of early hematopoietic progenitors. Magnification, x1000.

PBI hematopoietic progenitors lack key characteristics of HSCs
Because lmo2⁺gata1⁺ cells displayed many of the features of hematopoietic progenitor cells, we wanted to test their homing, proliferative, and differentiation potentials in functional assays. lmo2⁺gata1⁺ cells were purified by flow cytometry from 36 hpf embryos and transplanted into WT embryonic recipients, either stage-matched or at 48 hpf. Transplanted cells homed to the PBI within 24 hours post-transplantation (Fig. 4A). In contrast to transplanted adult whole kidney marrow (WKM) cells which populate the embryonic thymus and pronephros (Traver et al., 2003), embryonic lmo2⁺gata1⁺ cells were never observed to seed these hematopoietic organs. Rather, donor-derived cells remained largely within the PBI and, based upon the disappearance of double-fluorescent yellow cells after 1-2 days, appeared to differentiate rapidly (Fig. 4A). Donor-derived cells were observable for approximately one week following transplantation by fluorescent transgene expression.

Several reports have demonstrated that rare, definitive hematopoietic precursors arise in the mammalian yolk sac before circulation (Palis et al., 1999; Ferkowicz et al., 2003; Bertrand et al., 2005a; Yokota et al., 2006; Yokomizo et al., 2007). These precursors express CD41 (Ferkowicz et al., 2003; Mikkola et al., 2003; Yokota et al., 2006), which appears to be the first marker of definitive hematopoietic commitment from mesoderm. Since CD41 was detected only within lmo2⁺gata1⁺ cells in 30-36 hpf embryos, we analyzed expression of CD41:eGFP in the PBI of transgenic embryos (Lin et al., 2005). GFP expression was detected as early as 26 hpf, and increased in intensity and in the number of cells labeled over time (not shown). The location, appearance and proliferative kinetics of CD41⁺ cells closely matched those of lmo2⁺gata1⁺ cells, suggesting that CD41 expression represents another, independent method of detecting definitive hematopoietic precursors in the PBI.

View larger version (73K): [in this window] [in a new window]   Fig. 3. Gene expression profiling of hematopoietic precursors in the PBI suggest multipotency. (A) Cells were purified from 30 hpf embryos by flow cytometry based on expression of gata1:DsRed and lmo2:eGFP transgenes (DN, double negative; L, lmo2:eGFP+, gata1:DsRed-; LG, lmo2:eGFP+, gata1:DsRed+; G, lmo2:eGFPlow, gata1:DsRed+; WKM, whole kidney marrow) and subjected to RT-PCR. (B) FACS analysis shows a population that coexpresses the gata1:DsRed and mpx:eGFP transgenes at 30 hpf (black gate). (C) Two-color FISH demonstrates that cells within the PBI at 30 hpf coexpress gata1 and pu.1 (highlighted circles, upper panels) and gata1 and mpx (highlighted circles, lower panels). Blue frame on embryo denotes regions shown in C at 400x magnification.

Our transplantation and fate-mapping experiments demonstrated that hematopoietic progenitors in the PBI lack lymphoid potential - a hallmark of HSCs. However, PBI progenitors did display transient but relatively robust proliferation potential. To assess the differentiation potential of these cells, we developed in vitro culture assays using a new zebrafish kidney stromal (ZKS) cell line. lmo2⁺gata1⁺ cells were purified from 30 hpf embryos and deposited onto ZKS layers. Aliquots were removed daily and analyzed for cellular morphology. Compared to the immature morphology of uncultured cells (Fig. 2C), lmo2⁺gata1⁺ cells rapidly differentiated into erythroid and myelomonocytic cell fates upon 2 days of culture (Fig. 4C). An approximately equivalent ratio of erythroid to myelomonocytic cells was observed on day 2 (see Fig. S2 in the supplementary material). By day 4 of culture myelomonocytic cells predominated, with most erythroid cells presumably having differentiated and died (see Fig. S2 in the supplementary material). Based on morphological analyses, cultured lmo2⁺gata1⁺ cells generated multiple myeloid lineages, including neutrophilic granulocytes, monocytes and macrophages (Fig. 4C), whereas parallel experiments using purified lmo2^lowgata1⁺ primitive erythroblasts showed only erythroid progeny (not shown). Cells were also removed after 4 days of culture and stained for myeloperoxidase (MPX) activity. Many cells demonstrated robust staining, and nuclear morphology showed that positive cells included both immature myelomonocytic cells and mature granulocytes (Fig. 4C, bottom panel).

View larger version (67K): [in this window] [in a new window]   Fig. 4. Functional studies demonstrate that gata1+ lmo2+ CD41+ cells are committed erythromyeloid progenitors. (A) Dissociated gata1:DsRed+ lmo2:eGFP+ cells were purified from 36 hpf embryos by flow cytometry and transplanted into wild-type embryonic recipients. Transplanted cells were observed to home back to the PBI in host animals (right panel, 200x magnification). Arrowheads denote gata1:DsRed+ lmo2:eGFP+ cells. (B) In vivo fate-mapping studies were performed by laser activation of caged rhodamine in CD41+cells in the 44 hpf AGM or 40 hpf PBI. Presumptive AGM HSCs were targeted as positive controls for thymus colonization (lower panels; outlined crescent-shaped structure). Boxed yellow and blue regions in upper panel denote close-up areas shown below in left panels for the AGM and right panels for the PBI, respectively. All animals are shown in lateral view, with head oriented to the left and dorsal side up. Dotted line at the left edge of lower boxes denotes outline of the eye for orientation. White arrowheads indicate uncaged, GFP+ cells. (C) Short-term culture of lmo2+ gata1+ cells atop kidney stromal cells demonstrates erythroid (E), granulocytic (G) and monocytic/macrophage (M) differentiation potentials. Cultured cells were stained for myeloperoxidase (MPX) activity after 4 days (bottom panel).

EMPs arise independently of HSCs from caudal, lmo2⁺ mesoderm
Collectively, our data suggest that lmo2⁺gata1⁺, or CD41⁺ cells in the PBI before 40 hpf are committed erythromyeloid progenitors that lack self-renewal and multilineage differentiation abilities. Our fate-mapping experiments also suggest that CD41⁺ cells in the nascent AGM region represent the first HSCs born in the embryo. Although EMPs appear to arise before presumptive HSCs are observed in the AGM, it is possible that EMPs derive from HSCs. To determine whether EMPs are born directly in the PBI or migrate from the AGM, we performed uncaging experiments in mid-somitogenesis embryos. Approximately 10 lmo2⁺ cells were targeted in either the medial (bounded by somites 1-10 - the region that will later contain the AGM) or most posterior portion (the region that will later become the PBI) of the stripe of mesodermal-derived tissue marked by an lmo2:eGFP transgene in 13- to 15-somite-stage embryos (Fig. 5A,B). Since the number of EMPs peaks at 30 hpf (Fig. 2B), we analyzed uncaged animals at this time point. All eight animals with medial lmo2⁺ cells targeted showed marked progeny confined to the anterior trunk region (Table 1), mainly within presumptive vasculature (not shown). None of the eight animals showed marked progeny within the PBI (Fig. 5C). Five out of eight animals with posterior lmo2⁺ cells targeted showed marked progeny within the PBI (Table 1). These cells were large and round and localized to the vascular plexus of the PBI (Fig. 5C), consistent with our localization of lmo2⁺gata1⁺ EMPs at 30 hpf (Fig. 2A). None of these eight animals showed labeled progeny in the trunk (Table 1). Together, these data suggest that lmo2⁺gata1⁺ EMPs arise from the most posterior regions of the lmo2⁺ (gata1^-) hematopoietic or vasculogenic `stripes' that converge to form the posterior ICM or PBI. These results are consistent with previous studies demonstrating localized expression of `definitive' hematopoietic genes in this region such as scl (Liao et al., 2002) and gata2 (Detrich et al., 1995).

View larger version (92K): [in this window] [in a new window]   Fig. 5. Erythromyeloid progenitors arise autonomously within the PBI. (A-D) Cells expressing GFP under control of the lmo2 promoter were lineage traced by uncaging a combination of caged rhodamine and FITC. GFP+ cells were targeted, either in the medial (bounded by somites 1-10; panel A) or most posterior (panel B) regions of the lmo2 expression domain between 13- and 15-somite stages. (C,D) Analysis of targeted progeny at 30 hpf showed no medially derived cells in the PBI (C), whereas posterior-derived daughter cells were observed throughout the venous plexus of the PBI (D). Inset in (D) shows a close-up of the PBI in a second animal, with marked progeny found within the vascular plexus between the aorta (dashed red line) and caudal vein (dashed blue line). Primitive erythrocytes within each vessel are indicated with asterisks and the daughters of posterior lmo2+ cells are indicated by white arrowheads. Blue framed areas in inset images of whole animals indicate the regions shown in close-up in A and B.

	DISCUSSION

TOP SUMMARY INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

The presence of the EMP in the PBI by 24 hpf may help clarify the ontogeny of the definitive myeloid lineages in teleosts. Histological and ultrastructural analyses have described granulocytic precursors in the PBI, both in the zebrafish (Willett et al., 1999; Zapata et al., 2006) and carp (Rombout et al., 2005; Huttenhuis et al., 2006). We observed eosinophilic and neutrophilic granulocytes in zebrafish tail preparations by 36-48 hpf. The first granulocytes produced in the zebrafish embryo may therefore be the daughters of EMPs, and not lineally related to the primitive macrophages that arise from cephalic mesoderm. This model is consistent with the observations of Herbomel and colleagues (Herbomel et al., 1999), and with the single lineage origin of embryonic macrophages produced in other organisms ranging from Drosophila to mammals (Lichanska and Hume, 2000; Evans et al., 2003). Based on the robust generation of mononuclear phagocytes by cultured EMPs, it appears that a second wave of macrophage production later occurs in the PBI through monocytic intermediates. The full differentiation potential of the EMP remains to be determined because our in vitro conditions do not appear to support all myeloerythroid lineages, including eosinophils and thrombocytes. Isolation of autologous growth factors such as Interleukin-3 and Thrombopoietin will probably be necessary to reveal the complete fate potentials of zebrafish hematopoietic stem and progenitor cells.

The first blood cells born in the mammalian embryo are erythroid cells in the extraembryonic yolk sac. Based on their resemblance to the nucleated erythrocytes of avian and amphibian species, these cells were initially termed primitive, and their enucleated embryonic counterparts definitive (McGrath and Palis, 2005). More recently, these terms have become interchangeable with yolk sac and intraembryonic hematopoiesis, respectively. The correlation of each wave with anatomical sites has led to some confusion because several reports have recently demonstrated the existence of multipotent, definitive hematopoietic precursors in the extraembryonic yolk sac that generate definitive cell types (Wong et al., 1986; Cumano, 1996; Palis et al., 1999; Bertrand et al., 2005a; Yokota et al., 2006; Yokomizo et al., 2007). Likewise, the nomenclature used for the hematopoietic waves in the zebrafish has often been inconsistent and confusing, with many publications referring to `primitive HSCs', `primitive granulocytes', and so forth. We propose that the same conventions applied to the murine hematopoietic waves (Keller et al., 1999; McGrath and Palis, 2005) be used to describe primitive versus definitive hematopoiesis in the zebrafish, namely that only ICM-derived erythrocytes and cephalic mesoderm-derived macrophages should be termed primitive. This nomenclature is consistent with observations in each species suggesting that the two primitive lineages appear to arise directly from mesoderm without transiting through a multipotent progenitor (Detrich et al., 1995; Herbomel et al., 1999; Keller et al., 1999; Bertrand et al., 2005a). Conversely, we propose that hematopoietic cells that derive from an oligopotent or multipotent progenitor be termed definitive.

In our current model, hematopoietic development in the zebrafish occurs in four independent waves, each through precursors that arise in different anatomical regions (Fig. 6). Two primitive waves produce macrophages from cephalic mesoderm and erythrocytes from the ICM. Likewise, two definitive waves occur, the first from EMP production in the PBI and the second from HSC generation in the AGM. It was previously proposed by Murayama and colleagues that all hematopoietic cells in the CHT derive from HSCs born in the AGM (Murayama et al., 2006). Our results do not support this hypothesis. Several lines of evidence show that hematopoietic precursors are present in the PBI before presumptive HSCs can be detected in the AGM region beginning at approximately 28 hpf. These include gene expression profiles suggestive of multilineage hematopoiesis in the PBI by 30 hpf, the appearance of definitive myelomonocytic cells within the PBI by 36 hpf, single-cell coexpression of early hematopoietic genes, such as lmo2-gata1 or gata1-pu.1 by 30 hpf, and CD41:eGFP⁺ cells appearing in the PBI before the AGM. Furthermore, our fate-mapping experiments suggest that EMPs arise directly from the lmo2:eGFP⁺ descendents of posterior LPM that contribute to the formation of the PBI. The experiments of Murayama et al. were performed after 48 hpf. Our lineage-tracing experiments showed that CD41:eGFP⁺ cells in the PBI/CHT before 40 hpf lack thymus colonizing potential. After 40 hpf, we observed rare thymic immigrants from targeted CD41:eGFP⁺ cells in the CHT that increased in number over time. These results suggest that the first CD41:eGFP⁺ cells in the PBI are EMPs and that CD41:eGFP⁺ HSCs immigrate into the nascent CHT from the AGM after 40 hpf. It appears that the EMP disappears gradually after this time, with definitive hematopoiesis in the CHT increasingly deriving from incoming HSCs. As previously suggested in the mouse, the generation of committed EMPs in the embryo before HSCs arise has probably evolved to provide a rapid burst of definitive cell types to meet the needs of the growing embryo (Keller et al., 1999; McGrath and Palis, 2005).

View larger version (28K): [in this window] [in a new window]   Fig. 6. Model of hematopoietic ontogeny in the zebrafish embryo. (A) Different regions of lateral plate mesoderm (LPM) give rise to anatomically distinct regions of blood cell precursors. Drawing depicts a dorsal view of a five-somite-stage embryo. (B) Embryonic hematopoiesis appears to occur through four independent waves of precursor production. Each wave is numbered based on the temporal appearance of functional cells from each subset. First, primitive macrophages arise from cephalic mesoderm and migrate onto the yolk ball before spreading throughout the embryo. Second, primitive erythrocytes begin to differentiate within the intermediate cell mass (ICM) before entering circulation at approximately 24 hpf. Third, the first definitive progenitors arise as EMPs are formed within the posterior blood island (PBI). EMPs generate the first definitive myeloid cells and a new wave of erythroid cells. Finally, definitive hematopoiesis culminates with the production of multipotent HSCs between the axial vessels in the zebrafish equivalent of the AGM region.

Supplementary material
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/134/23/4147/DC1

	ACKNOWLEDGMENTS

 
We thank Amy Kiger, Patricia Ernst and Wilson Clements for critical evaluation of the manuscript; Steve Renshaw for providing mpx:eGFP animals; David Kosman, Bill McGinnis, Samantha Zeitlin and Scott Holley for assistance with FISH techniques and confocal microscopy; Shutian Teng for performing initial CD45 WISH experiments; Shrey Purohit and Jason Reyes for assistance with progenitor cultures; Colin Jamora for microscope use; Adam O'Connor and Karen Ong for assistance with flow cytometry; and Roger Rainville, Evie Wright and Lisa Phelps for excellent animal care. Supported by the Irvington Institute for Immunological Research (J.Y.B.), the Cancer Research Prevention Foundation (D.L.S.), National Institutes of Health grant # DK074482, the March of Dimes Foundation, and the Arnold and Mabel Beckman Foundation (D.T.).

	Footnotes

 
^* These authors contributed equally to this work

	REFERENCES

TOP SUMMARY INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

Arpin, M., Friederich, E., Algrain, M., Vernel, F. and Louvard, D. (1994). Functional differences between L- and T-plastin isoforms. J. Cell Biol. 127,1995 -2008.[Abstract/Free Full Text]

Bertrand, J. Y., Jalil, A., Klaine, M., Jung, S., Cumano, A. and Godin, I. (2005a). Three pathways to mature macrophages in the early mouse yolk sac. Blood 106,3004 -3011.[Abstract/Free Full Text]

Bertrand, J. Y., Giroux, S., Golub, R., Klaine, M., Jalil, A., Boucontet, L., Godin, I. and Cumano, A. (2005b). Characterization of purified intraembryonic hematopoietic stem cells as a tool to define their site of origin. Proc. Natl. Acad. Sci. USA 102,134 -139.[Abstract/Free Full Text]

Burns, C. E., DeBlasio, T., Zhou, Y., Zhang, J., Zon, L. and Nimer, S. D. (2002). Isolation and characterization of runxa and runxb, zebrafish members of the runt family of transcriptional regulators. Exp. Hematol. 30,1381 -1389.[CrossRef][Medline]

Crowhurst, M. O., Layton, J. E. and Lieschke, G. J. (2002). Developmental biology of zebrafish myeloid cells. Int. J. Dev. Biol. 46,483 -492.[Medline]

Cumano, A. and Godin, I. (2007). Ontogeny of the hematopoietic system. Annu. Rev. Immunol. 25,745 -785.[CrossRef][Medline]

Cumano, A., Dieterlen-Lievre, F. and Godin, I. (1996). Lymphoid potential, probed before circulation in mouse, is restricted to caudal intraembryonic splanchnopleura. Cell 86,907 -916.[CrossRef][Medline]

Detrich, H. W., 3rd, Kieran, M. W., Chan, F. Y., Barone, L. M., Yee, K., Rundstadler, J. A., Pratt, S., Ransom, D. and Zon, L. I. (1995). Intraembryonic hematopoietic cell migration during vertebrate development. Proc. Natl. Acad. Sci. USA 92,10713 -10717.[Abstract/Free Full Text]

Dzierzak, E. (2005). The emergence of definitive hematopoietic stem cells in the mammal. Curr. Opin. Hematol. 12,197 -202.[CrossRef][Medline]

Evans, C. J., Hartenstein, V. and Banerjee, U. (2003). Thicker than blood: conserved mechanisms in Drosophila and vertebrate hematopoiesis. Dev. Cell 5, 673-690.[CrossRef][Medline]

Ferkowicz, M. J., Starr, M., Xie, X., Li, W., Johnson, S. A., Shelley, W. C., Morrison, P. R. and Yoder, M. C. (2003). CD41 expression defines the onset of primitive and definitive hematopoiesis in the murine embryo. Development 130,4393 -4403.[Abstract/Free Full Text]

Gekas, C., Dieterlen-Lievre, F., Orkin, S. H. and Mikkola, H. K. (2005). The placenta is a niche for hematopoietic stem cells. Dev. Cell 8,365 -375.[CrossRef][Medline]

Godin, I., Garcia-Porrero, J. A., Dieterlen-Lievre, F. and Cumano, A. (1999). Stem cell emergence and hemopoietic activity are incompatible in mouse intraembryonic sites. J. Exp. Med. 190,43 -52.[Abstract/Free Full Text]

Hartenstein, V. (2006). Blood cells and blood cell development in the animal kingdom. Annu. Rev. Cell Dev. Biol. 22,677 -712.[CrossRef][Medline]

Herbomel, P., Thisse, B. and Thisse, C. (1999). Ontogeny and behaviour of early macrophages in the zebrafish embryo. Development 126,3735 -3745.[Abstract]

Hsia, N. and Zon, L. I. (2005). Transcriptional regulation of hematopoietic stem cell development in zebrafish. Exp. Hematol. 33,1007 -1014.[CrossRef][Medline]

Hsu, K., Traver, D., Kutok, J. L., Hagen, A., Liu, T. X., Paw, B. H., Rhodes, J., Berman, J., Zon, L. I., Kanki, J. P. et al. (2004). The pu.1 promoter drives myeloid gene expression in zebrafish. Blood 104,1291 -1297.[Abstract/Free Full Text]

Hu, M., Krause, D., Greaves, M., Sharkis, S., Dexter, M., Heyworth, C. and Enver, T. (1997). Multilineage gene expression precedes commitment in the hemopoietic system. Genes Dev. 11,774 -785.[Abstract/Free Full Text]

Huang, S., Guo, Y. P., May, G. and Enver, T. (2007). Bifurcation dynamics in lineage-commitment in bipotent progenitor cells. Dev. Biol. 305,695 -713.[CrossRef][Medline]

Huttenhuis, H. B., Taverne-Thiele, A. J., Grou, C. P., Bergsma, J., Saeij, J. P., Nakayasu, C. and Rombout, J. H. (2006). Ontogeny of the common carp (Cyprinus carpio L.) innate immune system. Dev. Comp. Immunol. 30,557 -574.[CrossRef][Medline]

Jin, H., Xu, J. and Wen, Z. (2007). Migratory path of definitive hematopoietic stem/progenitor cells during zebrafish development. Blood 109,5208 -5214.[Abstract/Free Full Text]

Kalev-Zylinska, M. L., Horsfield, J. A., Flores, M. V., Postlethwait, J. H., Vitas, M. R., Baas, A. M., Crosier, P. S. and Crosier, K. E. (2002). Runx1 is required for zebrafish blood and vessel development and expression of a human RUNX1-CBF2T1 transgene advances a model for studies of leukemogenesis. Development 129,2015 -2030.[Medline]

Keller, G., Lacaud, G. and Robertson, S. (1999). Development of the hematopoietic system in the mouse. Exp. Hematol. 27,777 -787.[CrossRef][Medline]

Kinna, G., Kolle, G., Carter, A., Key, B., Lieschke, G. J., Perkins, A. and Little, M. H. (2006). Knockdown of zebrafish crim1 results in a bent tail phenotype with defects in somite and vascular development. Mech. Dev. 123,277 -287.[CrossRef][Medline]

Kosman, D., Mizutani, C. M., Lemons, D., Cox, W. G., McGinnis, W. and Bier, E. (2004). Multiplex detection of RNA expression in Drosophila embryos. Science 305, 846.[Abstract/Free Full Text]

Liao, E. C., Paw, B. H., Oates, A. C., Pratt, S. J., Postlethwait, J. H. and Zon, L. I. (1998). SCL/Tal-1 transcription factor acts downstream of cloche to specify hematopoietic and vascular progenitors in zebrafish. Genes Dev. 12,621 -626.[Abstract/Free Full Text]

Liao, E. C., Trede, N. S., Ransom, D., Zapata, A., Kieran, M. and Zon, L. I. (2002). Non-cell autonomous requirement for the bloodless gene in primitive hematopoiesis of zebrafish. Development 129,649 -659.[Abstract/Free Full Text]

Lichanska, A. M. and Hume, D. A. (2000). Origins and functions of phagocytes in the embryo. Exp. Hematol. 28,601 -611.[CrossRef][Medline]

Lin, H. F., Traver, D., Zhu, H., Dooley, K., Paw, B. H., Zon, L. I. and Handin, R. I. (2005). Analysis of thrombocyte development in CD41-GFP transgenic zebrafish. Blood 106,3803 -3810.[Abstract/Free Full Text]

McGrath, K. E. and Palis, J. (2005). Hematopoiesis in the yolk sac: more than meets the eye. Exp. Hematol. 33,1021 -1028.[CrossRef][Medline]

Meijer, A. H., van der Sar, A. M., Cunha, C., Lamers, G. E., Laplante, M. A., Kikuta, H., Bitter, W., Becker, T. S. and Spaink, H. P. (2007). Identification and real-time imaging of a myc-expressing neutrophil population involved in inflammation and mycobacterial granuloma formation in zebrafish. Dev. Comp. Immunol. doi.10.1016/j.dci.2007.04.003 .

Mikkola, H. K., Fujiwara, Y., Schlaeger, T. M., Traver, D. and Orkin, S. H. (2003). Expression of CD41 marks the initiation of definitive hematopoiesis in the mouse embryo. Blood 101,508 -516.[Abstract/Free Full Text]

Mitjavila-Garcia, M. T., Cailleret, M., Godin, I., Nogueira, M. M., Cohen- Solal, K., Schiavon, V., Lecluse, Y., Le Pesteur, F., Lagrue, A. H. and Vainchenker, W. (2002). Expression of CD41 on hematopoietic progenitors derived from embryonic hematopoietic cells. Development 129,2003 -2013.[Medline]

Miyamoto, T., Iwasaki, H., Reizis, B., Ye, M., Graf, T., Weissman, I. L. and Akashi, K. (2002). Myeloid or lymphoid promiscuity as a critical step in hematopoietic lineage commitment. Dev. Cell 3,137 -147.[CrossRef][Medline]

Murayama, E., Kissa, K., Zapata, A., Mordelet, E., Briolat, V., Lin, H. F., Handin, R. I. and Herbomel, P. (2006). Tracing hematopoietic precursor migration to successive hematopoietic organs during zebrafish development. Immunity 25,963 -975.[CrossRef][Medline]

Nerlov, C., Querfurth, E., Kulessa, H. and Graf, T. (2000). GATA-1 interacts with the myeloid PU.1 transcription factor and represses PU.1-dependent transcription. Blood 95,2543 -2551.[Abstract/Free Full Text]

Ottersbach, K. and Dzierzak, E. (2005). The murine placenta contains hematopoietic stem cells within the vascular labyrinth region. Dev. Cell 8, 377-387.[CrossRef][Medline]

Palis, J. and Yoder, M. C. (2001). Yolk-sac hematopoiesis: the first blood cells of mouse and man. Exp. Hematol. 29,927 -936.[CrossRef][Medline]

Palis, J., Robertson, S., Kennedy, M., Wall, C. and Keller, G. (1999). Development of erythroid and myeloid progenitors in the yolk sac and embryo proper of the mouse. Development 126,5073 -5084.[Abstract]

Renshaw, S. A., Loynes, C. A., Trushell, D. M., Elworthy, S., Ingham, P. W. and Whyte, M. K. (2006). A transgenic zebrafish model of neutrophilic inflammation. Blood 108,3976 -3978.[Abstract/Free Full Text]

Rhodes, J., Hagen, A., Hsu, K., Deng, M., Liu, T. X., Look, A. T. and Kanki, J. P. (2005). Interplay of pu.1 and gata1 determines myelo-erythroid progenitor cell fate in zebrafish. Dev. Cell 8,97 -108.[CrossRef][Medline]

Rombout, J. H., Huttenhuis, H. B., Picchietti, S. and Scapigliati, G. (2005). Phylogeny and ontogeny of fish leucocytes. Fish Shellfish Immunol. 19,441 -455.[CrossRef][Medline]

Tenen, D. G., Hromas, R., Licht, J. D. and Zhang, D. E. (1997). Transcription factors, normal myeloid development, and leukemia. Blood 90,489 -519.[Free Full Text]

Thisse, C., Thisse, B., Schilling, T. F. and Postlethwait, J. H. (1993). Structure of the zebrafish snail1 gene and its expression in wild-type, spadetail and no tail mutant embryos. Development 119,1203 -1215.[Abstract]

Thompson, M. A., Ransom, D. G., Pratt, S. J., MacLennan, H., Kieran, M. W., Detrich, H. W., 3rd, Vail, B., Huber, T. L., Paw, B., Brownlie, A. J. et al. (1998). The cloche and spadetail genes differentially affect hematopoiesis and vasculogenesis. Dev. Biol. 197,248 -269.[CrossRef][Medline]

Traver, D., Paw, B. H., Poss, K. D., Penberthy, W. T., Lin, S. and Zon, L. I. (2003). Transplantation and in vivo imaging of multilineage engraftment in zebrafish bloodless mutants. Nat. Immunol. 4,1238 -1246.[CrossRef][Medline]

Westerfield, M. (1994). The Zebrafish Book: A Guide for the Laboratory use of Zebrafish (Brachydanio rerio). Eugene, OR: University of Oregon Press.

Willett, C. E., Cortes, A., Zuasti, A